Microbiol Immunol 2015; 59: 219–230 doi: 10.1111/1348-0421.12250
ORIGINAL ARTICLE
Molecular cloning and characterization of a sigma-class glutathione S-Transferase from the freshwater mussel Hyriopsis cumingii Haihua Li1,2, Ziyan Yang2, Qiang Huang1 and Yanxia Li3 1 Key Laboratory of Northwest Water Resources and Environmental Ecology of Education Ministry, Xi’an University of Technology, Xi’an, Shanxi Province 710048, China, 2School of Environment and Municipal Engineering, North China University of Water Resources and Electric Power, Zhengzhou, Henan Province 450011, China and 3SanQuan Medical College, Xinxiang, Henan Province 453003, China
ABSTRACT A full-length cDNA of a sigma-like glutathione S-transferase (GST) was identified from Hyriopsis cumingii (HcGSTS). The deduced amino acid sequence of HcGSTS was found to comprise 203 amino acid residues and to contain the distinct highly conserved glutathione binding site of N-terminal and the relatively diverse substrate binding site of C-terminal. Alignment analysis and phylogenetic relationship suggested that the HcGSTS is a sigma-class GST. The mRNA of HcGSTS was constitutively expressed in all tested tissues, the strongest expression being in the hepatopancreas. The mRNA expression of HcGSTS was significantly up-regulated (P < 0.05) in all assessed tissues after stimulation of the mussels with peptidoglycan (PGN) and LPS, the only exception being when the gills were challenged with PGN. The expression of HcGSTS mRNA in kidney and foot was also significantly up-regulated (P < 0.05) by microcystin-LR. Recombinant HcGSTS exhibited high activity towards the substrate 1-chloro-2,4-dinitrobenzene. The optimal pH was 8.0 and temperature 35 °C. Key words
biochemical characterization, expression pattern, glutathione S-transferase, Hyriopsis cumingii.
Glutathione S-transferases (EC 2.5.1.18) are a superfamily of multi-functional enzymes that play prominent roles against various harmful exogenous compounds, such as carcinogens, mutagens, environmental pollutants, drugs, pesticides and cellular-derived endogenous toxic compounds (1–3), and in protecting tissues against oxidative damage (4). GSTs are widespread in both prokaryotes and eukaryotes and catalyze the conjugation of GSH to various less soluble exogenous or endogenous toxic compounds containing electrophilic centers in order to transform them into soluble non-toxic products (5). Therefore, GSTs can potentially be used as indicators and biomarkers for assisting understanding of the impact of environmental changes at the
biochemical level and to serve as effective early warning tools in assessments of environmental health (6, 7). In recent decades, increasing water pollution has resulted in the exposure of aquatic organisms to a variety of xenobiotic compounds such as heavy metals, organic pollutants, industrial waste water and environmental endocrine disruptors (8). These xenobiotics may interact deleteriously with organisms, causing toxic and sometimes carcinogenic effects (9). However, organisms have evolved various strategies for protecting themselves against such continuous threats from the environment, including sequestration, scavenging and binding and catalytic biotransformation to (5). Because of their ability to detoxify environmental pollutants, GSTs in
Correspondence Ziyan Yang, School of Environment and Municipal Engineering, NorthChina University of Water Resources and Electric Power, Zhengzhou, Henan Province 450011, China. Tel: þ86 13 52350 9762; fax: þ86-0371-6579068; email: [email protected] Received 26 June 2014; revised 31 January 2015; accepted 5 February 2015. List of Abbreviations: CD, conserved domain; CDNB, 1-chloro-2,4-dinitrobenzene; GSH, glutathione; GST, glutathione S transferase; HcGSTS, full length cDNA of a sigma-like GST was identified from Hyriopsis cumingii; MC LR, microcystin LR; NJ, neighbor joining; PGN, peptidoglycan; RACE, rapid amplification of the cDNA ends; rHcGSTS, recombinant HcGSTS.
© 2015 The Societies and Wiley Publishing Asia Pty Ltd
219
Z. Yang et al.
aquatic invertebrates have been extensively used as biomarkers for monitoring aquatic environmental pollution (10–12). The GST superfamily has been subdivided into three major families: cytosolic, microsomal and mitochondrial GSTs (13). Now at least 15 classes of cytosolic GSTs have been recognized; namely, a, m, p, s, u, v, B, b, d, k, e, l, f, r and t (14, 15). Sigma-class GSTs, one of the largest GST subfamilies, have been identified in both vertebrate and invertebrate animals. They can inactivate lipoperoxidation products (16), catalyze biosynthetic reactions (17), and play important roles in terms of structure and metabolism. To date, the activities and degree of transcription of GSTs have been widely investigated in some aquatic species (18); however, study of GSTs in freshwater aquatic organisms, especially mussels, is thus far scanty. Some sigma-class GSTs have been cloned and described in aquatic mollusks, such as Haliotis diversicolor (19, 20), Ruditapes philippinarum (21), Mytilus edulis (22) and Solen grandis (23). Hyriopsis cumingii, an economically important freshwater pearl mussel species and aquatic environment monitoring animal, is widely cultured in southern China because of its great capacity to accumulate and tolerate environmental pollutants and because it provides a means of achieving ecological restoration of lakes that potentially pose risks for aquatic ecosystems and human health (24). Thus, study of the characteristics of GST isoenzymes and their capacity to achieve detoxification is essential and meaningful. In this study, we cloned the complete GST cDNA from H. cumingii, investigated the distribution of its transcripts and its expression pattern when challenged by LPS, PGN or MC-LR, and investigated the biochemical properties of recombinant HcGSTS.
Aldrich), 100 mL MC-LR from Microcystis aeruginosa (0.1 mg/ml in DMSO; Sigma–Aldrich), whereas the control group was injected with 100 mL PBS. Sampling was performed at 3, 6, 12, 24, 36 and 48 hr after LPS and PGN challenge, whereas the group challenged by MC-LR was sampled at 6, 12, 24, 36, 48 and 96 hr. To investigate the distribution of HcGSTS transcripts, various tissues were extracted from these healthy mussels, including hemocytes, hepatopancreas, gonad, kidney, intestine, gill, mantle, adductor muscle and foot. In addition, the expression profiles of HcGSTS transcripts were examined in tissues that had been challenged with LPS, PGN and MC-LR and obtained at the indicated times throughout the sampling process from the hepatopancreas, gonad, kidney, gill, and foot. Cloning the full-length cDNA of HcGST gene from H. cumingii
MATERIALS AND METHODS
Total RNA was extracted from the hepatopancreas of MC-LR-challenged mussels using TRIzol reagent according to the manufacturer's instructions (Invitrogen, Carlsbad, CA, USA). cDNA was then synthesized and amplified using a RevertAid first strand cDNA synthesis kit (MBI Fermentas, St Leon-Rot, Germany) according to the manufacturer's instructions. Two groups of specific primers, namely 50 GSP1, 50 GSP2, and 30 GSP1, 30 GSP2 were designed (Table 1) from the partial GST sequence (EST No.2-11) identified in the suppression subtractive hybridization cDNA library (29), whereas adaptor primers (UPM) were used for 50 and 30 RACE. The RACE reactions were performed using a SMART RACE cDNA amplification kit (Clontech, Palo Alto, CA, USA) according to the manufacturer's instructions and submitted for sequencing to Shanghai Sangon Biological Engineering Technology & Services (Shanghai, China).
Experimental animals and bacterial challenge
Sequence analysis
Approximately 2-year-old pearl mussels (H. cumingii) of average shell length 55 5 mm were obtained by aquaculture in Yueshan village, Ezhou city, China, and maintained in aerated fresh lake water at 20 1°C before the experiments. One hundred and sixty mussels were used in the stimulation experiment. The mussels were randomly divided into four groups, each of which contained 40 individuals. The test groups were injected with 100 mL LPS from Escherichia coli 055:B5 (1 mg/mL in PBS; Sigma–Aldrich, St Louis, MO, USA), 100 mL PGN from Staphylococcus aureus (1 mg/mL in PBS; Sigma–
Sequence similarity with other known proteins was analyzed using the BLAST program (25). Alignment of multiple sequences was performed with Clustal W (version 1.83). The theoretical signal peptides were predicted by SignalP 3.0 Server (26). A CD-Search service of NCBI's Conserved Domain Database (27) was performed to identify the CDs present. The SMART program (28) was used to predict the functional sites or domains in the amino acid sequences. A phylogenetic tree was constructed based on the deduced amino acid sequences using the NJ method with 1000 bootstrap replicates by means of MEGA v4.0 software.
220
© 2015 The Societies and Wiley Publishing Asia Pty Ltd
Molecular cloning of GST from mussel
Table 1. Primer sequences used in the present study Sequence (50 to 30 )
Feature
GGCCACGCGTCGACTAGTACT17 TGGTATCAACGCAGAGTCTAATACGACTCACTATAGGGC TTATGTCTGCGATAGCGACCTCTCA GCTTGCCATCCACTTC TCTATCCTCAAAGCTTTCTCCA CAGCCCAGATCGACCAAGTTATGGACCT GGAACCTGACAAGAAGAAAGACCTGGAAC TGTCCGTCTTCTTTCTGCTCTTC GGAAAACACTGGAGGTCAATACT GAGACAACCTACAACAGCATCAT GAAGCCAAAATGGGACCACCGAT AAGGGTACCATGAGCTTTGAGGATAGAAGGGTG GGAGAATTCGCGGGTGATTTGTCCAAGAGA
Universal primer Adaptor primer
Primer Oligo(dT)-adaptor UPM-long UPM-short 50 -GSP1 50 -GSP2 30 -GSP1 30 -GSP2 RT-GSTR RT-GSTF ActinF ActinR ExGSTF ExGSTR
Analysis of gene expression pattern of HcGSTS in H. cumingii using real-time quantitative PCR Real time quantitative PCR was performed with SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) on a CFX96 C1000 thermal cycler (Bio-Rad) to investigate the expression of HcGSTS. One pair of gene-specific primers (RT-GSTF and RT-GSTR) (Table 1) designed by Primer premier 5.0 for HcGSTS was used to amplify a 197 bp PCR product. Two b-actin primers, actin-F and actin-R (Table 1) were used to amplify a gene fragment of 218 bp as the internal control for qRTPCR. The amplification efficiency of all primers was determined by standard curves; primers with amplification efficiency between 0.95–1.0 were chosen for use in the present study. The sample qRT-PCR amplifications were carried out in triplicate along with the internal control gene in 96 well plates. All analyses were based on the CT values of the PCR products. The 2DDCTmethod was used to analyze the strength of expression of HcGSTS (30). The relative expression of target genes was normalized to the expression of b-actin and then expressed as a fold change relative to the corresponding control group. The data were subjected to one-way anova followed by an unpaired Student's t-test. Differences were considered significant at P < 0.05 and extremely significant at P < 0.01. Recombinant expression and purification of HcGSTS The open reading frame (including the stop codon) of the cDNA encoding HcGSTS was amplified by PCR with the upstream primer ExGSTF and the downstream primer ExGSTR (Table 1). The PCR product was cloned into pMD18-T simple vector (TaKaRa, Kyoto, Japan), © 2015 The Societies and Wiley Publishing Asia Pty Ltd
50 -RACE 30 -RACE Real time PCR Prokaryotic expression
and digested with Kpn I and EcoR I (TaKaRa), then cloned into the expression vector pET-30a (Novagen, Madison, WI, USA). The recombinant plasmid (pET30a-HcGSTS) was transformed into E. coli BL21 (DE3)-pLysS (Novagen). Colonies containing the appropriate insert were kept and the inserts checked by sequencing. Positive transformants were incubated in LB medium (containing 50 mg/mL ampicillin) at 28 °C with shaking at 220 rpm. When the OD (turbidity at 600 nm) of the culture mediums reached 0.4, isopropyl-h-dthiogalactoside was added to the recombinant HcGSTS culture at a final concentration of 0.5 mM and incubation continued for another 6 hr at 28 °C, after which the bacteria were harvested by centrifugation at 10,000 g for 10 min at 4 °C. The supernatant with rHcGSTs was purified by nickel affinity resin chromatography and pooled by elution with 100 mM imidazole. The concentration of the purified rHcGSTS was determined by the Bradford method (31) using BSA as the standard. Biochemical properties of rHcGSTS The activity assay of rHcGSTS was measured by a previously described method (32). Conjugation of the thiol group of GSH to the substrate CDNB was determined spectrophotometrically by monitoring changes in absorbance at 340 nm. The reaction was performed in a 1 mL reaction mixture containing 100 mM phosphate buffer, 10 mM reduced GSH and some rHcGSTS (pH 6.5). Then 1 mM CDNB substrate was added to the enzyme mixture after reaction at 25 °C for 5 min, after which absorbance at 340 nm was monitored for 5 min while maintaining the mixture at 25 °C. A non-enzymatic reaction was measured under the conditions described above. The changes in absorbance per minute were converted into amounts 221
