Vol. 57, No. 3

APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Mar. 1991, p. 804-811

0099-2240/91/030804-08$02.00/0 Copyright © 1991, American Society for Microbiology

Molecular Characterization of the Nisin Resistance Region of Lactococcus lactis subsp. lactis Biovar Diacetylactis DRC3t BARRIE R. FROSETH AND LARRY L. McKAY*

Department of Food Science and Nutrition, University of Minnesota, 1334 Eckles Avenue, St. Paul, Minnesota 55108 Received 30 July 1990/Accepted 2 January 1991

The nisin resistance determinant of Lactococcus lactis subsp. lactis biovar diacetylactis DRC3 was localized a 1.3-kb EcoRI-NdeI fragment by subcloning and interrupting the NdeI site by cloning random NdeI fragments into it; the nisin resistance determinant was then sequenced. The nucleotide sequence revealed a large open reading frame containing 318 codons. Putative transcription and translation signal sequences were located directly upstream from the initiation codon. Immediately downstream of the termination codon was a palindromic region resembling a rho-independent termination sequence. This 957-nucleotide open reading frame and its associated transcription and translation signal sequences were cloned into plasmid-free L. lactis subsp. lactis LM0230 and conferred an MIC of 160 IU of nisin per ml. This level of nisin resistance is equivalent to that of the initial nisin-resistant subclone, pFMO11, used for further subcloning in this study. The inferred amino acid sequence would result in a protein with a molecular mass of 35,035 Da. This value was in agreement with the molecular mass of a protein detected after in vitro transcription and translation of DNA encoding the nisin resistance gene, nsr. This protein contained a hydrophobic region at the N terminus that was predicted to be membrane associated but did not contain a typical signal sequence cleavage site. No significant homology was detected when the DNA sequence of the nsr gene and the amino acid sequence of its putative product were compared with other available sequences. When subjected to Southern hybridization, a 1.2-kb DraI fragment encoding the nsr gene did not hybridize with the genomic DNA of the nisin-producing strain L. lactis subsp. lactis 11454. onto

The lactococci (previously the group N streptococci [37]) have long been used for the production of fermented milk products. Genetic improvement of these organisms has been limited to natural selection, although conjugation has been used to construct phage-resistant starter strains (35, 36). Genes conferring a number of commercially relevant phenotypic traits of these organisms have been isolated and characterized to various degrees (5). Current work on the molecular biology of lactococci has focused on understanding the genetic basis for insensitivity to bacteriophage (18) and the metabolism of important milk constituents, including casein and lactose (6). A detailed understanding of these genes will allow the manipulation of their expression and possibly the construction of strains which have enhanced milk-fermenting capabilities through in vitro recombinant DNA technology. A vector for cloning DNA encoding commercially relevant phenotypes will be critical for this type of strain improvement (35). A number of research groups have developed vectors useful for cloning in lactococci (5), but these vectors depend on selectable markers conferring resistance to antibiotics used in human drug therapy, and these markers would not be food grade. Potential food-grade selectable markers from the lactococci include genes associated with carbohydrate metabolism (13), bacteriophage lysin production (39), and bacteriocin production or resistance (19). In a previous paper, we reported cloning an origin of replication (oriR) and a nisin resistance determinant on a

7.6-kb EcoRI fragment which was capable of existing as an independent replicon when circularized (9). Subsequent analysis of this fragment has determined its size to be 7.8 kb. This 7.8-kb fragment was obtained from pNP40, a 60-kb plasmid present in Lactococcus lactis subsp. lactis bv. diacetylactis DRC3 (28) (referred to in this paper as biovar diacetylactis DRC3). The nisin resistance determinant was further localized on a 2.8-kb EcoRI-XbaI fragment. Simon and Chopin (40) cloned this nisin resistance determinant from pNP40 as a 30-kb XbaI fragment. Biovar diacetylactis DRC3 is not a nisin producer, and its level of nisin resistance is significantly lower than that expressed by nisin-producing strains of L. lactis subsp. lactis (9, 16). The reason for this difference is unknown. The only type of nisin resistance that has been well characterized was reported by Jarvis and Farr (17) in 1971. They isolated a protein from Bacillus cereus capable of inactivating nisin and subtilin and identified it as a dehydroalanine reductase. Other groups have reported strains of Streptococcus thermophilus and Staphylococcus aureus which are resistant to nisin, but the mechanism of nisin resistance has not been specifically identified (16). Therefore, a study of the nisin resistance determinant of biovar diacetylactis DRC3 may be important in elucidating the mechanism of nisin resistance in this strain and its similarity to other mechanisms. Additionally, if nisin-producing strains are to be used in cheese production, it may be desirable to use them in conjunction with other starter organisms, as described by Lipinska (24). The characterization of a gene conferring nisin resistance that could be introduced into these starter organisms might be useful in constructing multiple-strain cultures compatible with nisinproducing strains. The present research focused on identifying and charac-

