MOLECULAR MEDICINE REPORTS 13: 1119-1126, 2016

Molecular cloning and functional characterization of murine toll‑like receptor 8 TINGTING LI, XIAOBING HE, HUAIJIE JIA, GUOHUA CHEN, SHUANG ZENG, YONGXIANG FANG, QIWANG JIN and ZHIZHONG JING State Key Laboratory of Veterinary Etiological Biology, Key Laboratory of Veterinary Public Health of Ministry of Agriculture, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou, Gansu 730046, P.R. China Received January 20, 2015; Accepted November 5, 2015 DOI: 10.3892/mmr.2015.4668 Abstract. Toll‑like receptors (TLRs) are a large family of germ‑line encoded pattern recognition receptors (PRRs) that recognize pathogen‑associated molecular patterns and evoke the relevant innate immune responses. TLR8 is a member of several endosome nucleic acid‑sensing TLRs; however little attention has been paid to murine TLR8 (mTLR8) compared with other endosome nucleic acid‑sensing TLRs. In the present study, mTLR8 was cloned using reverse transcription‑polymerase chain reaction from murine peripheral blood mononuclear cells and its function in regulating innate immune response was characterized. The open reading frame of mTLR8 consists of 3,099 bps and encodes 1,032 amino acids. It contains typical leucine‑rich repeats, a transmembrane domain and a Toll/interleukin‑1 receptor domain, and it shares a high level of identity with other mammalian species. The expression of mTLR8 has been widely observed in different tissues, and higher expression levels of mTLR8 have mainly been detected in the heart, spleen and lung. Overexpression of mTLR8 is required for the activation of transcription factor nuclear factor‑κ B and the production of tumor necrosis factor‑α. However, mTLR8 is not able to activate interferon regulatory factor 3 or activator protein 1, nor can it induce interferon‑ α in HEK293T cells. These results indicate that mTLR8, as an important PRR, is indeed functional and is vital role in the activation of innate immune responses. This study may aid in determining the molecular basis of the interactions between mTLR8 and pathogens.

Correspondence to: Dr Zhizhong Jing, State Key Laboratory of Veterinary Etiological Biology, Key Laboratory of Veterinary Public Health of Ministry of Agriculture, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, 1 Xujiaping, Lanzhou, Gansu 730046, P.R. China E‑mail: [email protected]

Key words: mouse, toll‑like receptor 8, cloning, expression analysis, innate immune response

Introduction Toll‑like receptors (TLRs), an important family of germ‑line encoded pattern recognition receptors (PRRs), are responsible for the recognition of pathogen‑associated molecular patterns (PAMPs) from infectious pathogens. Up to now, 10 TLRs (TLR1‑10) have been identified in humans and 12 TLRs (TLR1‑9, TLR11‑13) in mice, and TLR1‑9 have been found to be conserved in the two species (1). TLR1, 2, 4, 5 and 6 are primarily expressed on the surface and predominantly recognize bacterial and fungal cell wall components and viral envelope proteins, as well as protozoal components (1,2). By contrast, the nucleic acid‑sensing TLRs, which include TLRs 3, 7, 8, 9 and 13, are localized within the endosomal compartments of immune cells and recognize double‑stranded RNA (dsRNA), single stranded RNA (ssRNA) and DNA derived from viruses, bacteria, fungi and parasites (1‑3). As an important family of type I transmembrane (TM) glycoprotein receptors, all TLRs are composed of an ectodomain (ECD) containing multiple leucine‑rich repeats (LRRs) directly involved in the recognition of PAMPs, a TM domain required for the sub‑cellular localization of TLRs, and an intracellular domain with a conserved cytoplasmic signaling region termed the Toll/IL‑1 receptor (TIR), which is required for the transduction of downstream signaling (4). Upon PAMP recognition, the cytoplasmic TIR domain of the TLRs recruits the adaptor molecules myeloid differentiation primary response gene 88 (MyD88) and/or TIR‑domain‑containing adaptor‑inducing interferon‑β (TRIF). This results in the activation of interferon regulatory factor 3 (IRF3), IRF7, activator protein 1 (AP‑1) and nuclear transcription‑κ B (NF‑κ B), as well as the transcription of inflammatory cytokines, chemokines, and type I interferons (IFNs) that rapidly initiate innate immune responses to ensure host protection (5). The human TLR8 (hTLR8) gene is located on the X chromosome, and can recognize ssRNA, short dsRNA, bacterial RNA, oligoribonucleotides and a large number of synthetic chemical agonists, such as imidazoquinolines (1‑4). However, although human TLR8 is able to recognize imidazoquinolines and initiate immune responses, murine TLR8 (mTLR8) is not activated by imidazoquinolines or ssRNA due to a five amino‑acid deletion in the ECD. As a result, mTLR8 was