Z. Yang et al.
of substrate conjugated/min/mg enzyme by using the molar extinction coefficient for CDNB e340 ¼ 9.6 mM1 cm1. The optimal pH and temperature for rHcGSTS were measured using CDNB as the substrate at pH ranges from 3.0 to 10.0 and temperatures from 20 °C to 50 °C.
were gathered together in the minimum cluster, and then clustered with sigma-GST of the other aquatic molluscan, suggesting they have a close evolutionary relationship.
RESULTS
The differential tissue-specific expression of HcGSTS was investigated by SYBR Green real-time PCR for multiple tissues from healthy mussels, including hemocytes, hepatopancreas, gonad, kidney, intestinal, gill, mantle, adductor muscle and foot, b-actin was used as an internal standard gene and the strength of expression of HcGSTS in the foot was used as a calibrator for other tissues. HcGSTS mRNA was found to be constitutively expressed to different degrees in a wide range of the tested tissues (Fig. 3). As observed, HcGSTS mRNA expression was strongest in the hepatopancreas, followed by the kidney, which were 1337.7- and 455.9-fold, respectively, that of the foot.
Molecular characterization of H. cumingii HcGSTS cDNA The cDNA sequence of H. cumingii GST sigma was affirmed by NCBI BLAST analysis and was designated HcGSTS (GenBank accession number KF479262). The full-length nucleotide sequence was 996 bp of HcGSTS cDNA and an open reading frame of 612 bp. The open reading frame encoded a polypeptide of 203 amino acids with a theoretical isoelectric point of 5.46 and predicted molecular weight of 23.3 kDa. The predicted protein sequence of HcGSTS was similar to GST_N_Sigma_like (PSSM: cd03039) and GST_C_Sigma_ like (PSSM: cd03192), containing a G-site (from Tyr4 to Arg73) that binds GSH in the N-terminal region and an H-site (from Trp83 to Lys183) which is a substrate binding site in the C-terminal. BLAST analysis revealed that the identity of HcGSTS sequence with other homologs ranged from 35% to 58%. The highest percentage of identity and similarity (58% and 76%, respectively) were with the GST homologue from the Manila clam R. philippinarum (Table 2). Given the multiple sequence alignments between HcGSTS and the other twelve sigma-class GSTs from aquatic mollusks, the N-terminal region of all the GSTs compared was highly homologous and conserved, whereas the C-terminal was relatively diverse (Fig. 1). In HcGSTS, the GSH binding moieties (G-site) include Tyr8, Arg14, Gln50, Ile51, Pro52, Gln63 and Ser64, and the substrate binding pocket (H-site) includes Glu96, Arg99, Arg100, Leu103, Lys104, Leu160 and Thr163. Phylogenetic relationship of HcGSTS To ascertain the evolutionary relationships among sigma GSTs, the deduced amino acid sequences of HcGSTS were aligned with 18 known sigma GSTs and 46 other class GSTs sequences obtained from GenBank, after which a phylogenetic tree was constructed with homologs using the NJ method, based on alignment (Fig. 2). Nine distinct groups, namely the classes s, m, p, a, u, d, B, v and k, were well separated in the phylogenetic tree. The same classes of GSTs were found to group together, HcGSTS being grouped in the sigmaclass GST cluster. HcGSTS and R. philippinarum GSTS1 222
The distribution of HcGSTS mRNA in various tissues
The expression pattern of HcGSTS gene in tissues after challenge with LPS, PGN and MC-LR Time-course experiments were performed to investigate temporal variations in HcGSTS transcription in vivo for up to 96 hr after challenge with LPS, PGN and MC-LR. Based on the results obtained by real-time quantitative PCR analysis, five tissues (the hepatopancreas, gonad, kidney, gill and foot) of H. cumingii were selected for evaluation of the expression pattern of HcGSTS gene. b-actin was used as an internal control gene. As shown in Figure 4a, in the LPS stimulation group, the HcGSTS gene exhibited a burst up-regulation in gill and foot (P < 0.05). Particularly in the gill, strong upregulation of expression was maintained for the first 12 hr; the highest value being 1097.3-fold that of the blank group at 3 hr post-stimulation. Similar variations in HcGSTS gene expression were found in the hepatopancreas, gill, gonad and foot, the greatest expression being observed at 3 hr post-stimulation and decreasing rapidly thereafter. In contrast, in the kidney the peak of up-regulation of expression of HcGSTS gene appeared relatively late, reaching its maximum at 12 hr post-stimulation. After the mussels were stimulated by PGN (Fig. 4b), expression in the hepatopancreas and gonad showed a similar trend, with significant greater expression at 12 hr (P < 0.05) in the challenged group than in the blank group. As time progressed, significant enhancement of up-regulation of HcGSTS expression in the kidney and foot was observed at 18 hr (293.6-fold) and 24 hr (19.9-fold), respectively (P < 0.05). But there © 2015 The Societies and Wiley Publishing Asia Pty Ltd
Molecular cloning of GST from mussel
Table 2. Percent identity and similarity between HcGSTS and homologs of various aquatic mollusks Molecular name RpGSTS1 CgGSTS CrGSTS CfGSTS2 MgGSTS3 HdGSTS1 MgGSTS1 HdGSTS2 SgGSTS MgGSTS2 HdGSTS RpGSTS
Species
Accession no.
Identity (%)
Similarity (%)
Ruditapes philippinarum Crassostrea gigas Crassostrea ariakensis Chlamys farreri Mytilus galloprovincialis Haliotis discus discus Mytilus galloprovincialis Haliotis discus discus Solen grandis Mytilus galloprovincialis Haliotis discus hannai Ruditapes philippinarum
AEW46325 CAE11863 ACJ06744 ADF32019 AFQ35985 ABO26602 AFQ35983 ABO26603 AEW43451 AFQ35984 ACE79171 ADI44317
58 46 44 46 41 40 37 37 40 39 42 36
76 67 65 64 64 65 61 63 61 63 64 61
was no significant difference in gill compared with that in the blank group (P < 0.05). In contrast, after challenge with MC-LR the HcGSTS gene expression pattern did not fluctuate significantly in the hepatopancreas, gill and gonad between most time points, the exception being slight up-regulation at 48 hr post-stimulation (Fig. 4c). In the foot, one high expression peak of HcGSTS gene was observed at 48 hr after MC-LR challenge. It is noteworthy that transcription of HcGSTS in the kidney exhibited a sudden up-regulation (P < 0.05), reaching a maximum at 48 hr poststimulation of 38.4-fold that of the blank group after it had returned to normal. Expression, purification and biochemical characterization of rHcGSTS Induction of the expression construct, pET30a-HcGSTS, resulted in production of high yields of the recombinant protein (Fig. 5a). The molecular mass of the purified fusion protein rHcGSTS was approximately 30 kDa by SDS–PAGE (Fig. 5b), indicating that the specific activity of purified soluble pET30a-HcGSTS towards the substrate CDNB is 4.54 0.08 mmol/min/mg (Table 3). Tests for pH and temperature effects were performed only for rHcGSTS using CDNB as the substrate (Fig. 6). rHcGSTS was found to possess a narrow activity range of pH, from 7.5 to 8.5 (Fig. 6a) and a relatively broader optimum temperature, ranging from 20 °C to 50 °C (Fig. 6b).
DISCUSSION In this study, the full-length cDNA sequence of HcGSTS was cloned in H. cumingii. BLAST analysis revealed that the HcGSTS gene shares 58% identity with sigma GST1 from R. philippinarum (AEW46325). It is generally © 2015 The Societies and Wiley Publishing Asia Pty Ltd
accepted that GSTs sharing more than 40% identity are grouped within a single class (3), whereas with less than 30% identity they are assigned to separate classes (5). Thus, our findings suggest that the GST gene of H. cumingii belongs to the family of the sigma class. In addition, the constructed phylogenetic tree a defined clustering of HcGSTS with other defined sigma class GSTs. Therefore, we named our gene sigma-class glutathione S-transferase of HcGSTS. In most organisms, the cytosolic GSTs are all dimeric with subunit molecular masses ranging from 21 to 29 kDa (5). The predicted molecular mass of HcGSTS is 23.3 kDa, which is in accordance with a previous report that sigma-class GSTs have average subunit molecular weights of 23 kDa (18). The predicted signal peptide cleavage and N-glycosylation sites of its deduced protein were not found, suggesting that HcGSTS is a cytosolic protein. Each GST is known to possess a conserved G-site (GSH binding site) in the N-terminal region, and a relatively diverse H-site (xenobiotic compound binding site), which accounts for the variability of GST enzyme activity (14, 18). Multiple sequence alignment of HcGSTS with other known sigma-class GSTs showed that HcGSTS not only has the distinct highly conserved GSH binding site, but also the relatively diverse substrate binding site (33); sigma-class GSTs rely on a Tyr residue for GSH stabilization in the G-site (18). This stabilization residue is a feature that the sigma-class shares with the ball-and-socket style cytosolic GSTs (34). Similar results were obtained in present study: it was found that HcGSTS may also bind and utilize glutathione as a substrate and may bind diverse xenobiotic compounds because of the variability of GST enzyme activity. A comparison of the enzymatic activities of HcGSTS and other bivalve molluscs GSTs towards the substrates CDNB and GSH is summarized in Table 3. The specific activities of RpGSTs and RpGSTu from Manila clam 223
Z. Yang et al.
Fig. 1. Multiple alignment of HcGSTS with known sigma class GST orthologs. Triangles indicate putative G-sites residues and dots putative H-sites residues. Identical amino acids are shaded in black. Other conserved, but not consensus amino acids, are shaded in gray. Sequences used for the analysis were GSTs from Ruditapes philippinarum (RpGSTS1; AEW46325), Crassostrea gigas (CgGSTS; CAE11863), Crassostrea ariakensis (CrGSTS; ACJ06744), Chlamys farreri (CfGSTS2; ADF32019), Mytilus galloprovincialis (MgGSTS3; AFQ35985), Haliotis discus discus (HdGSTS1; ABO26602), Mytilus galloprovincialis (MgGSTS1; AFQ35983), Haliotis discus discus (HdGSTS2; ABO26603), Solen grandis (SgGSTS; AEW43451), Mytilus galloprovincialis (MgGSTS2; AFQ35984), Haliotis discus hannai (HdGSTS; ACE79171) and Ruditapes philippinarum (RpGSTS; ADI44317).
