Publisher: Taylor & Francis & British Poultry Science Ltd Journal: British Poultry Science DOI: 10.1080/00071668.2015.1020283
an us cr ip t
CBPS-2014-449 Ed. Kjaer, February 2015; Edited Hocking 11/02/2015
Molecular cloning and functional analysis of the goose FSHβ gene
Z. HUANG1, X. LI1, 2, Y. LI1, R. LIU1, Y. CHEN1, N. WU1, M. WANG1, Y. SONG1, X.
ed
M
YUAN1, L. LAN2, Q. XU1, G. CHEN1 AND W. ZHAO1
1
Jiangsu Key Laboratory for Animal Genetics, Breeding and Molecular Design, Yangzhou
pt
University and 2School of Animal Science and Technology, Jiangxi Agricultural University,
Ac
ce
Jiangxi, China.
Z. Huang and X. Li contributed equally to this work.
Correspondence to: W. Zhao, Jiangsu Key Laboratory of Animal Genetics, Breeding and Molecular Design, Yangzhou University, 12 East Wenhui Road, Yangzhou, Jiangsu 225009, China. Email: [email protected](W.Z.).
Abstract. 1. The objective of this investigation was to clone goose FSHβ-subunit cDNA, and to construct a FSH fusion gene to identify the function of FSHβ mRNA during stages of the breeding cycle. 2. The FSHβ gene was obtained by reverse transcription-PCR (RT-PCR), and the full-length FSHβ mRNA sequence was amplified by rapid-amplification of cDNA ends (RACE). FSHβ
an us cr ip t
mRNA expression was detected in reproductive tissues at different stages (pre-laying, laying period, and broody period). Additionally, the expression of 4 genes known to be involved in reproduction (FSHβ, GnRH, GH, and BMP) were evaluated in COS-7 cells expressing the fusion gene (pVITRO2-FSHαβ-CTP).
3. The results show that the FSHβ gene consists of a 16 base pair (bp) 5′-untranslated region (UTR), 396 bp open reading frame (ORF), and alternative 3′-UTRs at 518 bp and 780 bp,
M
respectively. qPCR analyses revealed that FSHβ mRNA is highly transcribed in reproductive
tissues, including the pituitary, hypothalamus, ovaries, and oviduct. FSHβ mRNA expression
ed
increased and subsequently decreased in the pituitary, ovaries, and oviduct during the reproductive stages. Stable FSH expression was confirmed using enzyme-linked
pt
immunosorbent assays (ELISA) after transfection with the pVITRO2-FSHαβ-CTP plasmid. FSHβ, GnRH, and BMP expression increased significantly 36 h and 48 h after transfection
ce
with the fusion gene in COS-7 cells.
Ac
4. The results demonstrate that the FSHβ subunit functions in the goose reproductive cycle, and provides a theoretical basis for future breeding work. INTRODUCTION
Follicle-stimulating hormone (FSH) is synthesised and secreted by gonadotropes and comprises two dissimilar subunits, alpha and beta (Jameson et al., 1988; Gharib et al., 1989). It acts in an endocrine manner and plays an essential role in the reproductive system,
including steroidogenesis, folliculogenesis, and follicular maturation (Hoi et al., 2005). It also regulates gonadal endocrine function (Moyle et al., 1994). In the goose, the FSHβ precursor molecule consists of 131 amino acids, including a 20 amino acid signal peptide followed by a mature protein of 111 amino acids encoded by the FSHβ cDNA. The effects of FSH on ovarian follicular development and growth have led to
an us cr ip t
the hypothesis that FSH enhances laying performance or egg production in the chicken;
however, the beta subunits of FSH vary in different species. This subunit confers specific biological actions and is responsible for interaction with the FSH receptor (Simoni et al., 1997).
Studies have shown that genetic variations in the FSHβ gene regulatory region and coding region are closely related to early sexual maturation and early egg laying in the
M
chicken (Ottinger et al., 2002; Xie et al., 2004). FSHβ gene levels are affected by light, food,
age, and other factors in chickens and thereby affect egg production. A polymorphism in exon
ed
3 of the FSHβ gene is related to egg traits in the Wulong goose (Chen, 2001; Livak and Schmitthen, 2001; Erdost, 2005;; Zhao et al., 2011). Because it is an important candidate gene
pt
for poultry breeding traits, FSHβ has been the focus of an increasing number of studies. The FSH gene is also related to broodiness behaviour (Jiang et al., 2010). Zhedong
ce
White geese have strong broodiness, whereas Yangzhou geese have weak broodiness. In this
Ac
study, the FSHα and FSHβ genes were cloned, and the full-length sequence of FSHβ mRNA was amplified using RACE. FSHβ mRNA expression was studied in different reproductive tissues and at different physiological stages. A specific fusion form of the goose FSH gene
was constructed and transfected into COS-7 cells. Expression activities as well as the expression level of FSHβ, GnRH, GH and BMP, genes that are related to reproductive traits, were also evaluated. The current study aims to comprehensively analyse FSH gene function in geese and to provide a theoretical basis for improving the reproductive performance and
regulation mechanisms of goose fecundity genes by understanding FSHβ mRNA expression during different physiological periods. MATERIALS AND METHODS
an us cr ip t
Animals and tissue sample collection Zhedong White geese (aged 380 d) and Yangzhou geese both (Anser anser) were obtained
from the National Waterfowl Germplasm Resource Gene Pool (Taizhou, China). The geese (n = 80) were slaughtered by exsanguination according to protocols approved by the Animal
Care Advisory Committee of Yangzhou University. Blood samples were collected for DNA frozen in liquid nitrogen. Tissues were stored at −80°C until RNA isolation.
M
DNA and RNA isolation, and cDNA synthesis
Genomic DNA was isolated using the TIANamp Genomic DNA kit according to the
ed
manufacturer’s instructions (Tiangen, Beijing, China). Total RNA was extracted from tissue samples or cells using RNAiso Plus (TaKaRa, Dalian, China) according to the manufacturer’s
pt
instructions. Total RNA concentrations were determined using a NanoDrop1000
ce
Spectrophotometer (Thermo Scientific, Waltham, MA, USA). After treatment with DNase I (Ambion, DNA-free kit), cDNA was transcribed using TransScriptFirst-Strand cDNA
Ac
Synthesis SuperMix (Tiangen, Beijing, China), and followed by PCR analyses. Cloning of the FSHβ gene The DNA and mRNA sequences of FSHβ (GenBank ID: EU563910.1) were amplified using the primers listed in Table 1. PCR was performed in 20-μl reactions containing 0.4 μl firststrand cDNA, 1 μl of each forward and reverse primers (10 μM), 7.6 μl DEPC-treated water, and 10 μl 2 × Taq PCR MasterMix (Tiangen, Beijing, China). Thermal cycling conditions were as follows: one cycle of 95°C for 5 min, followed by 32 cycles of 94°C for 30 s, 65°C
for 30 s, and 72°C for 2 min 30 s, and a final extension of 72°C for 10 min. PCR products were analysed by electrophoresis on 1.0% agarose gels, purified using a gel extraction kit (Dongsheng, Beijing, China), ligated into the pMD19-T Vector (TaKaRa,Qingdao, China), transformed into E. coli DH5α cells, and sequenced.
Table 1 near here
an us cr ip t
Construction of the FSH fusion gene FSHβ, CTP (cytoplasmic transduction peptide) and FSHα was amplified using specific
primers, with the pMD19-T-FSHβ, pMD19-T-CTP and pMD19-T-FSHα plasmids as templates, respectively. Primer FSHΒ-F introduced an Nde I site, and primer FSHΒ-R introduced an Xba I site (underlined in Table 2). After digestion with Nde I and Xba I, the FSHβ-CTP was inserted
into the vector pVITRO 2 -neo-mcs (Invitrogen, CA, USA) and the FSH fusion gene pVITRO2FSHβ-CTP was constructed. After digestion with EcoR V and Sal I, the FSHα was inserted
M
into the vector pVITRO2-FSHβ-CTP (Invitrogen, CA, USA) and the FSH fusion gene
pVITRO2-FSHαβ-CTP was constructed. Proper plasmid construction was confirmed by
ed
sequencing.
Table 2 near here
pt
Sequence analyses, multiple sequence alignment, and phylogenetic analyses
ce
Searches for nucleotide and protein sequence similarities were conducted using the BLAST algorithm from the National Center for Biotechnology Information (NCBI,
Ac
http://blast.ncbi.nlm.nih.gov/Blast.cgi). Based on the goose FSHβ sequence (GenBank ID: JN048668), primers pMD19-T-FSHΒ-F and pMD19-T-FSHΒ-R were designed and used to
amplify the potential FSHβ cDNA sequence from total RNA extracted from the ovary of a Zhedong White goose. Alignment of the FSHβ amino acid sequence and DNA was performed
using the ClustalW multiple alignment program (http://www.ebi.ac.uk/Tools/clustalw2/) and the Multiple Align Show program (http://www.bioinformatics.org/sms/). Using a neighbourjoining (NJ) algorithm, an unrooted phylogenetic tree was constructed based on the deduced
amino acid sequences of FSHβ using MEGA 5.20 software (http://www.megasoftware.net). To derive confidence values for tree nodes, bootstrap values were obtained for 1000 replications (Wilkins et al., 1999; Pearson et al., 1999).A phylogenetic tree was constructed from the FSHβ coding regions of 24 different species.
an us cr ip t
Real-Time quantitative PCR Primers were designed according to the sequences of FSHβ (GenBank ID: EU563910.1) and GAPDH (GenBank ID: DQ 485913.1). Primer sequences are listed in Table 1. Real-time quantitative PCR was performed using the Applied Biosystems 7500 Real-Time PCR
Detection System (Applied Biosystems, Foster City, CA, USA). Gene-specific primers are
listed in Table 1. Each PCR mixture contained 2 μl first-strand cDNA, 0.4 μl of each forward and reverse primer (10 μM), 6 μl DEPC-treated water, and 10 μl of 2× SYBR qPCR Mix
M
(TaKaRa). The PCR cycling conditions were as follows: 95°C for 10 s, followed by 40 cycles
ed
of 95°C for 15 s and 60°C for 30 s. Each primer pair yielded a single peak in the melting curve and a single band of the expected size on agarose gel analyses. The identities of the
pt
PCR products were confirmed by sequencing. The assays were carried out in triplicate. Data were analysed according to the efficiency-corrected comparative Ct method and normalised
ce
using GAPDH expression levels.