1120

LI et al: MOLECULAR CLONING AND FUNCTIONAL CHARACTERIZATION OF MURINE TLR8

initially hypothesized to be non‑functional (1‑4,6). However, in 2006 it was revealed that mTLR8 could be activated by imidazoquinoline 3M‑002 combined with poly(dT)17 oligonucleotides (ODNs), leading to NF‑κ B activation and TNF‑α production (7), suggesting that mTLR8 is indeed functional. In support of this, a recent study reported that vaccinia virus (VACV) or vaccinia viral poly(A)/T‑rich DNA could activate NF‑κ B in an mTLR8‑dependent manner. In addition, synthetic poly(dA) and poly(dT) ODNs are capable of activating plasmacytoid DCs (pDCs) in an mTLR8‑dependent manner (8), suggesting that mTLR8 is a functional receptor, regulating innate immunity against VACV infection. However, research from another team has raised uncertainties about these results, not only because they found that poly A10 and two different polyT ODNs did not induce IFN‑ α or other cytokines in sorted FL‑pDCs or ex vivo‑isolated pDCs, but also because of the high levels of transcripted TLR7 and TLR9 in murine pDCs and not TLR8 (9). Notably, mTLR8 was found to inhibit TLR7‑sensing of 3M‑001 in HEK293T cells, and mTLR8‑/‑ DCs showed increased responses to various TLR7 ligands and NF‑κ B activation. These results indicate that TLR8 may directly modulate TLR7 function (10). In this study, to investigate the role of mTLR8 in regulating innate immune responses, mTLR8 cDNA isolated from peripheral blood mononuclear cells (PBMCs) was cloned and sequenced. It was found that mTLR8 conserved the typical domains of TLRs and had a high level of identity to other mammalian species. Higher expression levels of mTLR8 in the heart, spleen, and lung were also detected by reverse transcription‑quantitative polymerase chain reaction (RT‑qPCR). Furthermore, it was demonstrated that mTLR8 can induce nuclear factor (NF)‑κ B activation and tumor necrosis factor (TNF)‑ α production but not the activation of interferon‑sensitive response element (ISRE), AP‑1 activation and IFN‑ α production in HEK293T cells. Overall, these results provide a molecular foundation for further investigation into the potential role of mTLR8 in anti‑viral therapeutics, oncotherapy, autoimmune diseases and vaccine design. Materials and methods Animals and cells. C57BL/6 mice (n=30) were purchased from the Laboratory Animal Center of Lanzhou University (Lanzhou, China). Groups of 6‑10‑week‑old mice were selected for this study (Animals were treated in accordance with the Guide for the Care and Use of Laboratory Animals and approved by the Committee of Transgenic Bio‑safety Evaluation of Agriculture Ministry, Lanzhou, China). Animals were housed separately under 12 h light/dark cycles at a temperature of 22˚C and a humidity of 60%, with free access to food and water. HEK293T cells were purchased from the Type Culture Collection of the Chinese Academy of Science (Shanghai, China) and were maintained in complete Dulbecco's modified Eagle's medium (Gibco, Thermo Fisher Scientific Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (Gibco, Thermo Fisher Scientific Inc.), and 50 mg/ml penicillin/streptomycin (Shanghai Sangon Biological Engineering Biotechnology Company, Shanghai, China).