* Corresponding author. t Published as paper no. 18345 of the contribution series of the Minnesota Agricultural Experiment Station based on research conducted under Project 18-62.

804

VOL. 57,

1991

NISIN RESISTANCE IN L. LACTIS SUBSP. LACTIS

805

TABLE 1. Description of strains and plasmids used in this study Strain or plasmid (size in kb)

Strains E. coli XL-1 Blue L. lactis subsp. lactis LM0230 LM2306

FM011 11454 JS21 L. lactis subsp. lactis bv. diacetylactis DRC3

Plasmids pUC118 (3.2) pBluescript SK(+) (3.0) pSA3 (10.2) pNP40 (60) pFMO11 (7.8) pFMO40 (11.5)

Relevant

Reference or

Descrition

phenotypea

source

Amps

Plasmid-free recipient

Stratagene

Niss Ery' Niss Eryr NiSr Erys

Nip' Nisr Erys Nip' Nisr Eryr

Plasmid-cured derivative of L. lactis subsp. lactis C2 Eryr derivative of LM0230 LM0230 containing pFM011 Nip' Nisr wild-type strain 11454 x LM2306 transconjugant

41 41 9 41 41

Nip- Nisr Erys

Nisr wild-type parental strain

28

Apr Apr Emr Nisr Nisr Nisr Emr

29

pFG010 (10.2) pLLM1 (6.0) pLLM2 (4.9) pLLM3 (5.0) pLLM4 (3.9) pLLM5 (4.2) pLLM6 (4.1)

Nisr Emr Apr Apr Apr Apr Apr Apr

E. coli cloning vector E. coli cloning vector Streptococcus-E. coli shuttle vector Parental plasmid from DRC3 7.8-kb self-ligated EcoRI fragment of pNP40 pSA3 EcoRI-XbaI fragment with 2.8-kb pFMO11 EcoRI-XbaI fragment pFMO11 with 2.4-kb HindlIl fragment pUC118 with 2.8-kb pFMO11 EcoRI-Xbal fragment pUC118 with 1.7-kb pFMO11 SacI-XbaI fragment pUC118 with 1.8-kb pFMO11 EcoRI-KpnI fragment pUC118 with 0.7-kb pFMO11 SacI-KpnI fragment pUC118 with 1.0-kb pFMO11 KpnI-XbaI fragment pBluescript SK(+) with 1.1-kb pFMOll EcoRI-Sacl

pLLM7 (10.5)

Emr Nisr

fragment pSA3 EcoRI-XbaI fragment with 1.8-kb pFMO11

pLLM8 (10.4)

Emr Niss

pLLM9 (11.4) pLLM10 (11.1) pLLM11 (11.2) pBF61 (39)

Emr Nisr Emr Nis' Emr Niss Plasmid used to generate NdeI fragments

EcoRL-KpnI fragment pSA3 EcoRI-XbaI fragment with 1.7-kb pFMO11 SacI-XbaI fragment pSA3 with 1.2-kb pFMO11 DraI fragment pSA3 with 0.86-kb pFMOll AluI fragment pSA3 with 0.95-kb pFMO11 RsaI fragment

Ap, ampicillin; Amp, ampicillin; Em, erythromycin; Ery, erythromycin; Nis, nisin;

terizing the gene encoding nisin resistance from pNP40.