Ac
FSHβ expression in different tissues
To study the tissue distribution of FSHβ expression, we performed RT-PCR analyses on total
RNA isolated from the pituitary, hypothalamus, ovaries, and oviduct of healthy geese. Amplification was performed using the following cycling parameters: 30 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 30 s. Primer sequences are shown in Table 1. PCR products were visualised on 1.0% agarose gels. Expression levels were assessed by comparison with an internal standard, goose GAPDH. Each sample had three replicates.
COS-7 cell culture and transfection COS-7 cells (ATCC Number: CRL-1651) were derived from the kidney of Cercopithecus aethiops, the African Green Monkey, (ATCC, Manassas, Virginia, USA). COS-7 cells were maintained in Dulbecco’s modified Eagle media (DMEM) (Invitrogen) supplemented with
an us cr ip t
10% foetal bovine serum (FBS) (Invitrogen) at 37 °C in a 5% CO 2 humidified atmosphere. Media were replaced every 3 d. Twenty-four h prior to transfection, COS-7 cells were seeded in 24 well plates (Corning Inc., Corning, NY, USA) at a density of 2.0 × 105 cells/well. Cells were transfected with 2 μg of plasmid using Lipofectamine 2000 (Invitrogen). Transfected COS-7 cells (0.5 mL) were transferred to 24-well cell culture dishes containing 1.5 ml
DMEM supplemented with 10% FBS. Cells were collected 6 h, 12 h, 24 h, 36 h, and 48 h
analyses. Detection of FSH protein
M
after incubation at 37°C with 5% CO 2 . RNA was extracted and subjected to qRT-PCR
ed
The pVITRO2-FSHαβ-CTP plasmid was transfected into COS-7 cells, which were maintained in DMEM supplemented with 10% FBS at 37 °C in a 5% CO 2 humidified atmosphere. Cells
pt
were incubated for 12 h, 24 h, 36 h, and 48 h. Cells were isolated by centrifugation at 1500 x
ce
g for 10 min at 4°C, and the upper supernatant taken. Radioimmunoassay was performed using goose FSH radioimmunoassay kit (Jianchen, Nanjing, China) at the 5 time points. There
Ac
were three replicates for each sample. Statistical analyses Data are expressed as the mean ± standard deviation (SD). Student’s t-tests were used to examine differences in expression. RT-PCR data are expressed as the mean ± SD. One-way analysis of variance (ANOVA) and Tukey’s tests (V22.0, SPSS Inc., Chicago, IL, USA,
2013) were performed to assess the significance of between-treatment differences. P < 0.05 was considered statistically significant. RESULTS Cloning and sequence analyses of FSHβ
an us cr ip t
The coding sequence (CDS) of the FSHβ gene of the Zhedong White goose was determined
using full-length RT-PCR and long distance (LD) PCR. The gene contains a 5′-UTR of 16 bp and an open reading frame (ORF) of 396 bp (GenBank ID: KC777370). Two alternative
splice forms of the 3′-UTR (518 bp and 780 bp) were also identified. The gene contains three exons and two introns, and encodes 131 amino acid residues (Supplementary figure 1). The nucleotide sequence of FSHβ is nearly identical to that previously reported for goose (Li et
M
al., 2014). The nucleotide sequence shows 98.5% and 95.5% similarity with the FSHβ
sequences of duck and chicken, respectively. Alignment of the FSHβ amino acid sequences of
ed
various species is shown in the Supplementary figure. A phylogenetic tree for FSHβ based on 24 species is shown in Figure 1.
Figure 1 near here
pt
The goose (Anser anser) FSHβ sequence shows the highest sequence similarity with Anser
ce
cygnoides (swan goose) and Anas platyrhynchos (duck) FSHβ. The goose sequence also has high similarity with chicken, but the sequence similarity between goose and other species is
Ac
lower. As shown in Figure 1, mammals are clustered into one class and birds are clustered into
another. This phylogenetic tree is consistent with the genetic relationship of these species. These
data show that the FSHβ gene has been conserved within the evolutionary process. Expression of goose FSHβ mRNA during different physiological stages qRT-PCR results showed that the expression of FSHβ was higher in tissues and organs that are relevant to reproduction, including the pituitary, hypothalamus, ovaries, and oviduct. Therefore, we focused the study of FSHβ mRNA expression levels on these 4 tissues. The expression of
FSHβ mRNA in the 4 tissues was also examined using qRT-PCR during different reproductive periods (pre-laying, laying period, and broody period). As shown in Figure 3, the relative FSHβ mRNA expression levels in the tissues during the three reproductive periods were pituitary >oviduct >ovaries >hypothalamus. During the laying period (before laying; LB) in the pituitary, FSHβ mRNA expression was significantly higher than in the laying period (after laying; LA),
an us cr ip t
the pre-laying period (PP), or the broody period (BP) (P < 0.01). In the pituitary, hypothalamus, ovaries and oviduct, a general trend that the expression of FSHβ first increased and
subsequently decreased from the pre-laying period to the broody period was observed. Peak FSHβ expression occurred during the laying period.
Figure 2 near here
Expression of goose FSHβ mRNA in different breeds
FSHβ mRNA was detected using qRT-PCR in the laying period (before ovulation) of Zhedong
M
White goose and Yangzhou goose (Figure 3). As shown, in the laying period, FSHβ mRNA in
the pituitary of the Yangzhou goose was significantly higher than in the Zhedong White goose
ed
(P < 0.01), whereas there were no significant differences between the two breeds in FSHβ mRNA expression in the other three tissues (P > 0.05).
Figure 3 and 4 near here
pt
Changes in FSH protein secretion
ce
As shown in Figure 4, when pVITRO2-FSHαβ-CTP was expressed in COS-7 cells, FSH
Ac
protein secretion was not significantly affected. Thus, the expressed FSH protein is stable. Altered expression of related genes in FSH signalling pathways In order to analyse the effect of FSH signalling when cells were transfected with pVITRO2-
FSHαβ-CTP, the expression of related genes, including FSHβ, GH, GnRH, and BMP, using qRT-PCR were examined (Figure 5). Figure 5A shows that FSHβ gene expression varied from 6 h to 48 h, and its expression increased and peaked at 48 h. In the first 12 h after 5 nearand here transfection with pVITRO2-FSHαβ-CTP, GnRH expression Figure was maximal, its expression
subsequently decreased (Figure 5B). In addition, the expression of GH was highest at 12 h and 36 h, with a slight decrease at 24 h (Figure 5C). As shown in Figure 5D, the expression of BMP genes increased and peaked at 48 h in cells transfected with pVITRO2-FSHαβ-CTP. DISCUSSION
an us cr ip t
FSH is a pituitary gonadotropin synthesis gene in animals, and includes the FSHα and FSHβ subunits. The FSHβ subunit contains three exons and two introns in ducks, chickens, and
quail (Cai et al., 2009; Yang et al., 2009). The coding DNA region contains exon 2 and part of exon 3 and encodes 131 amino acids, including the signal peptide and mature peptide
(Keene et al., 1989). Studies have shown that FSHβ mRNA is the only gonadotropin with a long 3'-UTR (approximately 1100 bp and 2000 bp in mammals and poultry, respectively)
(Kikuehi et al., 1998; Shen and Yu, 2002). The 3'-UTR sequences may cause FSHβ mRNA
M
expression instability (Pesole et al., 2001; Zhang et al., 2002). The FSH gene has an important regulatory role during animal reproduction. In females, FSH and LH promote follicular
ed
development, maturation of the animal, granule cell proliferation, ovarian growth, as well as increasing the number of receptors and enhancing receptor binding. In males, FSH primarily
pt
exerts its biological effects by modulating the FSH receptor, including sperm growth and
ce
maturation and testicular growth (Niu et al., 2008). FSHβ is expressed in many tissues and organs, but its levels are increased in reproductive
Ac
tissues, such as the pituitary, hypothalamus, ovaries, and oviduct. It is possible that FSHβ is secreted by the pituitary and released via the hypothalamic-pituitary-gonad axis (HPG axis),
thereby causing higher FSHβ mRNA expression in the pituitary. FSHβ mRNA expression in the hypothalamus was also higher than in other tissues. One potential reason might be because FSH is primarily regulated by gonadotropins, and gonadotropins could promote FSHβ synthesis and secretion through the hypothalamus. These results are consistent with the expression levels of FSH in ovaries. In the current experiment, the pituitary secreted FSHβ
and the ovary may also express FSHβ. The level of FSH in serum could affect the expression of FSH receptors in the ovaries. There is a strong correlation between the levels of FSH and FSH receptor, and it is likely that the ovaries have a strong response to FSH during their development. FSHβ mRNA was not expressed in the glandular stomach. FSH, which the pituitary secretes through blood circulation to the target gonads, acts on specific receptors of
an us cr ip t
the gonads and exerts its biological effects there (Li et al., 2004).