Tissue sample collection and total RNA isolation. The mice were sacrificed by enucleation of the eye using 2% pentobarbital sodium (Wuhan Kehaojia Biological Technology, Wuhan, China) and blood samples were collected for mononuclear cell isolation using lymphocyte separation medium (Sigma‑Aldrich, St. Louis, MO, USA). The heart, liver, spleen, lung, kidney, intestine and muscle were dissected, washed three times in phosphate‑buffered saline (PBS, pH 7.2) and immediately snap‑frozen in liquid nitrogen prior to being stored at ‑80˚C until required. Total RNA was extracted from the collected tissue samples and cells using Takara MiniBEST Universal RNA Extraction kit (Takara, Dalian, China) according to the manufacturer's instructions. The RNA quality was detected by 1% agarose gel electrophoresis (Shanghai Sangon Biological Engineering Biotechnology Company) which was stained with 10 µg/ml ethidium bromide (Shanghai Sangon Biological Engineering Biotechnology Company). The total RNA concentration was determined using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Inc.) and the optical density (OD)260:OD280 ratio of the RNA was between 1.8 and 2.0. Reverse transcription. Synthesis of the first strand of cDNA was performed with the Primescript 1st strand cDNA synthesis kit (Takara Bio Inc., Dalian, China) according to the manufacturer's instructions. Briefly, 800 ng RNA, 0.5 µl Oligo dT Primer (50 µM), 0.5 µl random 6 mers (50 µM), 1 µl dNTP mixture (10 mM) and an appropriate volume of RNase‑free water up to 10 µl were mixed gently. The mixture was heated to 65˚C for 5 min, and then quick‑chilled on ice. Then, the reverse transcription mixture was prepared as follows: 4 µl 5X PrimeScript Buffer, 0.5 µl RNase inhibitor (40 U/µl),1 µl PrimeScriptRTase (200 U/µl) and 4.5µl RNase free water were mixed with the above mixture. Cycle parameters of the RT procedure were 1 cycle of 30˚C for 10 min, 42˚C for 60 min, and 95˚C for 5  min. The cDNA were stored at ‑80˚C for mTLR8 cloning and relative quantification by PCR. Cloning of murine TLR8 cDNA and construction of pCMV‑tag2B‑TLR8 eukaryotic expression vector. Based on the murine genomic sequence obtained from the BLAST search, the primers c‑mTLR8‑F and c‑mTLR8‑R (Table I) were designed, and used to amplify the potential mTLR8cDNA by reverse transcription‑PCR from total RNA extracted from PBMCs. A pair of primers (c‑mTLR8) were designed based on the coding sequence (CDS) of Mus musculus TLR8 (GenBank ID: NM_133212) with Primer Premier 5.0 and with XhoI and KpnI site (underlined). The PCR was performed in a 50 µl reaction volume containing 4 µl of the first‑strand cDNA, 3 µl each of forward and reverse primers (10 µM), 10 µl 5X PrimeSTAR Buffer (including Mg2+; Takara Bio Inc.), 4 µl dNTP mixture, 0.5 µl PrimeSTAR HS DNA Polymerase (Takara Bio Inc.) and 25.5 µl sterile water. PCR conditions were as follows: Denaturation at 95˚C for 4 min, 30 cycles at 98˚C for 10 sec, 64˚C for 15 sec, 72˚C for 3 min 40 sec, with a final extension of 72˚C for 10 min. The PCR products were analyzed by electrophoresis on 1.0% agarose gel with 10 µg/ml ethidium bromide, and purified by a gel extraction kit (Axygen Scientific Inc., Union City, CA, USA). The purified products and the vector pCMV‑Tag2B

MOLECULAR MEDICINE REPORTS 13: 1119-1126, 2016

1121

Table I. Primers used for reverse transcription‑quantitative polymerase chain reaction. Gene Primer Sequence (5'‑3')

Amplicon length (bp)

GenBank accession no.

q‑mTLR8 Forward ACCTGAGCCACAATGGCATTTAC 121 NM_133212 Reverse TTGCCATCATTTGCATTCCAC β‑actin Forward CATCCGTAAAGACCTCTATGCCAAC 171 NM_007393 Reverse ATGGAGCCACCGATCCACA c‑mTLR8 Forward TTTCTCGAGATGGAAAACATGCCCCCTCAGTC 3099 NM_133212 Reverse CGGGGTACCCTAGTATTGCCTAATGGAATCAATG mTNF‑α Forward CAGGGTACCGTTTTCCGAGGGTTGAATGAG 243 GQ917239 Reverse CAGCTCGAGGTCTTTTCTGGAGGGAGATGTG mIFN‑α2 Forward CCGGGTACCCAGAGAGTGAAGTAAAGAAAGTG 180 X01969 Reverse TGTCTCGAGTGTGGGTCTTGCAGAGGTTGAT CTCGAG refers to XhoI site and GGTACC refers to KpnI site. TLR8, toll‑like receptor 8; TNF, tumor necrosis factor.