Subcloning and insertional inactivation were used to localize the gene. The DNA sequence of the nisin resistance gene (nsr) was determined, its homology to the genomic DNA of a nisin-producing strain was investigated, and the peptide encoded by nsr was identified. MATERIALS AND METHODS Bacterial strains and plasmids. The bacterial strains and plasmids used in this study are listed in Table 1. L. lactis strains were propagated at 32°C in M17 broth (42) supplemented with 0.5% glucose and erythromycin at 3 ,g/ml or nisin at 40 IU/ml (9). The MIC of nisin for L. lactis strains was determined as described previously (9). pFMO11 was subcloned into the vector pUC118 (29), pBluescript SK(+) (Stratagene, La Jolla, Calif.), or pSA3 (4) with transforma-

tion into Escherichia coli XL-1 Blue (Stratagene). The E. coli strains were propagated at 37°C with agitation in LB broth (26) supplemented with 50 pg of ampicillin per ml for

Stratagene 4 28 9 9

This This This This This This This

laboratory study study study study study study

This study This study This study This study This study 8

Nip. nisin production.

the pUC118 or pBluescript SK(+) derivatives or 100 ,ug of chloramphenicol per ml for pSA3 derivatives. Plasmid preparation, analysis, modification, and cloning. L. lactis plasmid DNA was isolated by the method of Anderson and McKay (1) and purified by CsCl-ethidium bromide density gradient centrifugation (26). The method of Holmes and Quigley (14) was employed to isolate E. coli plasmid DNA for use in subcloning, restriction mapping, and screening. E. coli plasmid DNA was prepared by a rapid alkaline lysis procedure (33) for sequencing and an alternative alkaline lysis procedure (34) for in vitro transcription and translation. CsCl-ethidium bromide density gradient centrifugation was employed after the two alkaline lysis procedures. Restriction endonucleases and T4 DNA ligase were purchased from Life Technologies, Inc. (Grand Island, N.Y.) and were used as recommended by the manufacturer. Agarose gel electrophoresis was performed with Tris-acetateEDTA (TAE) buffer (26) at 4 V/cm and was followed by staining in ethidium bromide (0.5 ,g/ml). Recovery of DNA fragments from agarose gels was performed by electropho-

806

FROSETH AND McKAY

APPL. ENVIRON. MICROBIOL. Sacl

EcoRI

pLL1 1

1.1 kb

1.0 kb

0.4 kb

0.3 kb

SacI

NdeI

KpnI 1.7 kb

EcoRI z

EcoRI

DLLM3

Nisr

_

pLLII2

pLLM6

Xba I

Kpnl

Ndel

_

XbaI

L

NiSS

Sac I

L

1.1 kb SacI 1 8 kb

NdeI

KpnI

L

Ni sr

FIG. 1. Physical restriction map and subcloning of the EcoRI-XbaI fragment encoding the gene associated with nisin resistance. The 1.1-kb EcoRI-SacI fragment was cloned with pBluescript SK(+); all other fragments were cloned with pUC118. The entire 2.8-kb fragment and the two overlapping flanking fragments, EcoRI-KpnI and SacI-XbaI, were cloned with pSA3 and introduced into L. lactis subsp. lactis LM0230. The nisin resistance phenotype of the resulting transformants is indicated on the right. Nisr represents nisin resistance with an MIC of 160 IU/ml; Niss represents nisin sensitivity with an MIC of 20 IU/ml. Nisin resistance was determined as described previously (9). The nisin resistance encoded by the EcoRI-SacI fragment was not evaluated.