FSHβ expression was low during the pre-laying period, peaked during the laying period,
and was lowest during the broody period. FSHβ gene expression showed growth volatility. FSHβ was produced to promote follicular development during the pre-laying period but
because the follicle had not matured, the expression of the FSH gene was lower. During the
laying period (before ovulation), in order to promote follicle formation, FSH was secreted and
M
stimulated follicle production, development, maturation and ovulation and FSHβ expression was higher. Additionally, the FSH gene is important for the process of follicle growth and
ed
maturity. During the broody period, goose ovaries stop ovulating and gradually atrophy, causing decreased secretion of FSHβ in the pituitary (Volkmer et al., 1996).
pt
There are currently no commercial goose cell lines. Therefore, it is difficult to perform experiments to detect goose protein expression. COS-7 cells are a commercially available cell
ce
line derived from the kidney of the African Green Monkey, Cercopithecus aethiops. In
Ac
poultry, COS-7 cells are often used to study protein function (Carosa et al., 1998; Kanda et al., 1999; Hatori et al., 2006; Hong et al., 2006a; Hong et al., 2006b). Currently, gene fusion technology is used to discover gene function both in research and
production. Studies have reported that when the FSHβ-CGB-α fusion gene was transfected into CHO cells, the protein was effectively secreted, and compared with the natural heterodimer, it had higher affinity with its receptor (Dirnberger et al., 2001). A single-chain FSHα-β fusion gene in bull was constructed. It was expressed in tobacco using the Tobacco mosaic virus (TMV) expression system, and the fusion protein was found to have normal
biological activity (Wang, 1993), therefore, activity of the fusion gene could be maintained, and cytoplasmic transduction peptide (CTP) could increase FSHβ expression and improve its stability. The CTP linker could promote gene expression and fusion gene secretion. The FSH fusion protein also has biological activity. The half-life of the FSH gene was extended by the gene fusion techniques; thus, FSH
an us cr ip t
became a long-term hormone. Based on further research regarding the molecular structure of
glycoprotein hormones, it was determined that the half-life of FSH in vivo is shorter (3.9 h on average) (Keutmann and Williams, 1977). This difference in half-life is because there is a 28 amino acid extension peptide (CTP) structure in the C-terminal of the CG protein β subunits (Birken and Canfield, 1977; Kessler et al., 1979; Boime and Ben-Menahem, 1999;
Marichatou et al., 2000), which contains 4 O-glycosylation sites, improving CG protein
M
quality, and decreasing the isoelectric point of the glycoprotein. The addition of CTP
sequences could extend the half-life of FSHβ, resulting in increased secretion. When the
ed
pVITRO2-FSHαβ-CTP plasmid was transfected into cells, FSH protein secretion remained stable. GnRH plays an important role regulating FSH secretion and release in the pituitary.
pt
Alternatively, it releases inhibition by increasing the expression of hormones (Dunn and Sharp, 1990; Altschul et al., 1997; Lal et al., 1999). When pVITRO2-FSHαβ-CTP was
ce
transfected into cells, expression of GnRH, GH, FSH, and BMP first increased and then
Ac
decreased. In cells transfected with pVITRO2-FSHαβ-CTP, GH gene expression increased. The GH and FSH genes had synergistic effects, and large-scale synthesis and secretion of FSH could promote GH gene expression, with GH promoting ovulation. Conclusions The results of this study show that FSHβ mRNA expression is closely related to the goose reproductive cycle. Therefore, it may be possible to alter the reproductive cycle of the goose
by changing the quantity of FSHβ released, and thereby improving egg production. The current data also provide the theoretical basis for future breeding work. ACKNOWLEDGMENTS This study was supported by the Earmarked Fund for Modern Agro-industry Technology
an us cr ip t
Research System (CARS-43-3) and the Nature Science Basic Research of Provincial Colleges and Universities affiliated with Jiangsu Province (No. 07KJB230138). We thank Zhen Zhu, Fei Zhai, Li Li, and Guanghui Rong for help with sample preparation. SUPPLEMENTARY INFORMATION
The supplementary figure can be accessed via the online version of this article at: http://dx.doi.org/?????????????
M
REFERENCES
ALTSCHUL, S.F.; MADDEN, T.L.; SCHAFFER, A.A.; ZHANG, J.; ZHANG, Z.; MILLER,
ed
W.; LIPMAN, D.J. (1997). Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic acids research, 25:3389–3402.
pt
BIRKEN, S.; CANFIELD, R.E. (1977). Isolation and amino acid sequence of COOH-terminal
ce
fragments from the beta subunit of human chorionic gonadotropin. Biological chemistry, 252:5386-5392.
Ac
BOIME, I.; BEN-MENAHEM, D. (1999). Glycoprotein hormone structure-function and analog design. Recent progress in hormone research, 54:271-288. CAI, J.; YANG, H.M.; LI, P.; GUO, L. (2009). Cloning and DNA sequence analysis of the cDNA for the precursor of Zi goose follicle stimulating hormone β subunit. China animal husbandry & veterinary medicine, 10:47-50. CAROSA, E.; FANELLI, A.; ULISSE, S.; DI LAURO, R.; RALL, J. E.; JANNINI, E. A. (1998). Ciona intestinalis nuclear receptor 1: a member of steroid/thyroid hormone receptor
family. Proceedings of the National Academy of Sciences of the United States of America, 95:11152-11157. CHEN, X.Y. (2001). Expression of follicle stimulating hormone by ovary. Journal of Hainan Medical College, 7:8-10. DIRNBERGER, D.; STEINKELLNER, H.; ABDENNEBI, L.; REMY, J. J.; VAN DE WIEL,
an us cr ip t
D. (2001). Secretion of biologically active glycoforms of bovine follicle stimulating hormone in plants. European journal of biochemistry, 268:4570-4579.
DUNN, I.C.; SHARP, P.J. (1990). Photo-induction of hypothalamic gonadotropin releasing hormone-I mRNA in the domestic chicken: a role for oestrogen. Neuro endocrinology, 11:371-375.
ERDOST, H. (2005). Immunolistochemical localization of FSH cells in the par distalis of the
sciences, 29:1125-1128.
M
pituitary gland in five-month -old laying hens. Turkish journal of veterinary & animal
ed
GHARIB, S. D.; A. ROY; M. E. WIERMAN AND W. W. (1989). Isolation and characterization of the gene encoding the beta-subunit of rat follicle-stimulating hormone.
pt
DNA, 8:339-349.
HATORI, M.; OKANO, T.; NAKAJIMA, Y.; FUKADA, Y. (2006). Lcg is a light-inducible
ce
and clock-controlled gene expressed in the chicken pineal gland. Journal of neurochemistry,
Ac
96:1790-1800.
HOI, J.H.; CHOI, K.C.; AUERSPERG, N.; LEUNG, P.C. (2005). Gonadotropins upregulate the epidermal growth factor receptor through activation of mitogen-activated protein kinases and phosphatidyl-inositol-3-kinase in human ovarian surface epithelial cells. Endocrinerelated cancer, 12:407-421. HONG, Y. H.; LILLEHOJ, H. S.; DALLOUL, R. A.; MIN, W.; MISKA, K. B.; TUO, W.; LILLEHOJ, E. P. (2006a). Molecular cloning and characterization of chicken NK-lysin. Veterinary immunology and immunopathology, 110:339-347.
HONG Y.H.; LILLEHOJ H.S.; LEE S.H.; PARK D.; LILLEHOJ E.P. (2006b). Molecular cloning and characterization of chicken lipopolysaccharide-induced TNF-alpha factor. Developmental and comparative immunology, 30:919-29. JAMESON, J.L.; BECKER, C.B.; LINDELL, C.M.; HABENER, J.F. (1988). Human follicle-
Molecular endocrinology, 2:806-815.
an us cr ip t
stimulating hormone beta-subunit gene encodes multiple messenger ribonucleic acids.
JIANG, R.S.; DU, X.D.; CHEN, X.Y.; GENG, Z.Y. (2010). Expression of pituitary FSH mRNA during reproduction cycle in wanxi white goose. Journal of china agricultural University, 15:84-88.
KANDA, M.; JABLONKA-SHARIFF, A.; SATO, A.; PIXLEY, R.M.; BOS, E.; HIRO’OKA, T.; BEN-MENAHEM, D.; BOIME, I.(1999). Genetic fusion of an alpha-subunit gene to the
M
follicle-stimulating hormone and chorionic gonadotropin-beta subunit genes: production of a biofunctional protein. Molecular endocrinology, 13:1873-1881.
ed
KEENE, J. L.; MATZUK, M. M.; OTANI, T.; FAUSER, B. C.; GALWAY, A. B.; HSUEH, A. J.; BOIME, I. (1989). Expression of biologically active human follitropin in Chinese
pt
hamster ovary cells. The Journal of biological chemistry, 264:4769-4775. KESSLER, M.J.; MISE, T.R.; HAI, D.G. (1979). Structure and location of the O-glycosidic
ce
carbohydrate units of human chorionic gonadotropin. Biological chemistry, 254:7909-7914.
Ac
KEUTMANN, H.T.; WILLIAMS, R.M. (1977). Human chorionic gonadotropin amino acid sequence of the hormone-specific COON-terminal region. Biological chemistry, 252:53935397.
KIKUEHI, M; KOBAYASHI, M; ITO, T; KATO, Y; ISHII, S. (1998). Cloning of complementary deoxyribonucleic acid for the follicle-stimulating hormone-beta subunit in the Japanese quail. Gen. Comp. Endocrinology, 111:376-385. LAL, P.; SHARP, P.J.; DUNN, I.C.; TALBOT, R.T. (1999). Absence of an effect of naloxone, an opioid antagonist, on luteinising hormone release in vivo and luteinising hormone releasing
hormone-I release in vitro in intact, castrated, and food restricted cockerels. General and comparative endocrinology, 77:239-245. LI, A.; WANG, H.; ZHU, M.X.; WANG, S.K.; WANG, C.K.; WANG, G.Y. (2004). The change regularity of the concentrations of reproductive hormone during the broody period in muscovy ducks. Acta Veterinaria et Zootechnica Sinica, 35:522-525.
an us cr ip t
LIVAK, K.J.; SCHMITTHEN, T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta ct) method. Methods, 25:402-408.