(Stratagene, La Jolla, CA, USA) were digested by XhoI and KpnI (Takara Bio Inc.) and the products were purified by electrophoresis and a gel extraction kit. The digested PCR product was inserted into the vector pCMV‑Tag2B. Proper construction was confirmed by sequencing and digesting with XhoI and KpnI and was termed pCMV‑Tag2B‑mTLR8. Sequence, structure and phylogenetic analysis. Amino acid sequences were aligned using the Clustal Omega on l i ne se quence a l ig n ment tool ( ht t p://w w w.ebi. ac.uk/Tools/msa/clustalo/) and the Sequence Manipulation Suite (SMS; http://www.bio‑soft.net/sms/), and the phylogenetics of the molecular evolutionary analysis were conducted using the MEGA 5.1 program (http://www.megasoftware.net/). Prediction of the mTLR8 and hTLR8 domains, motifs and features was performed on the SMART website (http://smart. embl‑heidelberg.de/). Swiss‑model (http://swissmodel.expasy. org/) was used to simulate the crystal structure of mTLR8. The predicted structure was analyzed and compared to that of hTLR8 (PDB ID: 3w3 g) using Swiss‑pdb Viewer 4.0.1 software (Swiss Institute of Bioinformatics). Construction of reporter plasmids, transfection and reporter luciferase assays. Murine TNF‑ α promoter region (GenBank ID: GQ917239) and IFN‑ α 2 promoter region (GenBanK ID: X01969) was amplified from murine genomic DNA, which was extracted from murine splenic lymphocytes, and then cloned into the pGL4.10 basic vector capable of expressing firefly luciferase. The primers are shown in Table I with KpnI and XhoI sites (underlined). HEK293T cells were seeded at a density of 2x105 cells/well in 500 µl culture medium into 24‑well plates and incubated. LyoVec (25 µl; Invivogen, San Diego, CA, USA) was brought to room temperature and gently vortexed to homogenize, after which it was mixed gently with 0.5 µg/well of pCMV‑Tag2B‑mTLR8 plasmid (pCMV‑Tag2B empty plasmid as controlled), 0.2 µg/well of the reporter plasmids including pGL4.32 [luc2P/NF‑ κ B‑RE/Hygro] vector, pGL4.44 [luc2P‑AP1‑RE‑Hygro] vector, pGL4.45

[luc2P‑ISRE‑Hygro] vector (Promega Corporation, Madison, WI, USA), TNF‑ α‑Luc and IFN‑ α2‑Luc, and 0.01 µg/well pGL4.74 [hRluc/TK] vector (Promega Corporation), in a sterile 0.5 ml microfuge tube. When the cells had grown to 70‑90% confluency, the culture medium was gently replaced with 475 µl opti‑MEM (Gibco, Thermo Fisher Scientific Inc.) and 25 µl LyoVec‑DNA complexes were directly added to the medium. The mixture was agitated to distribute the complexes uniformly and incubated for 24 h for the subsequent assay. After a 24‑h transfection, the dual luciferase reporter system was used to detect the luciferase activity (Promega Corporation), according to the manufacturer's protocol. The reporter assays were repeated three times in duplicate. Tissue distribution of murine TLR8 detected by RT‑qPCR. Primers for mTLR8 (q‑mTLR8) were designed based on the Mus musculus TLR8 cDNA sequence and β ‑actin was used as an internal reference gene to normalize target gene transcript levels (Table I). Quantitative PCR was performed with the Mx3005P Real‑time PCR detection system (Agilent Technologies Deutschland GmbH, Waldbronn, Germany). PCR was performed in 20 µl reactions with 2 µl of the cDNA sample, 0.8 µl each of the forward and reverse primers (10 µM), 6.4 µl DEPC‑treated water, and 10 µl 2xSYBR  Premix Ex Taq II (Takara Bio Inc.). The PCR parameters include 95˚C for 30 sec, 40 cycles at 95˚C for 5 sec and 60˚C for 34 sec, and then 95˚C for 15  sec, 60˚C for 1  min, and 95˚C for 15 sec. The primers for TLR8 and β ‑actin yielded a single peak in the melting curve and a single band of the expected size on an agarose gel. Data were analyzed according to the efficiency‑corrected comparative Cq method and normalized using β‑actin expression levels. Statistical analysis. All results represent the mean of three separate experiments. RT‑qPCR data are expressed as the mean ± standard deviation. The statistical significance of differences was assessed using Student's t‑test. P