224
© 2015 The Societies and Wiley Publishing Asia Pty Ltd
Molecular cloning of GST from mussel
Fig. 2. Phylogenetic analysis of HcGSTS from H. cumingiiwith other known vertebrate and invertebrate sigma GSTs orthologs and members of other classes of GSTs. The tree was constructed by the NJ algorithm using the Mega 4.1 program based on the multiple sequence alignment by ClustalW. Bootstrap values of 1000 replicates (%) are indicated for the branches.
© 2015 The Societies and Wiley Publishing Asia Pty Ltd
225
Z. Yang et al.
Fig. 3. Distribution of HcGSTS mRNA transcripts in various tissues of normal mussels detected by RT-PCR. Vertical bars represented the mean SD (n ¼ 3).
toward CDNB were 4.64 0.17 and 6.43 0.03 mmol/ min/mg, respectively (21, 35). The activities of HdGSTS1 and HdGSTS2 from abalone were 0.17 0.01 and 1.06 0.02 mmol/min/mg, respectively (20). Thus, different classes of GSTs have varying activities and the same class of GSTs from different species also have varying enzyme activities. The specific activity of HcGSTS was found to be 4.54 0.08 mmol/min/mg, which is similar to that of RpGSTs, indicating that these GSTs have similar affinity for the substrate CDNB. The optimum pH of rHcGSTS is about pH 8.0, which is very close to the previously reported optimal pHs for RpGSTs and TsMGSTs (21, 36). rHcGSTS exhibited a relatively broad range of optimum temperatures, from 20 °C to 50 °C, which is similar to the range of HdGSTS2 (20), suggesting that the recombinant loses enzymatic activity when the pH is increased and is able to retain reasonable activity at high temperatures. It was found that GSTs were distributed in all tissues of the organism. The tissue distribution of GSTs in aquatic invertebrates is very variable because of differences in primary structures, enzyme properties, and physiological functions. For example, in the rock shell Thais clavigera, m-class GSTs are predominantly expressed in the gill, followed by kidney and muscle (37), whereas in R. philippinarum the greatest expression of uclass GSTs is in hemocytes, followed by the gill and mantle (35). Strong expression of GSTs in the hepatopancreas has been reported in shrimp (38), Solen grandis (23), mussel (39) and crab (40). In addition, investigations of the tissue distribution of sigma-GSTs in aquatic organisms have revealed that sigma-GSTs are generally abundantly expressed in the hepatopancreas, gills, hemocytes and gonad (19–21, 23, 41), which suggests that different distributions of GST in tissues are 226
associated with differential detoxification and innate immune response. In the present study, strong HcGSTS expression was found in the hepatopancreas, gonad and kidney; thus, it is mostly distributed in detoxificationand immune-related organs, suggesting that HcGSTS is involved in some detoxification and immune modulation functions. Expression of HcGSTS was much greater in the hepatopancreas than in other tissues, suggesting that the hepatopancreas is the major organ for detoxification of xenobiotics (42). Glutathione S-transferases are well-known antioxidant proteins that not only detoxify a wide range of environmental pollutants, but are also expressed in response to biological stressors such as infectious agents (21). Recently, several marine GSTs have been found to be involved in immune responses against bacterial pathogens and that exposure of various pathogens leads to the up-regulation of GSTs in abalone (19), Manila clam (43), crab (40), pearl oyster (44) and freshwater mussel (39). In the present study, the bacterial components LPS and PGN, which are useful reagents for evaluating immune responses against gram-negative and gram-positive bacteria, respectively, were used to stimulate H. cumingii. It was found that expression of HcGSTS after challenge by LPS is significantly up-regulated in all tissues tested, supporting the contention that HcGSTS plays a role in the immune functions of organisms, consistent with previous reports. However, some of the present findings differed from those other studies. For example, HcGSTS mRNA expression in the gill after LPS challenge was significantly greater at 3, 6, and 12 hr, the expression peak being observed at 3 hr, whereas in the gill of LPS-injected clams, the greatest expression of RpGSTs and RpGSTu gene was at 48 and 12 hr, respectively (21, 35). These differences may be related to species specificity and the status of the test animals. There is little published information about the transcriptional profile of GSTs challenged by gram-positive bacteria. In our investigation, after mussels had been stimulated by PGN, the transcript expression of HcGSTS was up-regulated to different degrees in the hepatopancreas, gonad, kidney and foot. There is reportedly a burst of up-regulation of transcription of SgGST-S1 mRNA in hemocytes of razor clams after stimulation by PGN, implying that not only biological toxicity, but also the microparticle characteristics of PGN involved in initiation of phagocytosis, are responsible for the up-regulation of expression of GSTs (23). In the present study, LPS more strongly induced expression of the HcGSTS gene than did PGN, suggesting that HcGSTS is more sensitive to the immune response after invasion by gram-negative bacterial pathogens. © 2015 The Societies and Wiley Publishing Asia Pty Ltd
Molecular cloning of GST from mussel
Fig. 4. Temporal expression of HcGSTS mRNA in various tissues after challenge with (a) LPS, (b) PGN and(c) MC-LR as assessed by SYBR Green real-time RT-PCR. Statistical analysis of differences between the untreated control and the challenged groups was performed by one-way anova using SPSS 13.0 software. *, P < 0.05 (n ¼ 3).
In addition, GSTs activity can be induced by variety of xenobiotics, such as heavy metals (45), insecticides (46), polycyclic aromatic hydrocarbons (47), polychlorinated biphenyls (48), tributyltin and estrogen (49), benzo[a] pyrene (B[a]P) and polybrominated diphenyl ethers (17, 41), indicating that GSTs have great potential as biomarkers of exposure to environmental pollutants. To investigate whether xenobiotic compounds are involved in induction of HcGSTS, in the present study H. cumingii were challenged with an environmental © 2015 The Societies and Wiley Publishing Asia Pty Ltd
toxin of water (MC-LR) that is produced by freshwater cyanobacteria and can cause animal intoxications and human diseases, after which the expression patterns of HcGSTS were determined. After mussels had been stimulated by MC-LR, expression of HcGSTS mRNA was significantly up-regulated in the kidney and foot. Increase in GSTs activity has been shown to be induced by microcystins in aquatic organisms (50, 51). Additionally, transcription of VGST, mGST and GST2membrane-sssociated proteins in eicosanoid and 227
Z. Yang et al.
Fig. 5. Expression and purification of soluble rHcGSTS fused protein in E.coli BL21 (DE3). (a) Protein samples were separated by SDSPAGE and stained with Coomassie brilliant blue R-250. Lane M, protein marker; lanes 1–4, pET30a-HcGSTS induced 2, 4, 6, and 8 hr, respectively. (b) Purified combined protein. Lane M, protein marker; lanes 1–4,: concentration of 20 mmol/L, 60 mmol/L, 100 mmol/L and 250 mmol/L imidazole, respectively, when purifying the combined protein.
Fig. 6. Biochemical characterization of HcGSTS. The optimum pH and temperature for CDNB-GSH complex formation in the presence of HcGSTS were determined by measuring absorbance at 340 nm. (a) Optimum pH was measured in the range of 3–10 under the same experimental conditions. (b) Optimum temperature was measured in the range of 20°C–50°C.
Table 3. Specific activity of different GST family members toward the substrate CDNB Organism
GST name
Specific activity (mmol/min/mg)
Reference
Hyriopsis cumingii Cristaria plicata Ruditapes philippinarum Ruditapes philippinarum Haliotis discus discus Haliotis discus discus Mytilus edulis Perna perna
HcGSTS Cp-piGST RpGSTs RpGSTu HdGSTS1 HdGSTS2 GST GST
4.54 0.08 1.706 0.112 4.64 0.17 6.43 0.03 0.17 0.01 1.06 0.02 0.02 0.02
This study Hu et al., 2012 21 31 20 20 (Kaaya et al., 1999) (Kaaya et al., 1999)
228
© 2015 The Societies and Wiley Publishing Asia Pty Ltd
Molecular cloning of GST from mussel
glutathione metabolism has been observed to increase 12.0-, 2.8-, and 1.8-fold, respectively, in the hepatopancreas of MC-LR-injected shrimp (47). There is some evidence for the involvement of GSH and GST in the elimination of microcystins in Litopenaeus vannamei; however, the mechanism has not yet been identified (29). The temporal patterns of HcGSTS expression in response to MC-LR challenges imply that the MCs can potentially conjugate with GSH under catalysis by GST to reduce the original toxicity (52–54). Further study is needed to clarify the potential mechanisms.
ACKNOWLEDGEMENT This study was supported by National Natural Science Foundation of China (Grant no. 5119003). DISCLOSURE
11.
12.
13.
14.
15.
16.
None of the authors has any conflicts of interest associated with this study. 17.
REFERENCES 1. Yang Y., Cheng J.Z., Singhal S.S., Saini M., Pandya U., Awasthi S., Awasthi Y.C. (2001) Role of glutathione S-transferases in protection against lipid peroxidation. Overexpression of hGSTA 2–2 in K562 cells protects against hydrogen peroxide-induced apoptosis and inhibits JNK and caspase 3 activation. J Biol Chem 276: 19220–30. 2. Tu C.P., Akgul B. (2005) Drosophila glutathione S-transferases. Methods Enzymol 401: 204–26. 3. Hayes J.D., Flanagan J.U., Jowsey I.R. (2005) Glutathione transferases. Annu Rev Pharmacol Toxicol 45: 51–88. 4. Abdalla A.M., El-Mogy M., Farid N.M., El-Sharabasy M. (2006) Two glutathione S-transferase isoenzymes purified from Bulinus truncatus (Gastropoda: Planorbidae). Comp Biochem Phys B 143: 76–84. 5. Sheehan D., Meade G., Foley V.M., Dowd C.A. (2001) Structure, function and evolution of glutathione transferases: Implications for classification of non-mammalian members of an ancient enzyme superfamily. Biochem J 360: 1–16. 6. Hoarau P., Gnassia-Barelli M., Romeo M., Girard J.P. (2001) Differential induction of glutathione S-transferases in the clam Ruditapes decussatus exposed to organic compounds. Environ Toxicol Chem 20: 523–9. 7. Bebianno M.J., Lopes B., Guerra L., Hoarau P., Ferreira A.M. (2007) Glutathione S-tranferases and cytochrome P450 activities in Mytilus galloprovincialis from the South coast of Portugal: Effect of abiotic factors. Environ Int 33: 550–8. 8. Brian N.B., Singh B.R. (2002) Induction of glutathione S-transferase in the Northern Quahog Mercenaria mercenaria after exposure to the polychlorinated biphenyl (PCB) mixture aroclor1248. Pro Chem 21: 489–94. 9. Ames B.N., Profet M. Gold L.S. (1990) Nature's chemicals and synthetic chemicals: Comparative toxicology. Proc Natl Acad Sci USA 87: 7782–6. 10. Khessiba A., Hoarau P., Gnassia-Barelli M., Aissa P., Romeo M. (2001) Biochemical response of the mussel Mytilus
© 2015 The Societies and Wiley Publishing Asia Pty Ltd
18. 19.