LI, X.X.;CHEN,Y.;YU,Q.M.;HE,J.J.;LAN,L.T.; CHEN,G.H. (2014). Cloning and sequence analyst of FSH beta subunit gene in goose. China Poultry, 36:7-15.
MARICHATOU, H.; MARTINAT, N.; GUILLOU, F.; COMBARNOUS, Y. (2000). Human chorionic gonadotropin with C-elongated a-subunit retains full receptor binding and partial
M
agonist activity. Endocrinology, 142:402-405.
MOYLE, W.R.; CAMPBELL, R.K.; MYERS, R.V.; BERNARD, M.P.; HAN, Y.; WANG, X.
ed
(1994). Co-evolution of ligand-receptor pairs. Nature, 368:251-255. NIU, X.T.; JANG R., GENG, Z.Y.; LIU, C.X; YUAN, S.Y. (2008). Single nucleotide
pt
polymorphisms of the exon 3 of FSHβ gene in goose. China Poultry, 9:16-18. OTTINGER, M.A.; KUBAKAWA, K.; KIKUEHI, M. (2002). Effects of exogenous
ce
testosterone on testicular luteinizing hormone and follicle-stimulating hormone receptors
Ac
during aging. Experimental biology and medicine, 227:830-836. PEARSON, W.R.; ROBINS, G.; ZHANG, T. (1999). Generalized neighbor-joining: More reliable phylogenetic tree reconstruction. Molecular biology and evolution, 16:806–816. PESOLE, G.; MIGNONE, F.; GISSI, C.; GRILLO, G.; LICCIULLI, F.; LIUNI, S. (2001). Structural and functional features of eukaryotic mRNA untranslated regions. Gene, 276:73-81 SHEN, S.T.; YU J Y. (2002). Cloning and gene expression of a cDNA for the chicken follicle-stimulating hormone-beta-subunit. Gen. Comp. Endocrinology, 125:375-386.
SIMONI, M.; J. GROMOLL AND E. NIESCHLAG. (1997). The follicle-stimulating hormone receptor: biochemistry, molecular biology, physiology, and pathophysiology. Endocrine reviews, 18:739-773. VOLKMER, H.; LEUSCHNER, R.; ZACHARIAS, U.; RATHJEN, F. G. (1996). Neurofascin induces neurites by heterophilic interactions with axonal NrCAM while NrCAM requires F11
an us cr ip t
on the axonal surface to extend neurites. The Journal of cell biology, 135:1059-1069.
WANG, J.C. (1993). Reproduction in Farm Animals. Endocrinology Agriculture Press, 41112.
WILKINS, M.R.; GASTEIGER, E.; BAIROCH, A.; SANCHEZ, J.C.; WILLIAMS, K.L.;
APPEL, R.D.; HOCHSTRASSER, D.F. (1999). Protein identification and analysis tools in the ExPASy server. Methods in molecular biology, 112:531–552.
M
XIE, M.N.; ZHANG, C.Q.; MI, Y.L.; MI, Y.L.; ZENG, W.D. (2004). Effects of follicle-
stimulating hormone and estrogen on development of embryonic chicken germ cell in vitro.
ed
Zoological Research, 25:53-56.
YANG, G.W.; ZHANG, D.J.; FU, X.K.; HE, X.M.; LIU, D. (2009). Research on expression
pt
of large white pig transthyretin gene on different days. China animal husbandry & veterinary medicine, 36:77-81.
ce
ZHANG, T; KRUYS, V; HUEZ, G; GUEYDAN, C. (2002). AU-rich element-mediated
Ac
translational control: complexity and multiple activities of trans-activating factors. Biochemical Society transactions, 30:952-958. ZHAO, X.T.; YANG, G.F.; SUN, Y.; ZHOU, Q.; WANG, X.B. (2011). Association of polymorphisms of GnRH, PRL and FSHβ genes with egg production traits in Wulong goose. China Poultry, 16:26-28.
FIGURE LEGENDS Figure 1. Phylogenetic analysis of goose FSHB. This unrooted tree was constructed using the neighbour-joining method within MEGA5.2. Bootstrap values were derived from 1000
Ac
ce
pt
ed
M
an us cr ip t
iterations.
Figure 2. Relative expression of FSHβ mRNA in different tissues of the Zhedong White goose at different physiological stages. Note: The y-axis indicates fold change in expression, and the x-axis shows the different tissues of goose; A, B, C, and D indicate the relative expression of FSHβ mRNA in pituitary, hypothalamus, ovaries, and oviduct, respectively. PP indicates the
an us cr ip t
pre-laying period; LB indicates the laying period (before ovulation); LA indicates the laying
period (after ovulation); BP indicates the broody period. The mRNA levels of individual FSHβ mRNA genes normalised to the housekeeping gene glyceraldehyde-3-phosphate
Ac
ce
pt
ed
M
dehydrogenase (GAPDH). * indicates P < 0.05, ** indicates P < 0.01.
Figure 3. Comparison of FSHβ expression between the Zhedong White goose and Yangzhou goose during the laying period. The y-axis indicates fold change in FSHβ mRNA expression, and the x-axis indicates the various tissues of goose. PY, HC, OY, and OT indicate the pituitary, hypothalamus, ovary, and oviduct, respectively. ZD indicates Zhedong White goose,
an us cr ip t
whereas YZ indicates Yangzhou goose. FSHβ mRNA was normalised to GAPDH. * indicates
Ac
ce
pt
ed
M
P < 0.05.
Figure 4. FSH protein concentration in the supernatants of COS-7 cells transfected with pVITRO2-FSHαβ-CTP. The y-axis indicates the concentration of FSH protein, whereas the x-
Ac
ce
pt
ed
M
an us cr ip t
axis indicates the time (h) after transfection.
Figure 5. Changes in mRNA expression following transfection of COS-7 cells with pVITRO2FSHαβ-CTP. A, B, C, and D indicate changes in expression of FSHβ, GnRH, GH, and BMP genes, respectively. The y-axis indicates fold change in expression, and the x-axis indicates
an us cr ip t
the time (h) after transfection with pVITRO2-FSHαβ-CTP. Cells were harvested at the
indicated times, RNA was prepared, and RT-PCR analyses were performed using GAPDH as an internal control. Significant differences in expression compared to the 6 h time point were calculated using two-directional paired student’s t-tests. * indicates P < 0.05 vs. 6 h, **
Ac
ce
pt
ed
M
indicates P < 0.01 vs. 6 h.
Sequence (5'→3')
Note
FSHα-F
ATGGATTGCTACAGGAAGT
Sequence
FSHα-R
TTAGGATTTATGGTAGTAGCAG
amplification
FSHβ-F
ATGAAGACACTTAACTGTTATGTGC
Sequence
FSHβ-R
TCATTGGTTGCTTCCATTCTGACT
amplification
hCTP-F
TCCTCTTCCTCAAAGGCCCCTC
Sequence
hCTP-R
TTATTGTGGGAGGATCGGGGTGT
amplification
FSH-F
CACCAGTATCATCCGTTCAGC
qRT-PCR
FSH-R
AAGATTCAGGATGGTCACC
FSHβ-Fa
TGGTGCTCAGGATACTGCTTCA
FSHβ-Ra
GTGCAGTCAGTGCTGTCAGTGTCA
FSH-F
CACCAGTATCATCCGTTCAGC
FSH-R
AAGATTCAGGATGGTCACC
GH-F
GACAACGCTATGATCCACGC
GH-R
TCTGAGAGCCAGAGAGGAGT
GnRH-F
CTGACTCTGTGTGTGGAGGG
GnRH-R
GGTGCATTCGAAGTGTTGGG
BMP-F
CTCTCTCCTCCCAAGGGTGA
qRT-PCR
BMP-R
GAAGTCAGCTCCTGCACCTT
GAPDH-F
CTCCTGTTCGAGAGTCAGCC
qRT-PCR
ed
TTCCCGTTCTCAGCCTTCAC
Ac
ce
pt
GAPDH-R
an us cr ip t
Primer name
M
Table 1. Primers used for gene cloning, mapping, and expression analyses
qRT-PCR qRT-PCR qRT-PCR qRT-PCR
Table 2. Primers used for vector construction Primer
Sequence (5'→3')
Note
FSHβ-F
GAAGATCTGCCACCATGAAGACACTTAACTGTTATGTGC
FSHβ
FSHβ-R
CCGCTCGAGTCATTGGTTGCTTCCATTCTGACT
name
GAAGATCTGCCACCATGAAGACACTTAACTGTTATGTGC
Y02
TTGAGGAAGAGGATTGGTTGC
Y03
AACCAATCCTCTTCCTCAAAGGCCCCT
Y04
CCGCTCGAGTTATTGTGGGAGGATCGGG
Y05
CCGATATCGCCACCATGGATTGCTACAGGAAGT
Y06
ACGCGTCGACTTAGGATTTATGGTAGTAGCAG
Y07
GAAGATCTGCCACCATGAAGACACTTAACTGTTATGTGC
Y08
TAGCAATCCATTTGTGGGAGGATCG
Y09
TCCTCCCACAAATGGATTGCTACAG
Y10
CCGCTCGAGTTAGGATTTATGGTAGTAGCAGGTA
FSHβ CTP
an us cr ip t
Y01
Ac
ce
pt
ed
M
Note: The underlined letters indicate the restriction sites.