resis onto DEAE-cellulose membranes (34). Electroporation was used to transform L. lactis (27) and E. coli (7). DNA sequence analysis. DNA fragments were subcloned into pUC118 or pBluescript SK(+), and denatured doublestranded plasmid DNA (ca. 3 ,ug) was sequenced bidirectionally by the dideoxy-chain termination method (28). A Sequenase version 2.0 DNA sequencing kit (United States Biochemical, Cleveland, Ohio) was used as recommended by the manufacturer, and the synthesized DNA was labeled with 35S-dATP (New England Nuclear, Boston, Mass.). The plasmid DNA was denatured and the primers were annealed by the method of Toneguzzo et al. (44), with the exception that a final EDTA concentration of 0.2 mM (51) and a primer-to-template molar ratio of 4:1 were used in the denaturation mix. Electrophoresis was through 6% polyacrylamide-7 M urea gels in Tris-borate buffer (pH 8.3) with a Sequi-Gen apparatus (Bio-Rad Laboratories, Richmond, Calif.), as described by the manufacturer. Gels were dried and exposed to Kodak XAR-5 film at room temperature. Primers used included the M13 -40 and reverse primers (United States Biochemical) and synthetic 15-mer primers (Northern Biosciences, Hamel, Minn.). Sequence data were analyzed by the IntelliGenetics Suite of programs (release 6.01) and the PC/GENE program (release 5.35) (IntelliGenetics, Inc., Mountain View, Calif.). The facilities of the University of Minnesota Molecular Biology Computing Center were used to screen the protein data bases NBRF/PIR (release 20.0) and SWISS-PROT (release 11.0) as well as the DNA data bases GenBank (release 61) and EMBL (release 20). In vitro transcription-translation. Plasmid DNA-directed in vitro transcription-translation was used to identify protein products from the sequenced DNA. 35S-labeled proteins were electrophoretically separated on 0.1% sodium dodecyl sulfate (SDS)-15% polyacrylamide gels (23). The gels were fixed in 7% acetic acid, impregnated with Amplify (Amersham Corp., Arlington Heights, Ill.), dried, and exposed to Kodak XAR-5 film at -70°C for 2 to 8 h with an intensifying screen. 14C-methylated protein molecular weight markers were used. The [35S]methionine, in vitro transcription-translation kit, and size standards were obtained from Amersham. Detection of nsr in a nisin-producing strain. Total genomic DNA was prepared from L. lactis LM2306, FMO11, 11454, and JS21 (9, 41). The genomic DNA from these strains was

prepared as described by Ramos and Harlander (32a) with the following modifications: the cell pellet was washed in Tris-EDTA (10:1) buffer rather than 0.2 M sodium acetate; 0.5 M sucrose-0.01 M Tris (pH 7.0) buffer and 10 ,u of mutanolysin (1 mg/ml in distilled H20) (Miles Laboratories, Inc., Elkhart, Ind.) were used instead of 25% glucose-10 mM Tris-1 mM EDTA (pH 7.0) buffer and 10 ,u of lysozyme (10 mg/ml); and diethyl pyrocarbonate was not used. The restriction digestions were performed for 3 to 5 h at 37°C. The digests were electrophoresed on a 0.7% agarose gel for 16 to 18 h at 1.4 V/cm in TAE buffer. Southern transfers were performed as described by Polzin and Shimizu-Kadota (30) with Nytran membranes (Schleicher & Schuell, Inc., Keene, N.H.) prepared as described by the manufacturer. The 1.2-kb DraI fragment of pNP40 encoding the nsr gene, isolated by electrophoresis onto a DEAE-cellulose membrane, was used as a probe. Probe DNA was labeled, hybridized, and detected by using the Genius system (Boehringer Mannheim Biochemicals, Indianapolis, Ind.) as recommended by the manufacturer, except that the probe labeling reaction was scaled up to 50 ,ul as described in BMBiochemica (Boehringer Mannheim Biochemicals, 1989), and the probe was purified by precipitation with ethanol and 7.5 M ammonium acetate instead of 4 M LiCl. Nucleotide sequence accession number. The GenBank accession number for the DNA sequence of the nisin resistance gene cloned from biovar diacetylactis DRC3 is M37002. RESULTS Localization and subcloning of the nisin resistance gene, nsr. The nisin resistance (Nisr) phenotype was previously localized on a 2.6-kb EcoRI-XbaI fragment (9). Subsequent analysis of this fragment has determined it to be 2.8 kb long. Single restriction sites were mapped on this EcoRI-XbaI fragment for the endonucleases Sacl, NdeI, and KpnI (Fig. 1). By using the four enzymes XbaI, EcoRI, KpnI, and Sacl, all six possible fragments were cloned into E. coli XL-1 Blue with pUC118 or pBluescript SK(+) to generate pLLM1 through pLLM6 (Table 1). To further localize the nisin resistance determinant, the overlapping 1.8-kb EcoRI-KpnI and 1.7-kb SacI-XbaI fragments (Fig. 1) were excised from the pUC118 polycloning site with EcoRI and XbaI and ligated into the shuttle vector pSA3, which was also re-