20.
21.
22.
23.
24.
25.
galloprovincialis from Bizerta (Tunisia) to chemical pollutant exposure. Arch Environ Con Tox 40: 222–9. Perez E., Blasco J., Sole M. (2004) Biomarker responses to pollution in two invertebrate species: Scrobicularia plana and Nereis diversicolor from the Cadiz bay (SW Spain). Mar Environ Res 58: 275–9. Osman A.M., van den Heuvel H., van Noort P.C. (2007) Differential responses of biomarkers in tissues of a freshwater mussel, Dreissena polymorpha, to the exposure of sediment extracts with different levels of contamination. J Appl Toxicol 27: 51–9. Board P.G., Baker R.T., Chelvanayagam G. (1997) Zeta, a novel class of glutathione transferases in a range of species from plants to humans. Biochem J 328: 929–35. Armstrong R.N. (1997) Structure, catalytic mechanism, and evolution of the glutathione transferases. Chem Res Toxicol 10: 2–18. Hayes J.D., Pulford D.J. (1995) The glutathione S-transferase supergene family: Regulation of GST and the contribution of the isoenzymes to cancer chemoprotection and drug resistance. Crit Rev Biochem Mol 30: 445–600. Agianian B., Tucker P.A., Schouten A., Leonard K., Bullard B., Gros P. (2003) Structure of a Drosophila sigma class glutathione S-transferase reveals a novel active site topography suited for lipid peroxidation products. J Mol Biol 326: 151–65. Jowsey I.R., Thomson A.M., Flanagan J.U., Murdock P.R., Moore G.B., Meyer D.J., Murphy G.J., Smith S.A., Hayes J.D. (2001) Mammalian class Sigma glutathione S-transferases: Catalytic properties and tissue-specific expression of human and rat GSH-dependent prostaglandin D2 synthases. Biochem J 359: 507–16. Blanchette B., Feng X., Singh B.R. (2007) Marine glutathione S-transferases. Mar Biotechnol 9: 513–42. Ren H.L., Xu D.D., Singaram G., Qiao K., Huang W.B., Wang K.J. (2009) Gene cloning of a sigma class glutathione Stransferase from abalone (Haliotis diversicolor) and expression analysis upon bacterial challenge. Dev Comp Immunol 33: 980–90. Wan Q., Whang I., Lee J. (2008) Molecular cloning and characterization of three sigma glutathione S-transferases from disk abalone (Haliotis discus discus). Comp Bioche Phys B 151: 257–67. Navaneethaiyer U., Kasthuri S.R., Youngdeuk L., Ilson W., Cheol Y.C., Jehee L. (2012) A novel molluscan sigma-like glutathione S-transferase from Manila clam, Ruditapes philippinarum: Cloning, characterization and transcriptional profiling. Comp Biochem Phy C 155: 539–50. Yang H.L., Zeng Q.Y., Lia E.Q., Zhua S.G., Zhoua X.W. (2004) Molecular cloning, expression and characterization of glutathione S-transferase from Mytilus edulis. Comp Bioche Phys B 139: 175–82. Yang J.L., Wei X.M., Xu J., Yang D.L., Liu X.Q., Yang J.M., Fang J.H., Hu X.K. (2012) A sigma-class glutathione Stransferase from Solen grandis that responded to microorganism glycan and organic contaminants. Fish Shellfish Immun 32: 1198–204. Yang Z.Y., Wu H.J., Li Y. (2012) Toxic effect on tissues and differentially expressed genes in hepatopancreas dentified by suppression subtractive hybridization of freshwater pearl mussel (Hyriopsis cumingii) following microcystin-LR challenge. Environ Toxicol 27: 393–403. BLAST. Basic Local Alignment Search Tool. Available from URL: http://www.ncbi.nlm.nih.gov/BLAST/ .
229
Z. Yang et al.
26. SignalP 4.1 Server. (2012) Available from URL: http://www.cbs. dtu.dk/services/SignalP/ 27. NCBI. (2012) Conserved Domains. Available from URL: http:// www.ncbi.nlm.nih.gov/Structure/cdd/cdd.shtml 28. SMART. (2012) Simple Modular Architecture Research Tool. Available from URL: http://smart.embl-heidelberg.de/ 29. Martins J.C., Vasconcelos V.M. (2009) Microcystin dynamics in aquatic organisms. J Toxicol Environ Health B Crit Rev 12: 65–82. 30. Livak K.J., Schmittgen T.D. (2001) Analysis of relative gene expression data using realtime quantitative PCR and the 2(T) (-Delta Delta C) method. Methods 25: 402–8. 31. Bradford M.M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248–54. 32. Habig W.H., Pabst M.J., Jakoby W.B. (1974) Glutathione S-transferases. The first enzymatic step in mercapturic acid formation. J Biol Chem 249: 7130–9. 33. Dirr H., Reinemer P., Huber R. (1994) X-ray crystal structures of cytosolic glutathione S-transferases. Implications for protein architecture, substrate recognition and catalytic function. Eur J Biochem 220: 645–61. 34. Kanaoka Y., Ago H., Inagaki E., Nanayama T., Miyano M., Kikuno R., Fujii Y., Eguchi N.T.H., Urade Y., Hayaishi O. (1997) Cloning and crystal structure of hematopoietic prostaglandin D synthase. Cell 90: 1085–95. 35. Kasthuri S.R., Navaneethaiyer U., Youngdeuk L., Cheol Y.C., Ilson W.J. (2012) First molluscan theta-class Glutathione STransferase: Identification, cloning, characterization and transcriptional analysis post immune challenges. Comp Biochem Phys B 162: 10–23. 36. Nguyen H.A., Bae Y.A., Lee E.G., Kim S.H., Diaz-Camacho S.P., Nawa Y., Kang I., KongY. (2010) A novel sigma-like glutathione transferase of Taenia solium metacestode. Int J Parasitol 40: 1097–106. 37. Rhee J.S., Raisuddin S., Hwang D.S., Horiguchi T., Cho H.S., Lee J.S. (2008) A mu-class glutathione S-transferase (GSTM) from the rock shell Thais clavigera. Comp Biochem Phy C 148: 195–203. 38. Contreras-Vergara C.A., Harris-Valle C., Sotelo-Mundo R.R., Yepiz-Plascencia G. (2004) A mu-class glutathione S-transferase from the marine shrimp Litopenaeus vannamei: Molecular cloning and active-site structural modeling. J Biochem Mol Toxicol 18: 245–52. 39. Hu B.Q., Deng L.R., Wen C.G., Yang X.L., Pei P.Z. Xie Y.H., Luo S.Q. (2012) Cloning, identification and functional characterization of a pi-class glutathione-S-transferase from the freshwater mussel Cristaria plicata. Fish Shellfish Immun 32: 51–60. 40. Zhao D., Chen L., Qin C., Zhang H., Wu P., Zhang F. (2010) A delta-class glutathione transferase from the Chinese mitten crab Eriocheir sinensis: CDNA cloning, characterization and mRNA expression. Fish Shellfish Immun 29: 698–703. 41. Zhang L.B., Qiu L.H., Wu H.F., Liu X.L., You L.P., Pei D., Chen L.L., Wang Q., Zhao J.M. (2012) Expression profiles of seven glutathione S-transferase (GST) genes from Venerupis philippinarum exposed to heavy metals and benzo[a]pyrene. Comp Biochem Phy C 155: 517–27.
230
42. Doi A.M., Pham R.T., Hughes E.M., Barber D.S., Gallagher E.P. (2004) Molecular cloning and characterization of a glutathione S-transferase from largemouth bass (Micropterus salmoides) liver that is involved in the detoxification of 4-hydroxynonenal. Biochem Pharmacol 67: 2129–39. 43. Li C., Su X., Li Y., Li T., Sun C., Zhou T., Liu H. (2012) Two classes of glutathione S-transferase genes with different response profiles to bacterial challenge in Venerupis philippinarum. Fish Shellfish Immun 32: 219–22. 44. Chen J., Xiao S., Deng Y., Du X., Yu Z. (2011) Cloning of a novel glutathione S-transferase 3 (GST3) gene and expression analysis in pearl oyster, Pinctada martensii. Fish Shellfish Immun 31: 823–30. 45. Ognjanovic B.I., Markovic S.D., Pavlovic S.Z., Zikic R.V., Stajn A.S., Saicic Z.S. (2007) Effect of chronic cadmium exposure on antioxidant defense system in some tissues of rats: Protective effect of selenium. Physiol Res 57: 403–11. 46. Monteiro D.A., de Almeida J.A., Rantin F.T., Kalinin A.L. (2006) Oxidative stress biomarkers in the freshwater characid fish, Brycon cephalus, exposed to organophosphorus insecticide Folisuper 600 (methyl parathion). Comp Bioche Physiol C 143: 141–9. 47. Shailaja M.S., D'Silva C. (2003) Evaluation of impact of PAH on a tropical fish, Oreochromis mossambicus using multiple biomarkers. Chemosphere 53: 835–41. 48. Schmidt K., Steinberg C.E., Pflugmacher S., Staaks G.B. (2004) Xenobiotic substances such as PCB mixtures (Aroclor 1254) and TBT can influence swimming behavior and biotransformation activity (GST) of carp (Cyprinus carpio). Environ Toxicol 19: 460–70. 49. Greco L., Capri E., Rustad T. (2007) Biochemical responses in Salmo salar muscle following exposure to ethinyl estradiol and tributyltin. Chemosphere 68: 564–71. 50. Pflugmacher S., Wiegand C., Werner S., Schr€ oder H., Kankaanp€a€a. (2005) Activity and substrate specificity of cytosolic and microsomal glutathione S-transferase in Australian black tiger prawns (Penaeus monodon) after exposure to cyanobacterial toxins. Environ Toxicol L 20: 301–7. 51. GonSc alves-Soares D., Zanette J., Yunes J.S., Yepiz-Plascencia G.M., Bainy, A.C.D. (2012) Expression and activity of glutathione S-transferases and catalase in the shrimp Litopenaeus vannamei inoculated with a toxic Microcystis aeruginosa strain. Mar Environ Res 75: 54–61. 52. Li X.Y., Liu Y., D., Song L. R., Liu H.T. (2003) Responses of antioxidant systems in the hepatocytes of common carp (Cyprinus carpio L.) to the toxicity of microcystin-LR. Toxicon 42: 85–9. 53. Jos A., Pichardo S., Prieto A.I., Repetto G., Vazquez C.M., Moreno I., Camean A.M. (2005) Toxic cyanobacterial cells containing microcystins induce oxidative stress in exposed tilapia fish (Oreochromis sp.) under laboratory conditions. Aquat Toxicol 72: 261–71. 54. Zhang D.W., Xie P., Liu Y., Chen J., Liang G.D. (2007) Bioaccumulation of the hepatotoxic microcystins in various organs of a freshwater snail from a subtropical Chinese lake, Taihu Lake, with dense toxic Microcystis blooms. Environ Toxicol Chem 26: 171–6.