FSHα
FSHβ-CTP FSHα
an us cr ip t
CBPS-2014-449 Ed. Kjaer, February 2015; Edited Hocking 11/02/2015
Molecular cloning and functional analysis of the goose FSHβ gene
Z. HUANG1, X. LI1, 2, Y. LI1, R. LIU1, Y. CHEN1, N. WU1, M. WANG1, Y. SONG1, X.
ed
M
YUAN1, L. LAN2, Q. XU1, G. CHEN1 AND W. ZHAO1
1
Jiangsu Key Laboratory for Animal Genetics, Breeding and Molecular Design, Yangzhou
pt
University and 2School of Animal Science and Technology, Jiangxi Agricultural University,
Ac
ce
Jiangxi, China.
Z. Huang and X. Li contributed equally to this work.
Correspondence to: W. Zhao, Jiangsu Key Laboratory of Animal Genetics, Breeding and Molecular Design, Yangzhou University, 12 East Wenhui Road, Yangzhou, Jiangsu 225009, China. Email: [email protected](W.Z.).
Abstract. 1. The objective of this investigation was to clone goose FSHβ-subunit cDNA, and to construct a FSH fusion gene to identify the function of FSHβ mRNA during stages of the breeding cycle. 2. The FSHβ gene was obtained by reverse transcription-PCR (RT-PCR), and the full-length FSHβ mRNA sequence was amplified by rapid-amplification of cDNA ends (RACE). FSHβ
an us cr ip t
mRNA expression was detected in reproductive tissues at different stages (pre-laying, laying period, and broody period). Additionally, the expression of 4 genes known to be involved in reproduction (FSHβ, GnRH, GH, and BMP) were evaluated in COS-7 cells expressing the fusion gene (pVITRO2-FSHαβ-CTP).
3. The results show that the FSHβ gene consists of a 16 base pair (bp) 5′-untranslated region (UTR), 396 bp open reading frame (ORF), and alternative 3′-UTRs at 518 bp and 780 bp,
M
respectively. qPCR analyses revealed that FSHβ mRNA is highly transcribed in reproductive
tissues, including the pituitary, hypothalamus, ovaries, and oviduct. FSHβ mRNA expression
ed
increased and subsequently decreased in the pituitary, ovaries, and oviduct during the reproductive stages. Stable FSH expression was confirmed using enzyme-linked
pt
immunosorbent assays (ELISA) after transfection with the pVITRO2-FSHαβ-CTP plasmid. FSHβ, GnRH, and BMP expression increased significantly 36 h and 48 h after transfection
ce
with the fusion gene in COS-7 cells.
Ac
4. The results demonstrate that the FSHβ subunit functions in the goose reproductive cycle, and provides a theoretical basis for future breeding work. INTRODUCTION
Follicle-stimulating hormone (FSH) is synthesised and secreted by gonadotropes and comprises two dissimilar subunits, alpha and beta (Jameson et al., 1988; Gharib et al., 1989). It acts in an endocrine manner and plays an essential role in the reproductive system,
including steroidogenesis, folliculogenesis, and follicular maturation (Hoi et al., 2005). It also regulates gonadal endocrine function (Moyle et al., 1994). In the goose, the FSHβ precursor molecule consists of 131 amino acids, including a 20 amino acid signal peptide followed by a mature protein of 111 amino acids encoded by the FSHβ cDNA. The effects of FSH on ovarian follicular development and growth have led to
an us cr ip t
the hypothesis that FSH enhances laying performance or egg production in the chicken;
however, the beta subunits of FSH vary in different species. This subunit confers specific biological actions and is responsible for interaction with the FSH receptor (Simoni et al., 1997).
Studies have shown that genetic variations in the FSHβ gene regulatory region and coding region are closely related to early sexual maturation and early egg laying in the
M
chicken (Ottinger et al., 2002; Xie et al., 2004). FSHβ gene levels are affected by light, food,
age, and other factors in chickens and thereby affect egg production. A polymorphism in exon
ed
3 of the FSHβ gene is related to egg traits in the Wulong goose (Chen, 2001; Livak and Schmitthen, 2001; Erdost, 2005;; Zhao et al., 2011). Because it is an important candidate gene
pt
for poultry breeding traits, FSHβ has been the focus of an increasing number of studies. The FSH gene is also related to broodiness behaviour (Jiang et al., 2010). Zhedong
ce
White geese have strong broodiness, whereas Yangzhou geese have weak broodiness. In this
Ac
study, the FSHα and FSHβ genes were cloned, and the full-length sequence of FSHβ mRNA was amplified using RACE. FSHβ mRNA expression was studied in different reproductive tissues and at different physiological stages. A specific fusion form of the goose FSH gene
was constructed and transfected into COS-7 cells. Expression activities as well as the expression level of FSHβ, GnRH, GH and BMP, genes that are related to reproductive traits, were also evaluated. The current study aims to comprehensively analyse FSH gene function in geese and to provide a theoretical basis for improving the reproductive performance and
regulation mechanisms of goose fecundity genes by understanding FSHβ mRNA expression during different physiological periods. MATERIALS AND METHODS
an us cr ip t
Animals and tissue sample collection Zhedong White geese (aged 380 d) and Yangzhou geese both (Anser anser) were obtained
from the National Waterfowl Germplasm Resource Gene Pool (Taizhou, China). The geese (n = 80) were slaughtered by exsanguination according to protocols approved by the Animal
Care Advisory Committee of Yangzhou University. Blood samples were collected for DNA frozen in liquid nitrogen. Tissues were stored at −80°C until RNA isolation.
M
DNA and RNA isolation, and cDNA synthesis
Genomic DNA was isolated using the TIANamp Genomic DNA kit according to the
ed
manufacturer’s instructions (Tiangen, Beijing, China). Total RNA was extracted from tissue samples or cells using RNAiso Plus (TaKaRa, Dalian, China) according to the manufacturer’s
pt
instructions. Total RNA concentrations were determined using a NanoDrop1000
ce
Spectrophotometer (Thermo Scientific, Waltham, MA, USA). After treatment with DNase I (Ambion, DNA-free kit), cDNA was transcribed using TransScriptFirst-Strand cDNA
Ac
Synthesis SuperMix (Tiangen, Beijing, China), and followed by PCR analyses. Cloning of the FSHβ gene The DNA and mRNA sequences of FSHβ (GenBank ID: EU563910.1) were amplified using the primers listed in Table 1. PCR was performed in 20-μl reactions containing 0.4 μl firststrand cDNA, 1 μl of each forward and reverse primers (10 μM), 7.6 μl DEPC-treated water, and 10 μl 2 × Taq PCR MasterMix (Tiangen, Beijing, China). Thermal cycling conditions were as follows: one cycle of 95°C for 5 min, followed by 32 cycles of 94°C for 30 s, 65°C
for 30 s, and 72°C for 2 min 30 s, and a final extension of 72°C for 10 min. PCR products were analysed by electrophoresis on 1.0% agarose gels, purified using a gel extraction kit (Dongsheng, Beijing, China), ligated into the pMD19-T Vector (TaKaRa,Qingdao, China), transformed into E. coli DH5α cells, and sequenced.
Table 1 near here
an us cr ip t
Construction of the FSH fusion gene FSHβ, CTP (cytoplasmic transduction peptide) and FSHα was amplified using specific
primers, with the pMD19-T-FSHβ, pMD19-T-CTP and pMD19-T-FSHα plasmids as templates, respectively. Primer FSHΒ-F introduced an Nde I site, and primer FSHΒ-R introduced an Xba I site (underlined in Table 2). After digestion with Nde I and Xba I, the FSHβ-CTP was inserted
into the vector pVITRO 2 -neo-mcs (Invitrogen, CA, USA) and the FSH fusion gene pVITRO2FSHβ-CTP was constructed. After digestion with EcoR V and Sal I, the FSHα was inserted
M
into the vector pVITRO2-FSHβ-CTP (Invitrogen, CA, USA) and the FSH fusion gene
pVITRO2-FSHαβ-CTP was constructed. Proper plasmid construction was confirmed by
ed
sequencing.
Table 2 near here
pt
Sequence analyses, multiple sequence alignment, and phylogenetic analyses
ce
Searches for nucleotide and protein sequence similarities were conducted using the BLAST algorithm from the National Center for Biotechnology Information (NCBI,
Ac
http://blast.ncbi.nlm.nih.gov/Blast.cgi). Based on the goose FSHβ sequence (GenBank ID: JN048668), primers pMD19-T-FSHΒ-F and pMD19-T-FSHΒ-R were designed and used to
amplify the potential FSHβ cDNA sequence from total RNA extracted from the ovary of a Zhedong White goose. Alignment of the FSHβ amino acid sequence and DNA was performed
using the ClustalW multiple alignment program (http://www.ebi.ac.uk/Tools/clustalw2/) and the Multiple Align Show program (http://www.bioinformatics.org/sms/). Using a neighbourjoining (NJ) algorithm, an unrooted phylogenetic tree was constructed based on the deduced
amino acid sequences of FSHβ using MEGA 5.20 software (http://www.megasoftware.net). To derive confidence values for tree nodes, bootstrap values were obtained for 1000 replications (Wilkins et al., 1999; Pearson et al., 1999).A phylogenetic tree was constructed from the FSHβ coding regions of 24 different species.
an us cr ip t
Real-Time quantitative PCR Primers were designed according to the sequences of FSHβ (GenBank ID: EU563910.1) and GAPDH (GenBank ID: DQ 485913.1). Primer sequences are listed in Table 1. Real-time quantitative PCR was performed using the Applied Biosystems 7500 Real-Time PCR
Detection System (Applied Biosystems, Foster City, CA, USA). Gene-specific primers are
listed in Table 1. Each PCR mixture contained 2 μl first-strand cDNA, 0.4 μl of each forward and reverse primer (10 μM), 6 μl DEPC-treated water, and 10 μl of 2× SYBR qPCR Mix
M
(TaKaRa). The PCR cycling conditions were as follows: 95°C for 10 s, followed by 40 cycles
ed
of 95°C for 15 s and 60°C for 30 s. Each primer pair yielded a single peak in the melting curve and a single band of the expected size on agarose gel analyses. The identities of the
pt
PCR products were confirmed by sequencing. The assays were carried out in triplicate. Data were analysed according to the efficiency-corrected comparative Ct method and normalised
ce
using GAPDH expression levels.