NISIN RESISTANCE IN L. LACTIS SUBSP. LACTIS

VOL. 57, 1991 ZcoRI

807

780

GCTAATTTTTTAGAATCTTCATTGCATAAAAACAATTATAATGGGGTAATTGTTGATTTGA AlaAsnPheLeuGluSerSerLeuHisLysAsnAsnTyrAsnGlyVal IleValAspLeuA

840

AGGGGGAATAGAGGTGGAGACTTATCTCCTATGGTATTAGGATTATCCCCCCTATTGCCT ArgGlyAsnArgGlyGlyAspLeuSerProMetValLeuGlyLeuSerProLeuLeuPro

900

GATGGAACTCTATTTACTTATGTTGATAAAAGTAGTCATTCTAAACCTGTTGAACTACAA AspGlyThrLeuPheThrTyrValAspLysSerSerHisSerLysProValGluLeuGln

1

60 120

AluX TTTCAATTGAAAACCTTGAGGCGAACGACTTTTACAACGCTCAGCTCCTAGATTTGTCAA

180

AAAATAGAAAACTAGTCATAACTTCCCATTATGTCTAATTTTTAAACTTTGAGTTAATAT

240

GAGAGCGCAAAATTACTTCCTAGATTTATCGTTTACAATCAGTCCAAAGTTOCAGGATTT

300

TCCATTCAATITAGTTTAATAGTATTAAAATAACTGATGGAGCATATTTAATATGAAA

Dral

-35

-10

SD

960

AATGGAGAAATAAATAGTGGCGGGTCATCAACAAAAATAAGTGATAATAAAAAAATTAAA

AsnGlyGluIleAsnSerGlyGlySerSerThrLysIleSerAspAsnLysLysIleLys

MetLys

SacI

Alul 1020

AAAGCTCCTATTGCTGTATTAATAGATAATAATACAGGGAGCTCCGGCGAATTAACCGCT LysAlaProIleAlaValLeuIleAspAsnAsnThrGlySerS-rGlyGluLeuThrAla

RsaI TATCTTTGGGGGTATAAATTCAACATATATTTAGTACCACCCTCCCCTCAGAAGTATGTT TyrLeuTrpGlyTyrLysPheAsnIleTyrLeuValProProSerProGlnLysTyrVal

1080

TTGTGCTTTGAGGGAATACCTAATGTTAAATTTTTGGGTTCTGATTCAGCAGGTTATACT LeuCysPheGluGlyIleProAsnValLysPheLeuGlySerAspSerAlaGlyTyrThr

CGAGTTGCCTTAAAAAATATGGATGAACTTGGGCTATTTACTGATTCAAAAGAATGGGTA

1140

TCTGCTAATCAAACCGTCTATTTATATGATGGCTCAACATTACAAATAACTTCTGCTTTT

360

ATAGGTAAGCGCATTTTATTAGGTCTAGTGGCAGTATGTGCTTTATTTTTAGGAATTATC IleGlyLysArgIleLeuLeuGlyLeuValAlaValCysAlaLeuPheLeuGlyIleIle

420

480

SerAlaAsnGlnThrValTyrLeuTyrAspGlySerThrLeuGlnIleThrSerAlaPhe

ArgValAlaLeuLysAsnMetAspGluLeuGlyLeuPheThrAspSerLysGluTrpVal 1200

540

600

CCTTTTTTACAAAAAGCGATTAAAGTTGCAGGAGGAAAGCATTCTTTTATTGAACATGAA

1260

AATAATGCTAAAAGTTCTGCAATAGAATGGATAAAATCTCAAATAAAGTAAAGCAAAAAG ====== AsnAsnAlaLysSerSerAlaIleGluTrpIleLysSerGlnIleLys>>>