© 2015 The Societies and Wiley Publishing Asia Pty Ltd
ORIGINAL ARTICLE
Molecular cloning and characterization of a sigma-class glutathione S-Transferase from the freshwater mussel Hyriopsis cumingii Haihua Li1,2, Ziyan Yang2, Qiang Huang1 and Yanxia Li3 1 Key Laboratory of Northwest Water Resources and Environmental Ecology of Education Ministry, Xi’an University of Technology, Xi’an, Shanxi Province 710048, China, 2School of Environment and Municipal Engineering, North China University of Water Resources and Electric Power, Zhengzhou, Henan Province 450011, China and 3SanQuan Medical College, Xinxiang, Henan Province 453003, China
ABSTRACT A full-length cDNA of a sigma-like glutathione S-transferase (GST) was identified from Hyriopsis cumingii (HcGSTS). The deduced amino acid sequence of HcGSTS was found to comprise 203 amino acid residues and to contain the distinct highly conserved glutathione binding site of N-terminal and the relatively diverse substrate binding site of C-terminal. Alignment analysis and phylogenetic relationship suggested that the HcGSTS is a sigma-class GST. The mRNA of HcGSTS was constitutively expressed in all tested tissues, the strongest expression being in the hepatopancreas. The mRNA expression of HcGSTS was significantly up-regulated (P < 0.05) in all assessed tissues after stimulation of the mussels with peptidoglycan (PGN) and LPS, the only exception being when the gills were challenged with PGN. The expression of HcGSTS mRNA in kidney and foot was also significantly up-regulated (P < 0.05) by microcystin-LR. Recombinant HcGSTS exhibited high activity towards the substrate 1-chloro-2,4-dinitrobenzene. The optimal pH was 8.0 and temperature 35 °C. Key words
biochemical characterization, expression pattern, glutathione S-transferase, Hyriopsis cumingii.
Glutathione S-transferases (EC 2.5.1.18) are a superfamily of multi-functional enzymes that play prominent roles against various harmful exogenous compounds, such as carcinogens, mutagens, environmental pollutants, drugs, pesticides and cellular-derived endogenous toxic compounds (1–3), and in protecting tissues against oxidative damage (4). GSTs are widespread in both prokaryotes and eukaryotes and catalyze the conjugation of GSH to various less soluble exogenous or endogenous toxic compounds containing electrophilic centers in order to transform them into soluble non-toxic products (5). Therefore, GSTs can potentially be used as indicators and biomarkers for assisting understanding of the impact of environmental changes at the
biochemical level and to serve as effective early warning tools in assessments of environmental health (6, 7). In recent decades, increasing water pollution has resulted in the exposure of aquatic organisms to a variety of xenobiotic compounds such as heavy metals, organic pollutants, industrial waste water and environmental endocrine disruptors (8). These xenobiotics may interact deleteriously with organisms, causing toxic and sometimes carcinogenic effects (9). However, organisms have evolved various strategies for protecting themselves against such continuous threats from the environment, including sequestration, scavenging and binding and catalytic biotransformation to (5). Because of their ability to detoxify environmental pollutants, GSTs in
Correspondence Ziyan Yang, School of Environment and Municipal Engineering, NorthChina University of Water Resources and Electric Power, Zhengzhou, Henan Province 450011, China. Tel: þ86 13 52350 9762; fax: þ86-0371-6579068; email: [email protected] Received 26 June 2014; revised 31 January 2015; accepted 5 February 2015. List of Abbreviations: CD, conserved domain; CDNB, 1-chloro-2,4-dinitrobenzene; GSH, glutathione; GST, glutathione S transferase; HcGSTS, full length cDNA of a sigma-like GST was identified from Hyriopsis cumingii; MC LR, microcystin LR; NJ, neighbor joining; PGN, peptidoglycan; RACE, rapid amplification of the cDNA ends; rHcGSTS, recombinant HcGSTS.
© 2015 The Societies and Wiley Publishing Asia Pty Ltd
219
Z. Yang et al.
aquatic invertebrates have been extensively used as biomarkers for monitoring aquatic environmental pollution (10–12). The GST superfamily has been subdivided into three major families: cytosolic, microsomal and mitochondrial GSTs (13). Now at least 15 classes of cytosolic GSTs have been recognized; namely, a, m, p, s, u, v, B, b, d, k, e, l, f, r and t (14, 15). Sigma-class GSTs, one of the largest GST subfamilies, have been identified in both vertebrate and invertebrate animals. They can inactivate lipoperoxidation products (16), catalyze biosynthetic reactions (17), and play important roles in terms of structure and metabolism. To date, the activities and degree of transcription of GSTs have been widely investigated in some aquatic species (18); however, study of GSTs in freshwater aquatic organisms, especially mussels, is thus far scanty. Some sigma-class GSTs have been cloned and described in aquatic mollusks, such as Haliotis diversicolor (19, 20), Ruditapes philippinarum (21), Mytilus edulis (22) and Solen grandis (23). Hyriopsis cumingii, an economically important freshwater pearl mussel species and aquatic environment monitoring animal, is widely cultured in southern China because of its great capacity to accumulate and tolerate environmental pollutants and because it provides a means of achieving ecological restoration of lakes that potentially pose risks for aquatic ecosystems and human health (24). Thus, study of the characteristics of GST isoenzymes and their capacity to achieve detoxification is essential and meaningful. In this study, we cloned the complete GST cDNA from H. cumingii, investigated the distribution of its transcripts and its expression pattern when challenged by LPS, PGN or MC-LR, and investigated the biochemical properties of recombinant HcGSTS.
Aldrich), 100 mL MC-LR from Microcystis aeruginosa (0.1 mg/ml in DMSO; Sigma–Aldrich), whereas the control group was injected with 100 mL PBS. Sampling was performed at 3, 6, 12, 24, 36 and 48 hr after LPS and PGN challenge, whereas the group challenged by MC-LR was sampled at 6, 12, 24, 36, 48 and 96 hr. To investigate the distribution of HcGSTS transcripts, various tissues were extracted from these healthy mussels, including hemocytes, hepatopancreas, gonad, kidney, intestine, gill, mantle, adductor muscle and foot. In addition, the expression profiles of HcGSTS transcripts were examined in tissues that had been challenged with LPS, PGN and MC-LR and obtained at the indicated times throughout the sampling process from the hepatopancreas, gonad, kidney, gill, and foot. Cloning the full-length cDNA of HcGST gene from H. cumingii
MATERIALS AND METHODS
Total RNA was extracted from the hepatopancreas of MC-LR-challenged mussels using TRIzol reagent according to the manufacturer's instructions (Invitrogen, Carlsbad, CA, USA). cDNA was then synthesized and amplified using a RevertAid first strand cDNA synthesis kit (MBI Fermentas, St Leon-Rot, Germany) according to the manufacturer's instructions. Two groups of specific primers, namely 50 GSP1, 50 GSP2, and 30 GSP1, 30 GSP2 were designed (Table 1) from the partial GST sequence (EST No.2-11) identified in the suppression subtractive hybridization cDNA library (29), whereas adaptor primers (UPM) were used for 50 and 30 RACE. The RACE reactions were performed using a SMART RACE cDNA amplification kit (Clontech, Palo Alto, CA, USA) according to the manufacturer's instructions and submitted for sequencing to Shanghai Sangon Biological Engineering Technology & Services (Shanghai, China).
Experimental animals and bacterial challenge
Sequence analysis
Approximately 2-year-old pearl mussels (H. cumingii) of average shell length 55 5 mm were obtained by aquaculture in Yueshan village, Ezhou city, China, and maintained in aerated fresh lake water at 20 1°C before the experiments. One hundred and sixty mussels were used in the stimulation experiment. The mussels were randomly divided into four groups, each of which contained 40 individuals. The test groups were injected with 100 mL LPS from Escherichia coli 055:B5 (1 mg/mL in PBS; Sigma–Aldrich, St Louis, MO, USA), 100 mL PGN from Staphylococcus aureus (1 mg/mL in PBS; Sigma–
Sequence similarity with other known proteins was analyzed using the BLAST program (25). Alignment of multiple sequences was performed with Clustal W (version 1.83). The theoretical signal peptides were predicted by SignalP 3.0 Server (26). A CD-Search service of NCBI's Conserved Domain Database (27) was performed to identify the CDs present. The SMART program (28) was used to predict the functional sites or domains in the amino acid sequences. A phylogenetic tree was constructed based on the deduced amino acid sequences using the NJ method with 1000 bootstrap replicates by means of MEGA v4.0 software.
220
© 2015 The Societies and Wiley Publishing Asia Pty Ltd
Molecular cloning of GST from mussel
Table 1. Primer sequences used in the present study Sequence (50 to 30 )
Feature
GGCCACGCGTCGACTAGTACT17 TGGTATCAACGCAGAGTCTAATACGACTCACTATAGGGC TTATGTCTGCGATAGCGACCTCTCA GCTTGCCATCCACTTC TCTATCCTCAAAGCTTTCTCCA CAGCCCAGATCGACCAAGTTATGGACCT GGAACCTGACAAGAAGAAAGACCTGGAAC TGTCCGTCTTCTTTCTGCTCTTC GGAAAACACTGGAGGTCAATACT GAGACAACCTACAACAGCATCAT GAAGCCAAAATGGGACCACCGAT AAGGGTACCATGAGCTTTGAGGATAGAAGGGTG GGAGAATTCGCGGGTGATTTGTCCAAGAGA
Universal primer Adaptor primer
Primer Oligo(dT)-adaptor UPM-long UPM-short 50 -GSP1 50 -GSP2 30 -GSP1 30 -GSP2 RT-GSTR RT-GSTF ActinF ActinR ExGSTF ExGSTR
Analysis of gene expression pattern of HcGSTS in H. cumingii using real-time quantitative PCR Real time quantitative PCR was performed with SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) on a CFX96 C1000 thermal cycler (Bio-Rad) to investigate the expression of HcGSTS. One pair of gene-specific primers (RT-GSTF and RT-GSTR) (Table 1) designed by Primer premier 5.0 for HcGSTS was used to amplify a 197 bp PCR product. Two b-actin primers, actin-F and actin-R (Table 1) were used to amplify a gene fragment of 218 bp as the internal control for qRTPCR. The amplification efficiency of all primers was determined by standard curves; primers with amplification efficiency between 0.95–1.0 were chosen for use in the present study. The sample qRT-PCR amplifications were carried out in triplicate along with the internal control gene in 96 well plates. All analyses were based on the CT values of the PCR products. The 2DDCTmethod was used to analyze the strength of expression of HcGSTS (30). The relative expression of target genes was normalized to the expression of b-actin and then expressed as a fold change relative to the corresponding control group. The data were subjected to one-way anova followed by an unpaired Student's t-test. Differences were considered significant at P < 0.05 and extremely significant at P < 0.01. Recombinant expression and purification of HcGSTS The open reading frame (including the stop codon) of the cDNA encoding HcGSTS was amplified by PCR with the upstream primer ExGSTF and the downstream primer ExGSTR (Table 1). The PCR product was cloned into pMD18-T simple vector (TaKaRa, Kyoto, Japan), © 2015 The Societies and Wiley Publishing Asia Pty Ltd
50 -RACE 30 -RACE Real time PCR Prokaryotic expression
and digested with Kpn I and EcoR I (TaKaRa), then cloned into the expression vector pET-30a (Novagen, Madison, WI, USA). The recombinant plasmid (pET30a-HcGSTS) was transformed into E. coli BL21 (DE3)-pLysS (Novagen). Colonies containing the appropriate insert were kept and the inserts checked by sequencing. Positive transformants were incubated in LB medium (containing 50 mg/mL ampicillin) at 28 °C with shaking at 220 rpm. When the OD (turbidity at 600 nm) of the culture mediums reached 0.4, isopropyl-h-dthiogalactoside was added to the recombinant HcGSTS culture at a final concentration of 0.5 mM and incubation continued for another 6 hr at 28 °C, after which the bacteria were harvested by centrifugation at 10,000 g for 10 min at 4 °C. The supernatant with rHcGSTs was purified by nickel affinity resin chromatography and pooled by elution with 100 mM imidazole. The concentration of the purified rHcGSTS was determined by the Bradford method (31) using BSA as the standard. Biochemical properties of rHcGSTS The activity assay of rHcGSTS was measured by a previously described method (32). Conjugation of the thiol group of GSH to the substrate CDNB was determined spectrophotometrically by monitoring changes in absorbance at 340 nm. The reaction was performed in a 1 mL reaction mixture containing 100 mM phosphate buffer, 10 mM reduced GSH and some rHcGSTS (pH 6.5). Then 1 mM CDNB substrate was added to the enzyme mixture after reaction at 25 °C for 5 min, after which absorbance at 340 nm was monitored for 5 min while maintaining the mixture at 25 °C. A non-enzymatic reaction was measured under the conditions described above. The changes in absorbance per minute were converted into amounts 221