Ac
FSHβ expression in different tissues
To study the tissue distribution of FSHβ expression, we performed RT-PCR analyses on total
RNA isolated from the pituitary, hypothalamus, ovaries, and oviduct of healthy geese. Amplification was performed using the following cycling parameters: 30 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 30 s. Primer sequences are shown in Table 1. PCR products were visualised on 1.0% agarose gels. Expression levels were assessed by comparison with an internal standard, goose GAPDH. Each sample had three replicates.
COS-7 cell culture and transfection COS-7 cells (ATCC Number: CRL-1651) were derived from the kidney of Cercopithecus aethiops, the African Green Monkey, (ATCC, Manassas, Virginia, USA). COS-7 cells were maintained in Dulbecco’s modified Eagle media (DMEM) (Invitrogen) supplemented with
an us cr ip t
10% foetal bovine serum (FBS) (Invitrogen) at 37 °C in a 5% CO 2 humidified atmosphere. Media were replaced every 3 d. Twenty-four h prior to transfection, COS-7 cells were seeded in 24 well plates (Corning Inc., Corning, NY, USA) at a density of 2.0 × 105 cells/well. Cells were transfected with 2 μg of plasmid using Lipofectamine 2000 (Invitrogen). Transfected COS-7 cells (0.5 mL) were transferred to 24-well cell culture dishes containing 1.5 ml
DMEM supplemented with 10% FBS. Cells were collected 6 h, 12 h, 24 h, 36 h, and 48 h
analyses. Detection of FSH protein
M
after incubation at 37°C with 5% CO 2 . RNA was extracted and subjected to qRT-PCR
ed
The pVITRO2-FSHαβ-CTP plasmid was transfected into COS-7 cells, which were maintained in DMEM supplemented with 10% FBS at 37 °C in a 5% CO 2 humidified atmosphere. Cells
pt
were incubated for 12 h, 24 h, 36 h, and 48 h. Cells were isolated by centrifugation at 1500 x
ce
g for 10 min at 4°C, and the upper supernatant taken. Radioimmunoassay was performed using goose FSH radioimmunoassay kit (Jianchen, Nanjing, China) at the 5 time points. There
Ac
were three replicates for each sample. Statistical analyses Data are expressed as the mean ± standard deviation (SD). Student’s t-tests were used to examine differences in expression. RT-PCR data are expressed as the mean ± SD. One-way analysis of variance (ANOVA) and Tukey’s tests (V22.0, SPSS Inc., Chicago, IL, USA,
2013) were performed to assess the significance of between-treatment differences. P < 0.05 was considered statistically significant. RESULTS Cloning and sequence analyses of FSHβ
an us cr ip t
The coding sequence (CDS) of the FSHβ gene of the Zhedong White goose was determined
using full-length RT-PCR and long distance (LD) PCR. The gene contains a 5′-UTR of 16 bp and an open reading frame (ORF) of 396 bp (GenBank ID: KC777370). Two alternative
splice forms of the 3′-UTR (518 bp and 780 bp) were also identified. The gene contains three exons and two introns, and encodes 131 amino acid residues (Supplementary figure 1). The nucleotide sequence of FSHβ is nearly identical to that previously reported for goose (Li et
M
al., 2014). The nucleotide sequence shows 98.5% and 95.5% similarity with the FSHβ
sequences of duck and chicken, respectively. Alignment of the FSHβ amino acid sequences of
ed
various species is shown in the Supplementary figure. A phylogenetic tree for FSHβ based on 24 species is shown in Figure 1.
Figure 1 near here
pt
The goose (Anser anser) FSHβ sequence shows the highest sequence similarity with Anser
ce
cygnoides (swan goose) and Anas platyrhynchos (duck) FSHβ. The goose sequence also has high similarity with chicken, but the sequence similarity between goose and other species is
Ac
lower. As shown in Figure 1, mammals are clustered into one class and birds are clustered into
another. This phylogenetic tree is consistent with the genetic relationship of these species. These
data show that the FSHβ gene has been conserved within the evolutionary process. Expression of goose FSHβ mRNA during different physiological stages qRT-PCR results showed that the expression of FSHβ was higher in tissues and organs that are relevant to reproduction, including the pituitary, hypothalamus, ovaries, and oviduct. Therefore, we focused the study of FSHβ mRNA expression levels on these 4 tissues. The expression of
FSHβ mRNA in the 4 tissues was also examined using qRT-PCR during different reproductive periods (pre-laying, laying period, and broody period). As shown in Figure 3, the relative FSHβ mRNA expression levels in the tissues during the three reproductive periods were pituitary >oviduct >ovaries >hypothalamus. During the laying period (before laying; LB) in the pituitary, FSHβ mRNA expression was significantly higher than in the laying period (after laying; LA),
an us cr ip t
the pre-laying period (PP), or the broody period (BP) (P < 0.01). In the pituitary, hypothalamus, ovaries and oviduct, a general trend that the expression of FSHβ first increased and
subsequently decreased from the pre-laying period to the broody period was observed. Peak FSHβ expression occurred during the laying period.
Figure 2 near here
Expression of goose FSHβ mRNA in different breeds
FSHβ mRNA was detected using qRT-PCR in the laying period (before ovulation) of Zhedong
M
White goose and Yangzhou goose (Figure 3). As shown, in the laying period, FSHβ mRNA in
the pituitary of the Yangzhou goose was significantly higher than in the Zhedong White goose
ed
(P < 0.01), whereas there were no significant differences between the two breeds in FSHβ mRNA expression in the other three tissues (P > 0.05).
Figure 3 and 4 near here
pt
Changes in FSH protein secretion
ce
As shown in Figure 4, when pVITRO2-FSHαβ-CTP was expressed in COS-7 cells, FSH
Ac
protein secretion was not significantly affected. Thus, the expressed FSH protein is stable. Altered expression of related genes in FSH signalling pathways In order to analyse the effect of FSH signalling when cells were transfected with pVITRO2-
FSHαβ-CTP, the expression of related genes, including FSHβ, GH, GnRH, and BMP, using qRT-PCR were examined (Figure 5). Figure 5A shows that FSHβ gene expression varied from 6 h to 48 h, and its expression increased and peaked at 48 h. In the first 12 h after 5 nearand here transfection with pVITRO2-FSHαβ-CTP, GnRH expression Figure was maximal, its expression
subsequently decreased (Figure 5B). In addition, the expression of GH was highest at 12 h and 36 h, with a slight decrease at 24 h (Figure 5C). As shown in Figure 5D, the expression of BMP genes increased and peaked at 48 h in cells transfected with pVITRO2-FSHαβ-CTP. DISCUSSION
an us cr ip t
FSH is a pituitary gonadotropin synthesis gene in animals, and includes the FSHα and FSHβ subunits. The FSHβ subunit contains three exons and two introns in ducks, chickens, and
quail (Cai et al., 2009; Yang et al., 2009). The coding DNA region contains exon 2 and part of exon 3 and encodes 131 amino acids, including the signal peptide and mature peptide
(Keene et al., 1989). Studies have shown that FSHβ mRNA is the only gonadotropin with a long 3'-UTR (approximately 1100 bp and 2000 bp in mammals and poultry, respectively)
(Kikuehi et al., 1998; Shen and Yu, 2002). The 3'-UTR sequences may cause FSHβ mRNA
M
expression instability (Pesole et al., 2001; Zhang et al., 2002). The FSH gene has an important regulatory role during animal reproduction. In females, FSH and LH promote follicular
ed
development, maturation of the animal, granule cell proliferation, ovarian growth, as well as increasing the number of receptors and enhancing receptor binding. In males, FSH primarily
pt
exerts its biological effects by modulating the FSH receptor, including sperm growth and
ce
maturation and testicular growth (Niu et al., 2008). FSHβ is expressed in many tissues and organs, but its levels are increased in reproductive
Ac
tissues, such as the pituitary, hypothalamus, ovaries, and oviduct. It is possible that FSHβ is secreted by the pituitary and released via the hypothalamic-pituitary-gonad axis (HPG axis),
thereby causing higher FSHβ mRNA expression in the pituitary. FSHβ mRNA expression in the hypothalamus was also higher than in other tissues. One potential reason might be because FSH is primarily regulated by gonadotropins, and gonadotropins could promote FSHβ synthesis and secretion through the hypothalamus. These results are consistent with the expression levels of FSH in ovaries. In the current experiment, the pituitary secreted FSHβ
and the ovary may also express FSHβ. The level of FSH in serum could affect the expression of FSH receptors in the ovaries. There is a strong correlation between the levels of FSH and FSH receptor, and it is likely that the ovaries have a strong response to FSH during their development. FSHβ mRNA was not expressed in the glandular stomach. FSH, which the pituitary secretes through blood circulation to the target gonads, acts on specific receptors of
an us cr ip t
the gonads and exerts its biological effects there (Li et al., 2004).