Z. Yang et al.
of substrate conjugated/min/mg enzyme by using the molar extinction coefficient for CDNB e340 ¼ 9.6 mM1 cm1. The optimal pH and temperature for rHcGSTS were measured using CDNB as the substrate at pH ranges from 3.0 to 10.0 and temperatures from 20 °C to 50 °C.
were gathered together in the minimum cluster, and then clustered with sigma-GST of the other aquatic molluscan, suggesting they have a close evolutionary relationship.
RESULTS
The differential tissue-specific expression of HcGSTS was investigated by SYBR Green real-time PCR for multiple tissues from healthy mussels, including hemocytes, hepatopancreas, gonad, kidney, intestinal, gill, mantle, adductor muscle and foot, b-actin was used as an internal standard gene and the strength of expression of HcGSTS in the foot was used as a calibrator for other tissues. HcGSTS mRNA was found to be constitutively expressed to different degrees in a wide range of the tested tissues (Fig. 3). As observed, HcGSTS mRNA expression was strongest in the hepatopancreas, followed by the kidney, which were 1337.7- and 455.9-fold, respectively, that of the foot.
Molecular characterization of H. cumingii HcGSTS cDNA The cDNA sequence of H. cumingii GST sigma was affirmed by NCBI BLAST analysis and was designated HcGSTS (GenBank accession number KF479262). The full-length nucleotide sequence was 996 bp of HcGSTS cDNA and an open reading frame of 612 bp. The open reading frame encoded a polypeptide of 203 amino acids with a theoretical isoelectric point of 5.46 and predicted molecular weight of 23.3 kDa. The predicted protein sequence of HcGSTS was similar to GST_N_Sigma_like (PSSM: cd03039) and GST_C_Sigma_ like (PSSM: cd03192), containing a G-site (from Tyr4 to Arg73) that binds GSH in the N-terminal region and an H-site (from Trp83 to Lys183) which is a substrate binding site in the C-terminal. BLAST analysis revealed that the identity of HcGSTS sequence with other homologs ranged from 35% to 58%. The highest percentage of identity and similarity (58% and 76%, respectively) were with the GST homologue from the Manila clam R. philippinarum (Table 2). Given the multiple sequence alignments between HcGSTS and the other twelve sigma-class GSTs from aquatic mollusks, the N-terminal region of all the GSTs compared was highly homologous and conserved, whereas the C-terminal was relatively diverse (Fig. 1). In HcGSTS, the GSH binding moieties (G-site) include Tyr8, Arg14, Gln50, Ile51, Pro52, Gln63 and Ser64, and the substrate binding pocket (H-site) includes Glu96, Arg99, Arg100, Leu103, Lys104, Leu160 and Thr163. Phylogenetic relationship of HcGSTS To ascertain the evolutionary relationships among sigma GSTs, the deduced amino acid sequences of HcGSTS were aligned with 18 known sigma GSTs and 46 other class GSTs sequences obtained from GenBank, after which a phylogenetic tree was constructed with homologs using the NJ method, based on alignment (Fig. 2). Nine distinct groups, namely the classes s, m, p, a, u, d, B, v and k, were well separated in the phylogenetic tree. The same classes of GSTs were found to group together, HcGSTS being grouped in the sigmaclass GST cluster. HcGSTS and R. philippinarum GSTS1 222
The distribution of HcGSTS mRNA in various tissues
The expression pattern of HcGSTS gene in tissues after challenge with LPS, PGN and MC-LR Time-course experiments were performed to investigate temporal variations in HcGSTS transcription in vivo for up to 96 hr after challenge with LPS, PGN and MC-LR. Based on the results obtained by real-time quantitative PCR analysis, five tissues (the hepatopancreas, gonad, kidney, gill and foot) of H. cumingii were selected for evaluation of the expression pattern of HcGSTS gene. b-actin was used as an internal control gene. As shown in Figure 4a, in the LPS stimulation group, the HcGSTS gene exhibited a burst up-regulation in gill and foot (P < 0.05). Particularly in the gill, strong upregulation of expression was maintained for the first 12 hr; the highest value being 1097.3-fold that of the blank group at 3 hr post-stimulation. Similar variations in HcGSTS gene expression were found in the hepatopancreas, gill, gonad and foot, the greatest expression being observed at 3 hr post-stimulation and decreasing rapidly thereafter. In contrast, in the kidney the peak of up-regulation of expression of HcGSTS gene appeared relatively late, reaching its maximum at 12 hr post-stimulation. After the mussels were stimulated by PGN (Fig. 4b), expression in the hepatopancreas and gonad showed a similar trend, with significant greater expression at 12 hr (P < 0.05) in the challenged group than in the blank group. As time progressed, significant enhancement of up-regulation of HcGSTS expression in the kidney and foot was observed at 18 hr (293.6-fold) and 24 hr (19.9-fold), respectively (P < 0.05). But there © 2015 The Societies and Wiley Publishing Asia Pty Ltd
Molecular cloning of GST from mussel
Table 2. Percent identity and similarity between HcGSTS and homologs of various aquatic mollusks Molecular name RpGSTS1 CgGSTS CrGSTS CfGSTS2 MgGSTS3 HdGSTS1 MgGSTS1 HdGSTS2 SgGSTS MgGSTS2 HdGSTS RpGSTS
Species
Accession no.
Identity (%)
Similarity (%)
Ruditapes philippinarum Crassostrea gigas Crassostrea ariakensis Chlamys farreri Mytilus galloprovincialis Haliotis discus discus Mytilus galloprovincialis Haliotis discus discus Solen grandis Mytilus galloprovincialis Haliotis discus hannai Ruditapes philippinarum
AEW46325 CAE11863 ACJ06744 ADF32019 AFQ35985 ABO26602 AFQ35983 ABO26603 AEW43451 AFQ35984 ACE79171 ADI44317
58 46 44 46 41 40 37 37 40 39 42 36
76 67 65 64 64 65 61 63 61 63 64 61
was no significant difference in gill compared with that in the blank group (P < 0.05). In contrast, after challenge with MC-LR the HcGSTS gene expression pattern did not fluctuate significantly in the hepatopancreas, gill and gonad between most time points, the exception being slight up-regulation at 48 hr post-stimulation (Fig. 4c). In the foot, one high expression peak of HcGSTS gene was observed at 48 hr after MC-LR challenge. It is noteworthy that transcription of HcGSTS in the kidney exhibited a sudden up-regulation (P < 0.05), reaching a maximum at 48 hr poststimulation of 38.4-fold that of the blank group after it had returned to normal. Expression, purification and biochemical characterization of rHcGSTS Induction of the expression construct, pET30a-HcGSTS, resulted in production of high yields of the recombinant protein (Fig. 5a). The molecular mass of the purified fusion protein rHcGSTS was approximately 30 kDa by SDS–PAGE (Fig. 5b), indicating that the specific activity of purified soluble pET30a-HcGSTS towards the substrate CDNB is 4.54 0.08 mmol/min/mg (Table 3). Tests for pH and temperature effects were performed only for rHcGSTS using CDNB as the substrate (Fig. 6). rHcGSTS was found to possess a narrow activity range of pH, from 7.5 to 8.5 (Fig. 6a) and a relatively broader optimum temperature, ranging from 20 °C to 50 °C (Fig. 6b).
DISCUSSION In this study, the full-length cDNA sequence of HcGSTS was cloned in H. cumingii. BLAST analysis revealed that the HcGSTS gene shares 58% identity with sigma GST1 from R. philippinarum (AEW46325). It is generally © 2015 The Societies and Wiley Publishing Asia Pty Ltd
accepted that GSTs sharing more than 40% identity are grouped within a single class (3), whereas with less than 30% identity they are assigned to separate classes (5). Thus, our findings suggest that the GST gene of H. cumingii belongs to the family of the sigma class. In addition, the constructed phylogenetic tree a defined clustering of HcGSTS with other defined sigma class GSTs. Therefore, we named our gene sigma-class glutathione S-transferase of HcGSTS. In most organisms, the cytosolic GSTs are all dimeric with subunit molecular masses ranging from 21 to 29 kDa (5). The predicted molecular mass of HcGSTS is 23.3 kDa, which is in accordance with a previous report that sigma-class GSTs have average subunit molecular weights of 23 kDa (18). The predicted signal peptide cleavage and N-glycosylation sites of its deduced protein were not found, suggesting that HcGSTS is a cytosolic protein. Each GST is known to possess a conserved G-site (GSH binding site) in the N-terminal region, and a relatively diverse H-site (xenobiotic compound binding site), which accounts for the variability of GST enzyme activity (14, 18). Multiple sequence alignment of HcGSTS with other known sigma-class GSTs showed that HcGSTS not only has the distinct highly conserved GSH binding site, but also the relatively diverse substrate binding site (33); sigma-class GSTs rely on a Tyr residue for GSH stabilization in the G-site (18). This stabilization residue is a feature that the sigma-class shares with the ball-and-socket style cytosolic GSTs (34). Similar results were obtained in present study: it was found that HcGSTS may also bind and utilize glutathione as a substrate and may bind diverse xenobiotic compounds because of the variability of GST enzyme activity. A comparison of the enzymatic activities of HcGSTS and other bivalve molluscs GSTs towards the substrates CDNB and GSH is summarized in Table 3. The specific activities of RpGSTs and RpGSTu from Manila clam 223
Z. Yang et al.
Fig. 1. Multiple alignment of HcGSTS with known sigma class GST orthologs. Triangles indicate putative G-sites residues and dots putative H-sites residues. Identical amino acids are shaded in black. Other conserved, but not consensus amino acids, are shaded in gray. Sequences used for the analysis were GSTs from Ruditapes philippinarum (RpGSTS1; AEW46325), Crassostrea gigas (CgGSTS; CAE11863), Crassostrea ariakensis (CrGSTS; ACJ06744), Chlamys farreri (CfGSTS2; ADF32019), Mytilus galloprovincialis (MgGSTS3; AFQ35985), Haliotis discus discus (HdGSTS1; ABO26602), Mytilus galloprovincialis (MgGSTS1; AFQ35983), Haliotis discus discus (HdGSTS2; ABO26603), Solen grandis (SgGSTS; AEW43451), Mytilus galloprovincialis (MgGSTS2; AFQ35984), Haliotis discus hannai (HdGSTS; ACE79171) and Ruditapes philippinarum (RpGSTS; ADI44317).
224
© 2015 The Societies and Wiley Publishing Asia Pty Ltd
Molecular cloning of GST from mussel
Fig. 2. Phylogenetic analysis of HcGSTS from H. cumingiiwith other known vertebrate and invertebrate sigma GSTs orthologs and members of other classes of GSTs. The tree was constructed by the NJ algorithm using the Mega 4.1 program based on the multiple sequence alignment by ClustalW. Bootstrap values of 1000 replicates (%) are indicated for the branches.
© 2015 The Societies and Wiley Publishing Asia Pty Ltd
225
Z. Yang et al.
Fig. 3. Distribution of HcGSTS mRNA transcripts in various tissues of normal mussels detected by RT-PCR. Vertical bars represented the mean SD (n ¼ 3).
toward CDNB were 4.64 0.17 and 6.43 0.03 mmol/ min/mg, respectively (21, 35). The activities of HdGSTS1 and HdGSTS2 from abalone were 0.17 0.01 and 1.06 0.02 mmol/min/mg, respectively (20). Thus, different classes of GSTs have varying activities and the same class of GSTs from different species also have varying enzyme activities. The specific activity of HcGSTS was found to be 4.54 0.08 mmol/min/mg, which is similar to that of RpGSTs, indicating that these GSTs have similar affinity for the substrate CDNB. The optimum pH of rHcGSTS is about pH 8.0, which is very close to the previously reported optimal pHs for RpGSTs and TsMGSTs (21, 36). rHcGSTS exhibited a relatively broad range of optimum temperatures, from 20 °C to 50 °C, which is similar to the range of HdGSTS2 (20), suggesting that the recombinant loses enzymatic activity when the pH is increased and is able to retain reasonable activity at high temperatures. It was found that GSTs were distributed in all tissues of the organism. The tissue distribution of GSTs in aquatic invertebrates is very variable because of differences in primary structures, enzyme properties, and physiological functions. For example, in the rock shell Thais clavigera, m-class GSTs are predominantly expressed in the gill, followed by kidney and muscle (37), whereas in R. philippinarum the greatest expression of uclass GSTs is in hemocytes, followed by the gill and mantle (35). Strong expression of GSTs in the hepatopancreas has been reported in shrimp (38), Solen grandis (23), mussel (39) and crab (40). In addition, investigations of the tissue distribution of sigma-GSTs in aquatic organisms have revealed that sigma-GSTs are generally abundantly expressed in the hepatopancreas, gills, hemocytes and gonad (19–21, 23, 41), which suggests that different distributions of GST in tissues are 226
associated with differential detoxification and innate immune response. In the present study, strong HcGSTS expression was found in the hepatopancreas, gonad and kidney; thus, it is mostly distributed in detoxificationand immune-related organs, suggesting that HcGSTS is involved in some detoxification and immune modulation functions. Expression of HcGSTS was much greater in the hepatopancreas than in other tissues, suggesting that the hepatopancreas is the major organ for detoxification of xenobiotics (42). Glutathione S-transferases are well-known antioxidant proteins that not only detoxify a wide range of environmental pollutants, but are also expressed in response to biological stressors such as infectious agents (21). Recently, several marine GSTs have been found to be involved in immune responses against bacterial pathogens and that exposure of various pathogens leads to the up-regulation of GSTs in abalone (19), Manila clam (43), crab (40), pearl oyster (44) and freshwater mussel (39). In the present study, the bacterial components LPS and PGN, which are useful reagents for evaluating immune responses against gram-negative and gram-positive bacteria, respectively, were used to stimulate H. cumingii. It was found that expression of HcGSTS after challenge by LPS is significantly up-regulated in all tissues tested, supporting the contention that HcGSTS plays a role in the immune functions of organisms, consistent with previous reports. However, some of the present findings differed from those other studies. For example, HcGSTS mRNA expression in the gill after LPS challenge was significantly greater at 3, 6, and 12 hr, the expression peak being observed at 3 hr, whereas in the gill of LPS-injected clams, the greatest expression of RpGSTs and RpGSTu gene was at 48 and 12 hr, respectively (21, 35). These differences may be related to species specificity and the status of the test animals. There is little published information about the transcriptional profile of GSTs challenged by gram-positive bacteria. In our investigation, after mussels had been stimulated by PGN, the transcript expression of HcGSTS was up-regulated to different degrees in the hepatopancreas, gonad, kidney and foot. There is reportedly a burst of up-regulation of transcription of SgGST-S1 mRNA in hemocytes of razor clams after stimulation by PGN, implying that not only biological toxicity, but also the microparticle characteristics of PGN involved in initiation of phagocytosis, are responsible for the up-regulation of expression of GSTs (23). In the present study, LPS more strongly induced expression of the HcGSTS gene than did PGN, suggesting that HcGSTS is more sensitive to the immune response after invasion by gram-negative bacterial pathogens. © 2015 The Societies and Wiley Publishing Asia Pty Ltd
Molecular cloning of GST from mussel
Fig. 4. Temporal expression of HcGSTS mRNA in various tissues after challenge with (a) LPS, (b) PGN and(c) MC-LR as assessed by SYBR Green real-time RT-PCR. Statistical analysis of differences between the untreated control and the challenged groups was performed by one-way anova using SPSS 13.0 software. *, P < 0.05 (n ¼ 3).
In addition, GSTs activity can be induced by variety of xenobiotics, such as heavy metals (45), insecticides (46), polycyclic aromatic hydrocarbons (47), polychlorinated biphenyls (48), tributyltin and estrogen (49), benzo[a] pyrene (B[a]P) and polybrominated diphenyl ethers (17, 41), indicating that GSTs have great potential as biomarkers of exposure to environmental pollutants. To investigate whether xenobiotic compounds are involved in induction of HcGSTS, in the present study H. cumingii were challenged with an environmental © 2015 The Societies and Wiley Publishing Asia Pty Ltd
toxin of water (MC-LR) that is produced by freshwater cyanobacteria and can cause animal intoxications and human diseases, after which the expression patterns of HcGSTS were determined. After mussels had been stimulated by MC-LR, expression of HcGSTS mRNA was significantly up-regulated in the kidney and foot. Increase in GSTs activity has been shown to be induced by microcystins in aquatic organisms (50, 51). Additionally, transcription of VGST, mGST and GST2membrane-sssociated proteins in eicosanoid and 227
Z. Yang et al.
Fig. 5. Expression and purification of soluble rHcGSTS fused protein in E.coli BL21 (DE3). (a) Protein samples were separated by SDSPAGE and stained with Coomassie brilliant blue R-250. Lane M, protein marker; lanes 1–4, pET30a-HcGSTS induced 2, 4, 6, and 8 hr, respectively. (b) Purified combined protein. Lane M, protein marker; lanes 1–4,: concentration of 20 mmol/L, 60 mmol/L, 100 mmol/L and 250 mmol/L imidazole, respectively, when purifying the combined protein.
Fig. 6. Biochemical characterization of HcGSTS. The optimum pH and temperature for CDNB-GSH complex formation in the presence of HcGSTS were determined by measuring absorbance at 340 nm. (a) Optimum pH was measured in the range of 3–10 under the same experimental conditions. (b) Optimum temperature was measured in the range of 20°C–50°C.
Table 3. Specific activity of different GST family members toward the substrate CDNB Organism
GST name
Specific activity (mmol/min/mg)
Reference
Hyriopsis cumingii Cristaria plicata Ruditapes philippinarum Ruditapes philippinarum Haliotis discus discus Haliotis discus discus Mytilus edulis Perna perna
HcGSTS Cp-piGST RpGSTs RpGSTu HdGSTS1 HdGSTS2 GST GST
4.54 0.08 1.706 0.112 4.64 0.17 6.43 0.03 0.17 0.01 1.06 0.02 0.02 0.02
This study Hu et al., 2012 21 31 20 20 (Kaaya et al., 1999) (Kaaya et al., 1999)
228
© 2015 The Societies and Wiley Publishing Asia Pty Ltd
Molecular cloning of GST from mussel
glutathione metabolism has been observed to increase 12.0-, 2.8-, and 1.8-fold, respectively, in the hepatopancreas of MC-LR-injected shrimp (47). There is some evidence for the involvement of GSH and GST in the elimination of microcystins in Litopenaeus vannamei; however, the mechanism has not yet been identified (29). The temporal patterns of HcGSTS expression in response to MC-LR challenges imply that the MCs can potentially conjugate with GSH under catalysis by GST to reduce the original toxicity (52–54). Further study is needed to clarify the potential mechanisms.
ACKNOWLEDGEMENT This study was supported by National Natural Science Foundation of China (Grant no. 5119003). DISCLOSURE
11.
12.
13.
14.
15.
16.
None of the authors has any conflicts of interest associated with this study. 17.
REFERENCES 1. Yang Y., Cheng J.Z., Singhal S.S., Saini M., Pandya U., Awasthi S., Awasthi Y.C. (2001) Role of glutathione S-transferases in protection against lipid peroxidation. Overexpression of hGSTA 2–2 in K562 cells protects against hydrogen peroxide-induced apoptosis and inhibits JNK and caspase 3 activation. J Biol Chem 276: 19220–30. 2. Tu C.P., Akgul B. (2005) Drosophila glutathione S-transferases. Methods Enzymol 401: 204–26. 3. Hayes J.D., Flanagan J.U., Jowsey I.R. (2005) Glutathione transferases. Annu Rev Pharmacol Toxicol 45: 51–88. 4. Abdalla A.M., El-Mogy M., Farid N.M., El-Sharabasy M. (2006) Two glutathione S-transferase isoenzymes purified from Bulinus truncatus (Gastropoda: Planorbidae). Comp Biochem Phys B 143: 76–84. 5. Sheehan D., Meade G., Foley V.M., Dowd C.A. (2001) Structure, function and evolution of glutathione transferases: Implications for classification of non-mammalian members of an ancient enzyme superfamily. Biochem J 360: 1–16. 6. Hoarau P., Gnassia-Barelli M., Romeo M., Girard J.P. (2001) Differential induction of glutathione S-transferases in the clam Ruditapes decussatus exposed to organic compounds. Environ Toxicol Chem 20: 523–9. 7. Bebianno M.J., Lopes B., Guerra L., Hoarau P., Ferreira A.M. (2007) Glutathione S-tranferases and cytochrome P450 activities in Mytilus galloprovincialis from the South coast of Portugal: Effect of abiotic factors. Environ Int 33: 550–8. 8. Brian N.B., Singh B.R. (2002) Induction of glutathione S-transferase in the Northern Quahog Mercenaria mercenaria after exposure to the polychlorinated biphenyl (PCB) mixture aroclor1248. Pro Chem 21: 489–94. 9. Ames B.N., Profet M. Gold L.S. (1990) Nature's chemicals and synthetic chemicals: Comparative toxicology. Proc Natl Acad Sci USA 87: 7782–6. 10. Khessiba A., Hoarau P., Gnassia-Barelli M., Aissa P., Romeo M. (2001) Biochemical response of the mussel Mytilus
© 2015 The Societies and Wiley Publishing Asia Pty Ltd
18. 19.