FSHβ expression was low during the pre-laying period, peaked during the laying period,
and was lowest during the broody period. FSHβ gene expression showed growth volatility. FSHβ was produced to promote follicular development during the pre-laying period but
because the follicle had not matured, the expression of the FSH gene was lower. During the
laying period (before ovulation), in order to promote follicle formation, FSH was secreted and
M
stimulated follicle production, development, maturation and ovulation and FSHβ expression was higher. Additionally, the FSH gene is important for the process of follicle growth and
ed
maturity. During the broody period, goose ovaries stop ovulating and gradually atrophy, causing decreased secretion of FSHβ in the pituitary (Volkmer et al., 1996).
pt
There are currently no commercial goose cell lines. Therefore, it is difficult to perform experiments to detect goose protein expression. COS-7 cells are a commercially available cell
ce
line derived from the kidney of the African Green Monkey, Cercopithecus aethiops. In
Ac
poultry, COS-7 cells are often used to study protein function (Carosa et al., 1998; Kanda et al., 1999; Hatori et al., 2006; Hong et al., 2006a; Hong et al., 2006b). Currently, gene fusion technology is used to discover gene function both in research and
production. Studies have reported that when the FSHβ-CGB-α fusion gene was transfected into CHO cells, the protein was effectively secreted, and compared with the natural heterodimer, it had higher affinity with its receptor (Dirnberger et al., 2001). A single-chain FSHα-β fusion gene in bull was constructed. It was expressed in tobacco using the Tobacco mosaic virus (TMV) expression system, and the fusion protein was found to have normal
biological activity (Wang, 1993), therefore, activity of the fusion gene could be maintained, and cytoplasmic transduction peptide (CTP) could increase FSHβ expression and improve its stability. The CTP linker could promote gene expression and fusion gene secretion. The FSH fusion protein also has biological activity. The half-life of the FSH gene was extended by the gene fusion techniques; thus, FSH
an us cr ip t
became a long-term hormone. Based on further research regarding the molecular structure of
glycoprotein hormones, it was determined that the half-life of FSH in vivo is shorter (3.9 h on average) (Keutmann and Williams, 1977). This difference in half-life is because there is a 28 amino acid extension peptide (CTP) structure in the C-terminal of the CG protein β subunits (Birken and Canfield, 1977; Kessler et al., 1979; Boime and Ben-Menahem, 1999;
Marichatou et al., 2000), which contains 4 O-glycosylation sites, improving CG protein
M
quality, and decreasing the isoelectric point of the glycoprotein. The addition of CTP
sequences could extend the half-life of FSHβ, resulting in increased secretion. When the
ed
pVITRO2-FSHαβ-CTP plasmid was transfected into cells, FSH protein secretion remained stable. GnRH plays an important role regulating FSH secretion and release in the pituitary.
pt
Alternatively, it releases inhibition by increasing the expression of hormones (Dunn and Sharp, 1990; Altschul et al., 1997; Lal et al., 1999). When pVITRO2-FSHαβ-CTP was
ce
transfected into cells, expression of GnRH, GH, FSH, and BMP first increased and then
Ac
decreased. In cells transfected with pVITRO2-FSHαβ-CTP, GH gene expression increased. The GH and FSH genes had synergistic effects, and large-scale synthesis and secretion of FSH could promote GH gene expression, with GH promoting ovulation. Conclusions The results of this study show that FSHβ mRNA expression is closely related to the goose reproductive cycle. Therefore, it may be possible to alter the reproductive cycle of the goose
by changing the quantity of FSHβ released, and thereby improving egg production. The current data also provide the theoretical basis for future breeding work. ACKNOWLEDGMENTS This study was supported by the Earmarked Fund for Modern Agro-industry Technology
an us cr ip t
Research System (CARS-43-3) and the Nature Science Basic Research of Provincial Colleges and Universities affiliated with Jiangsu Province (No. 07KJB230138). We thank Zhen Zhu, Fei Zhai, Li Li, and Guanghui Rong for help with sample preparation. SUPPLEMENTARY INFORMATION
The supplementary figure can be accessed via the online version of this article at: http://dx.doi.org/?????????????
M
REFERENCES
ALTSCHUL, S.F.; MADDEN, T.L.; SCHAFFER, A.A.; ZHANG, J.; ZHANG, Z.; MILLER,
ed
W.; LIPMAN, D.J. (1997). Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic acids research, 25:3389–3402.
pt
BIRKEN, S.; CANFIELD, R.E. (1977). Isolation and amino acid sequence of COOH-terminal
ce
fragments from the beta subunit of human chorionic gonadotropin. Biological chemistry, 252:5386-5392.
Ac
BOIME, I.; BEN-MENAHEM, D. (1999). Glycoprotein hormone structure-function and analog design. Recent progress in hormone research, 54:271-288. CAI, J.; YANG, H.M.; LI, P.; GUO, L. (2009). Cloning and DNA sequence analysis of the cDNA for the precursor of Zi goose follicle stimulating hormone β subunit. China animal husbandry & veterinary medicine, 10:47-50. CAROSA, E.; FANELLI, A.; ULISSE, S.; DI LAURO, R.; RALL, J. E.; JANNINI, E. A. (1998). Ciona intestinalis nuclear receptor 1: a member of steroid/thyroid hormone receptor
family. Proceedings of the National Academy of Sciences of the United States of America, 95:11152-11157. CHEN, X.Y. (2001). Expression of follicle stimulating hormone by ovary. Journal of Hainan Medical College, 7:8-10. DIRNBERGER, D.; STEINKELLNER, H.; ABDENNEBI, L.; REMY, J. J.; VAN DE WIEL,
an us cr ip t
D. (2001). Secretion of biologically active glycoforms of bovine follicle stimulating hormone in plants. European journal of biochemistry, 268:4570-4579.
DUNN, I.C.; SHARP, P.J. (1990). Photo-induction of hypothalamic gonadotropin releasing hormone-I mRNA in the domestic chicken: a role for oestrogen. Neuro endocrinology, 11:371-375.
ERDOST, H. (2005). Immunolistochemical localization of FSH cells in the par distalis of the
sciences, 29:1125-1128.
M
pituitary gland in five-month -old laying hens. Turkish journal of veterinary & animal
ed
GHARIB, S. D.; A. ROY; M. E. WIERMAN AND W. W. (1989). Isolation and characterization of the gene encoding the beta-subunit of rat follicle-stimulating hormone.
pt
DNA, 8:339-349.
HATORI, M.; OKANO, T.; NAKAJIMA, Y.; FUKADA, Y. (2006). Lcg is a light-inducible
ce
and clock-controlled gene expressed in the chicken pineal gland. Journal of neurochemistry,
Ac
96:1790-1800.
HOI, J.H.; CHOI, K.C.; AUERSPERG, N.; LEUNG, P.C. (2005). Gonadotropins upregulate the epidermal growth factor receptor through activation of mitogen-activated protein kinases and phosphatidyl-inositol-3-kinase in human ovarian surface epithelial cells. Endocrinerelated cancer, 12:407-421. HONG, Y. H.; LILLEHOJ, H. S.; DALLOUL, R. A.; MIN, W.; MISKA, K. B.; TUO, W.; LILLEHOJ, E. P. (2006a). Molecular cloning and characterization of chicken NK-lysin. Veterinary immunology and immunopathology, 110:339-347.
HONG Y.H.; LILLEHOJ H.S.; LEE S.H.; PARK D.; LILLEHOJ E.P. (2006b). Molecular cloning and characterization of chicken lipopolysaccharide-induced TNF-alpha factor. Developmental and comparative immunology, 30:919-29. JAMESON, J.L.; BECKER, C.B.; LINDELL, C.M.; HABENER, J.F. (1988). Human follicle-
Molecular endocrinology, 2:806-815.
an us cr ip t
stimulating hormone beta-subunit gene encodes multiple messenger ribonucleic acids.
JIANG, R.S.; DU, X.D.; CHEN, X.Y.; GENG, Z.Y. (2010). Expression of pituitary FSH mRNA during reproduction cycle in wanxi white goose. Journal of china agricultural University, 15:84-88.
KANDA, M.; JABLONKA-SHARIFF, A.; SATO, A.; PIXLEY, R.M.; BOS, E.; HIRO’OKA, T.; BEN-MENAHEM, D.; BOIME, I.(1999). Genetic fusion of an alpha-subunit gene to the
M
follicle-stimulating hormone and chorionic gonadotropin-beta subunit genes: production of a biofunctional protein. Molecular endocrinology, 13:1873-1881.
ed
KEENE, J. L.; MATZUK, M. M.; OTANI, T.; FAUSER, B. C.; GALWAY, A. B.; HSUEH, A. J.; BOIME, I. (1989). Expression of biologically active human follitropin in Chinese
pt
hamster ovary cells. The Journal of biological chemistry, 264:4769-4775. KESSLER, M.J.; MISE, T.R.; HAI, D.G. (1979). Structure and location of the O-glycosidic
ce
carbohydrate units of human chorionic gonadotropin. Biological chemistry, 254:7909-7914.
Ac
KEUTMANN, H.T.; WILLIAMS, R.M. (1977). Human chorionic gonadotropin amino acid sequence of the hormone-specific COON-terminal region. Biological chemistry, 252:53935397.
KIKUEHI, M; KOBAYASHI, M; ITO, T; KATO, Y; ISHII, S. (1998). Cloning of complementary deoxyribonucleic acid for the follicle-stimulating hormone-beta subunit in the Japanese quail. Gen. Comp. Endocrinology, 111:376-385. LAL, P.; SHARP, P.J.; DUNN, I.C.; TALBOT, R.T. (1999). Absence of an effect of naloxone, an opioid antagonist, on luteinising hormone release in vivo and luteinising hormone releasing
hormone-I release in vitro in intact, castrated, and food restricted cockerels. General and comparative endocrinology, 77:239-245. LI, A.; WANG, H.; ZHU, M.X.; WANG, S.K.; WANG, C.K.; WANG, G.Y. (2004). The change regularity of the concentrations of reproductive hormone during the broody period in muscovy ducks. Acta Veterinaria et Zootechnica Sinica, 35:522-525.
an us cr ip t
LIVAK, K.J.; SCHMITTHEN, T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta ct) method. Methods, 25:402-408.