20.
21.
22.
23.
24.
25.
galloprovincialis from Bizerta (Tunisia) to chemical pollutant exposure. Arch Environ Con Tox 40: 222–9. Perez E., Blasco J., Sole M. (2004) Biomarker responses to pollution in two invertebrate species: Scrobicularia plana and Nereis diversicolor from the Cadiz bay (SW Spain). Mar Environ Res 58: 275–9. Osman A.M., van den Heuvel H., van Noort P.C. (2007) Differential responses of biomarkers in tissues of a freshwater mussel, Dreissena polymorpha, to the exposure of sediment extracts with different levels of contamination. J Appl Toxicol 27: 51–9. Board P.G., Baker R.T., Chelvanayagam G. (1997) Zeta, a novel class of glutathione transferases in a range of species from plants to humans. Biochem J 328: 929–35. Armstrong R.N. (1997) Structure, catalytic mechanism, and evolution of the glutathione transferases. Chem Res Toxicol 10: 2–18. Hayes J.D., Pulford D.J. (1995) The glutathione S-transferase supergene family: Regulation of GST and the contribution of the isoenzymes to cancer chemoprotection and drug resistance. Crit Rev Biochem Mol 30: 445–600. Agianian B., Tucker P.A., Schouten A., Leonard K., Bullard B., Gros P. (2003) Structure of a Drosophila sigma class glutathione S-transferase reveals a novel active site topography suited for lipid peroxidation products. J Mol Biol 326: 151–65. Jowsey I.R., Thomson A.M., Flanagan J.U., Murdock P.R., Moore G.B., Meyer D.J., Murphy G.J., Smith S.A., Hayes J.D. (2001) Mammalian class Sigma glutathione S-transferases: Catalytic properties and tissue-specific expression of human and rat GSH-dependent prostaglandin D2 synthases. Biochem J 359: 507–16. Blanchette B., Feng X., Singh B.R. (2007) Marine glutathione S-transferases. Mar Biotechnol 9: 513–42. Ren H.L., Xu D.D., Singaram G., Qiao K., Huang W.B., Wang K.J. (2009) Gene cloning of a sigma class glutathione Stransferase from abalone (Haliotis diversicolor) and expression analysis upon bacterial challenge. Dev Comp Immunol 33: 980–90. Wan Q., Whang I., Lee J. (2008) Molecular cloning and characterization of three sigma glutathione S-transferases from disk abalone (Haliotis discus discus). Comp Bioche Phys B 151: 257–67. Navaneethaiyer U., Kasthuri S.R., Youngdeuk L., Ilson W., Cheol Y.C., Jehee L. (2012) A novel molluscan sigma-like glutathione S-transferase from Manila clam, Ruditapes philippinarum: Cloning, characterization and transcriptional profiling. Comp Biochem Phy C 155: 539–50. Yang H.L., Zeng Q.Y., Lia E.Q., Zhua S.G., Zhoua X.W. (2004) Molecular cloning, expression and characterization of glutathione S-transferase from Mytilus edulis. Comp Bioche Phys B 139: 175–82. Yang J.L., Wei X.M., Xu J., Yang D.L., Liu X.Q., Yang J.M., Fang J.H., Hu X.K. (2012) A sigma-class glutathione Stransferase from Solen grandis that responded to microorganism glycan and organic contaminants. Fish Shellfish Immun 32: 1198–204. Yang Z.Y., Wu H.J., Li Y. (2012) Toxic effect on tissues and differentially expressed genes in hepatopancreas dentified by suppression subtractive hybridization of freshwater pearl mussel (Hyriopsis cumingii) following microcystin-LR challenge. Environ Toxicol 27: 393–403. BLAST. Basic Local Alignment Search Tool. Available from URL: http://www.ncbi.nlm.nih.gov/BLAST/ .
229
Z. Yang et al.
26. SignalP 4.1 Server. (2012) Available from URL: http://www.cbs. dtu.dk/services/SignalP/ 27. NCBI. (2012) Conserved Domains. Available from URL: http:// www.ncbi.nlm.nih.gov/Structure/cdd/cdd.shtml 28. SMART. (2012) Simple Modular Architecture Research Tool. Available from URL: http://smart.embl-heidelberg.de/ 29. Martins J.C., Vasconcelos V.M. (2009) Microcystin dynamics in aquatic organisms. J Toxicol Environ Health B Crit Rev 12: 65–82. 30. Livak K.J., Schmittgen T.D. (2001) Analysis of relative gene expression data using realtime quantitative PCR and the 2(T) (-Delta Delta C) method. Methods 25: 402–8. 31. Bradford M.M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248–54. 32. Habig W.H., Pabst M.J., Jakoby W.B. (1974) Glutathione S-transferases. The first enzymatic step in mercapturic acid formation. J Biol Chem 249: 7130–9. 33. Dirr H., Reinemer P., Huber R. (1994) X-ray crystal structures of cytosolic glutathione S-transferases. Implications for protein architecture, substrate recognition and catalytic function. Eur J Biochem 220: 645–61. 34. Kanaoka Y., Ago H., Inagaki E., Nanayama T., Miyano M., Kikuno R., Fujii Y., Eguchi N.T.H., Urade Y., Hayaishi O. (1997) Cloning and crystal structure of hematopoietic prostaglandin D synthase. Cell 90: 1085–95. 35. Kasthuri S.R., Navaneethaiyer U., Youngdeuk L., Cheol Y.C., Ilson W.J. (2012) First molluscan theta-class Glutathione STransferase: Identification, cloning, characterization and transcriptional analysis post immune challenges. Comp Biochem Phys B 162: 10–23. 36. Nguyen H.A., Bae Y.A., Lee E.G., Kim S.H., Diaz-Camacho S.P., Nawa Y., Kang I., KongY. (2010) A novel sigma-like glutathione transferase of Taenia solium metacestode. Int J Parasitol 40: 1097–106. 37. Rhee J.S., Raisuddin S., Hwang D.S., Horiguchi T., Cho H.S., Lee J.S. (2008) A mu-class glutathione S-transferase (GSTM) from the rock shell Thais clavigera. Comp Biochem Phy C 148: 195–203. 38. Contreras-Vergara C.A., Harris-Valle C., Sotelo-Mundo R.R., Yepiz-Plascencia G. (2004) A mu-class glutathione S-transferase from the marine shrimp Litopenaeus vannamei: Molecular cloning and active-site structural modeling. J Biochem Mol Toxicol 18: 245–52. 39. Hu B.Q., Deng L.R., Wen C.G., Yang X.L., Pei P.Z. Xie Y.H., Luo S.Q. (2012) Cloning, identification and functional characterization of a pi-class glutathione-S-transferase from the freshwater mussel Cristaria plicata. Fish Shellfish Immun 32: 51–60. 40. Zhao D., Chen L., Qin C., Zhang H., Wu P., Zhang F. (2010) A delta-class glutathione transferase from the Chinese mitten crab Eriocheir sinensis: CDNA cloning, characterization and mRNA expression. Fish Shellfish Immun 29: 698–703. 41. Zhang L.B., Qiu L.H., Wu H.F., Liu X.L., You L.P., Pei D., Chen L.L., Wang Q., Zhao J.M. (2012) Expression profiles of seven glutathione S-transferase (GST) genes from Venerupis philippinarum exposed to heavy metals and benzo[a]pyrene. Comp Biochem Phy C 155: 517–27.
230
42. Doi A.M., Pham R.T., Hughes E.M., Barber D.S., Gallagher E.P. (2004) Molecular cloning and characterization of a glutathione S-transferase from largemouth bass (Micropterus salmoides) liver that is involved in the detoxification of 4-hydroxynonenal. Biochem Pharmacol 67: 2129–39. 43. Li C., Su X., Li Y., Li T., Sun C., Zhou T., Liu H. (2012) Two classes of glutathione S-transferase genes with different response profiles to bacterial challenge in Venerupis philippinarum. Fish Shellfish Immun 32: 219–22. 44. Chen J., Xiao S., Deng Y., Du X., Yu Z. (2011) Cloning of a novel glutathione S-transferase 3 (GST3) gene and expression analysis in pearl oyster, Pinctada martensii. Fish Shellfish Immun 31: 823–30. 45. Ognjanovic B.I., Markovic S.D., Pavlovic S.Z., Zikic R.V., Stajn A.S., Saicic Z.S. (2007) Effect of chronic cadmium exposure on antioxidant defense system in some tissues of rats: Protective effect of selenium. Physiol Res 57: 403–11. 46. Monteiro D.A., de Almeida J.A., Rantin F.T., Kalinin A.L. (2006) Oxidative stress biomarkers in the freshwater characid fish, Brycon cephalus, exposed to organophosphorus insecticide Folisuper 600 (methyl parathion). Comp Bioche Physiol C 143: 141–9. 47. Shailaja M.S., D'Silva C. (2003) Evaluation of impact of PAH on a tropical fish, Oreochromis mossambicus using multiple biomarkers. Chemosphere 53: 835–41. 48. Schmidt K., Steinberg C.E., Pflugmacher S., Staaks G.B. (2004) Xenobiotic substances such as PCB mixtures (Aroclor 1254) and TBT can influence swimming behavior and biotransformation activity (GST) of carp (Cyprinus carpio). Environ Toxicol 19: 460–70. 49. Greco L., Capri E., Rustad T. (2007) Biochemical responses in Salmo salar muscle following exposure to ethinyl estradiol and tributyltin. Chemosphere 68: 564–71. 50. Pflugmacher S., Wiegand C., Werner S., Schr€ oder H., Kankaanp€a€a. (2005) Activity and substrate specificity of cytosolic and microsomal glutathione S-transferase in Australian black tiger prawns (Penaeus monodon) after exposure to cyanobacterial toxins. Environ Toxicol L 20: 301–7. 51. GonSc alves-Soares D., Zanette J., Yunes J.S., Yepiz-Plascencia G.M., Bainy, A.C.D. (2012) Expression and activity of glutathione S-transferases and catalase in the shrimp Litopenaeus vannamei inoculated with a toxic Microcystis aeruginosa strain. Mar Environ Res 75: 54–61. 52. Li X.Y., Liu Y., D., Song L. R., Liu H.T. (2003) Responses of antioxidant systems in the hepatocytes of common carp (Cyprinus carpio L.) to the toxicity of microcystin-LR. Toxicon 42: 85–9. 53. Jos A., Pichardo S., Prieto A.I., Repetto G., Vazquez C.M., Moreno I., Camean A.M. (2005) Toxic cyanobacterial cells containing microcystins induce oxidative stress in exposed tilapia fish (Oreochromis sp.) under laboratory conditions. Aquat Toxicol 72: 261–71. 54. Zhang D.W., Xie P., Liu Y., Chen J., Liang G.D. (2007) Bioaccumulation of the hepatotoxic microcystins in various organs of a freshwater snail from a subtropical Chinese lake, Taihu Lake, with dense toxic Microcystis blooms. Environ Toxicol Chem 26: 171–6.
© 2015 The Societies and Wiley Publishing Asia Pty Ltd