LI, X.X.;CHEN,Y.;YU,Q.M.;HE,J.J.;LAN,L.T.; CHEN,G.H. (2014). Cloning and sequence analyst of FSH beta subunit gene in goose. China Poultry, 36:7-15.
MARICHATOU, H.; MARTINAT, N.; GUILLOU, F.; COMBARNOUS, Y. (2000). Human chorionic gonadotropin with C-elongated a-subunit retains full receptor binding and partial
M
agonist activity. Endocrinology, 142:402-405.
MOYLE, W.R.; CAMPBELL, R.K.; MYERS, R.V.; BERNARD, M.P.; HAN, Y.; WANG, X.
ed
(1994). Co-evolution of ligand-receptor pairs. Nature, 368:251-255. NIU, X.T.; JANG R., GENG, Z.Y.; LIU, C.X; YUAN, S.Y. (2008). Single nucleotide
pt
polymorphisms of the exon 3 of FSHβ gene in goose. China Poultry, 9:16-18. OTTINGER, M.A.; KUBAKAWA, K.; KIKUEHI, M. (2002). Effects of exogenous
ce
testosterone on testicular luteinizing hormone and follicle-stimulating hormone receptors
Ac
during aging. Experimental biology and medicine, 227:830-836. PEARSON, W.R.; ROBINS, G.; ZHANG, T. (1999). Generalized neighbor-joining: More reliable phylogenetic tree reconstruction. Molecular biology and evolution, 16:806–816. PESOLE, G.; MIGNONE, F.; GISSI, C.; GRILLO, G.; LICCIULLI, F.; LIUNI, S. (2001). Structural and functional features of eukaryotic mRNA untranslated regions. Gene, 276:73-81 SHEN, S.T.; YU J Y. (2002). Cloning and gene expression of a cDNA for the chicken follicle-stimulating hormone-beta-subunit. Gen. Comp. Endocrinology, 125:375-386.
SIMONI, M.; J. GROMOLL AND E. NIESCHLAG. (1997). The follicle-stimulating hormone receptor: biochemistry, molecular biology, physiology, and pathophysiology. Endocrine reviews, 18:739-773. VOLKMER, H.; LEUSCHNER, R.; ZACHARIAS, U.; RATHJEN, F. G. (1996). Neurofascin induces neurites by heterophilic interactions with axonal NrCAM while NrCAM requires F11
an us cr ip t
on the axonal surface to extend neurites. The Journal of cell biology, 135:1059-1069.
WANG, J.C. (1993). Reproduction in Farm Animals. Endocrinology Agriculture Press, 41112.
WILKINS, M.R.; GASTEIGER, E.; BAIROCH, A.; SANCHEZ, J.C.; WILLIAMS, K.L.;
APPEL, R.D.; HOCHSTRASSER, D.F. (1999). Protein identification and analysis tools in the ExPASy server. Methods in molecular biology, 112:531–552.
M
XIE, M.N.; ZHANG, C.Q.; MI, Y.L.; MI, Y.L.; ZENG, W.D. (2004). Effects of follicle-
stimulating hormone and estrogen on development of embryonic chicken germ cell in vitro.
ed
Zoological Research, 25:53-56.
YANG, G.W.; ZHANG, D.J.; FU, X.K.; HE, X.M.; LIU, D. (2009). Research on expression
pt
of large white pig transthyretin gene on different days. China animal husbandry & veterinary medicine, 36:77-81.
ce
ZHANG, T; KRUYS, V; HUEZ, G; GUEYDAN, C. (2002). AU-rich element-mediated
Ac
translational control: complexity and multiple activities of trans-activating factors. Biochemical Society transactions, 30:952-958. ZHAO, X.T.; YANG, G.F.; SUN, Y.; ZHOU, Q.; WANG, X.B. (2011). Association of polymorphisms of GnRH, PRL and FSHβ genes with egg production traits in Wulong goose. China Poultry, 16:26-28.
FIGURE LEGENDS Figure 1. Phylogenetic analysis of goose FSHB. This unrooted tree was constructed using the neighbour-joining method within MEGA5.2. Bootstrap values were derived from 1000
Ac
ce
pt
ed
M
an us cr ip t
iterations.
Figure 2. Relative expression of FSHβ mRNA in different tissues of the Zhedong White goose at different physiological stages. Note: The y-axis indicates fold change in expression, and the x-axis shows the different tissues of goose; A, B, C, and D indicate the relative expression of FSHβ mRNA in pituitary, hypothalamus, ovaries, and oviduct, respectively. PP indicates the
an us cr ip t
pre-laying period; LB indicates the laying period (before ovulation); LA indicates the laying
period (after ovulation); BP indicates the broody period. The mRNA levels of individual FSHβ mRNA genes normalised to the housekeeping gene glyceraldehyde-3-phosphate
Ac
ce
pt
ed
M
dehydrogenase (GAPDH). * indicates P < 0.05, ** indicates P < 0.01.
Figure 3. Comparison of FSHβ expression between the Zhedong White goose and Yangzhou goose during the laying period. The y-axis indicates fold change in FSHβ mRNA expression, and the x-axis indicates the various tissues of goose. PY, HC, OY, and OT indicate the pituitary, hypothalamus, ovary, and oviduct, respectively. ZD indicates Zhedong White goose,
an us cr ip t
whereas YZ indicates Yangzhou goose. FSHβ mRNA was normalised to GAPDH. * indicates
Ac
ce
pt
ed
M
P < 0.05.
Figure 4. FSH protein concentration in the supernatants of COS-7 cells transfected with pVITRO2-FSHαβ-CTP. The y-axis indicates the concentration of FSH protein, whereas the x-
Ac
ce
pt
ed
M
an us cr ip t
axis indicates the time (h) after transfection.
Figure 5. Changes in mRNA expression following transfection of COS-7 cells with pVITRO2FSHαβ-CTP. A, B, C, and D indicate changes in expression of FSHβ, GnRH, GH, and BMP genes, respectively. The y-axis indicates fold change in expression, and the x-axis indicates
an us cr ip t
the time (h) after transfection with pVITRO2-FSHαβ-CTP. Cells were harvested at the
indicated times, RNA was prepared, and RT-PCR analyses were performed using GAPDH as an internal control. Significant differences in expression compared to the 6 h time point were calculated using two-directional paired student’s t-tests. * indicates P < 0.05 vs. 6 h, **
Ac
ce
pt
ed
M
indicates P < 0.01 vs. 6 h.
Sequence (5'→3')
Note
FSHα-F
ATGGATTGCTACAGGAAGT
Sequence
FSHα-R
TTAGGATTTATGGTAGTAGCAG
amplification
FSHβ-F
ATGAAGACACTTAACTGTTATGTGC
Sequence
FSHβ-R
TCATTGGTTGCTTCCATTCTGACT
amplification
hCTP-F
TCCTCTTCCTCAAAGGCCCCTC
Sequence
hCTP-R
TTATTGTGGGAGGATCGGGGTGT
amplification
FSH-F
CACCAGTATCATCCGTTCAGC
qRT-PCR
FSH-R
AAGATTCAGGATGGTCACC
FSHβ-Fa
TGGTGCTCAGGATACTGCTTCA
FSHβ-Ra
GTGCAGTCAGTGCTGTCAGTGTCA
FSH-F
CACCAGTATCATCCGTTCAGC
FSH-R
AAGATTCAGGATGGTCACC
GH-F
GACAACGCTATGATCCACGC
GH-R
TCTGAGAGCCAGAGAGGAGT
GnRH-F
CTGACTCTGTGTGTGGAGGG
GnRH-R
GGTGCATTCGAAGTGTTGGG
BMP-F
CTCTCTCCTCCCAAGGGTGA
qRT-PCR
BMP-R
GAAGTCAGCTCCTGCACCTT
GAPDH-F
CTCCTGTTCGAGAGTCAGCC
qRT-PCR
ed
TTCCCGTTCTCAGCCTTCAC
Ac
ce
pt
GAPDH-R
an us cr ip t
Primer name
M
Table 1. Primers used for gene cloning, mapping, and expression analyses
qRT-PCR qRT-PCR qRT-PCR qRT-PCR
Table 2. Primers used for vector construction Primer
Sequence (5'→3')
Note
FSHβ-F
GAAGATCTGCCACCATGAAGACACTTAACTGTTATGTGC
FSHβ
FSHβ-R
CCGCTCGAGTCATTGGTTGCTTCCATTCTGACT
name
GAAGATCTGCCACCATGAAGACACTTAACTGTTATGTGC
Y02
TTGAGGAAGAGGATTGGTTGC
Y03
AACCAATCCTCTTCCTCAAAGGCCCCT
Y04
CCGCTCGAGTTATTGTGGGAGGATCGGG
Y05
CCGATATCGCCACCATGGATTGCTACAGGAAGT
Y06
ACGCGTCGACTTAGGATTTATGGTAGTAGCAG
Y07
GAAGATCTGCCACCATGAAGACACTTAACTGTTATGTGC
Y08
TAGCAATCCATTTGTGGGAGGATCG
Y09
TCCTCCCACAAATGGATTGCTACAG
Y10
CCGCTCGAGTTAGGATTTATGGTAGTAGCAGGTA
FSHβ CTP
an us cr ip t
Y01
Ac
ce
pt
ed
M
Note: The underlined letters indicate the restriction sites.
FSHα
FSHβ-CTP FSHα