1320

ACTTGCCAAGAAAAACATATGGTAAGTCTTTTTTGCTAGTCAAAACTTAACGTTATTTAC

1380

TATGATATACCGAAAGCAAGTACCAATGCAGGTAAAATGTTGTTTAAAAGTGTATAGCTA

1440

TACTACTCTATCGTC

ProPheLeuGlnLysAlaIleLysValAlafjlyGlyLysHisSerPheIleGluHisGlu SD

GTAAAAGACAGAACAAATAATATTTATAAAAATTTTCCTATTAGTCCGGACATTCAAACA ValLysAspArgThrAsnAsnI leTyrLysAsnPheProI leSerProAspI leGlnThr

GluThrLysLysLysThrIleGluGluThrSerAsnAlaLysAsnTyrAlaGluThrIle

===========>

NdeI 660 GluAspIleSerLysArgSerMatThrLysTyrIleLysProLysAlaGluIleGluGly

Rsal 720

AACACTTTAATATTAACTATTCCTGAATTTACTGGAAATGATAGTCAAGCATCTGATTAC AsnThrLeuIleLeuThrIleProGluPheThrGlyAsnAspSerGlnAlaSerAspTyr

DraI

FIG. 2. Nucleotide sequence of the L. lactis subsp. lactis bv. diacetylactis DRC3 nisin resistance gene and its flanking regions. The of the nontranscribed DNA strand is presented, and numbering of the nucleotides is from the EcoRI site. The putative promoter and Shine-Dalgarno (SD) sequences are underlined. Putative initiation codons are in boldface type at bp 354 and 681. Directly downstream of the termination codon (>>>), the putative transcription terminator at bp 1314 to 1332 is indicated by inverted arrows, which represent the proposed stem of the stem-loop structure. The potential palindrome associated with the internal ORF is indicated by inverted arrows at bp 641 to 678. Pertinent restriction sites are indicated above the nucleotide sequence. sequence

stricted with EcoRI and XbaI. The two recombinant plasmids pLLM7 and pLLM8, formed with the EcoRI-KpnI and SacI-XbaI fragments, respectively, were transformed into plasmid-free L. lactis subsp. lactis LM0230; transformants were selected with the erythromycin resistance marker of pSA3. The nisin resistance of the transformants was evaluated. As shown previously, the 2.8-kb EcoRI-XbaI fragment confers a level of nisin resistance equivalent to that encoded by the entire 7.8-kb EcoRI fragment of pNP40, which, when inserted into LM0230, resulted in an MIC of 160 IU of nisin per ml. This level of resistance is about half that conferred by intact pNP40 in the LM0230 background (9). The MIC of nisin for plasmid-free LM0230 was 20 IU per ml (9). The 1.8-kb EcoRI-KpnI subfragment conferred a level of nisin resistance equivalent to that conferred by the entire 2.8-kb fragment (a nisin MIC of 160 IU/ml). The transformant containing the 1.7-kb SacI-XbaI fragment was nisin sensitive (Fig. 1). Therefore, the nisin resistance determinant appeared to be encoded entirely by the 1.8-kb EcoRI-KpnI fragment. Cloning of random NdeI fragments from pBF61 into the NdeI site of pFG010 did not disrupt the Nisr phenotype (data not shown). Therefore, the gene encoding nisin resistance does not overlap the NdeI site of the EcoRI-KpnI fragment (Fig. 1). Since subcloning indicated that the ScaI-XbaI fragment did not encode nisin resistance, the resistance

determinant appeared to be located between the EcoRI and NdeI restriction sites (Fig. 1). DNA sequence of the nsr gene. To determine the type of gene product conferring nisin resistance and its regulation, the sequence of the 1.4-kb EcoRI-NdeI fragment from pLLM3 associated with nisin resistance was determined (Fig. 1). The 1.1-kb EcoRI-SacI fragment cloned in pBluescript SK(+) (pLLM6) was initially used to determine part of the DNA sequence. After the initial sequence determination, the majority of the EcoRI-KpnI fragment of pLLM3 was sequenced by using a cascade sequencing strategy with synthetic primers. Both strands of a 1,454-bp fragment were sequenced. The total sequenced DNA included the entire EcoRI-NdeI fragment and 118 bp of the adjacent NdeI-KpnI fragment (pLLM3; Fig. 1). The complete nucleotide sequence is shown in Fig. 2. A single large open reading frame (ORF) was present. This ORF, designated nsr, was composed of 957 nucleotides and extended from an ATG start codon at position 354 to the first in-frame stop codon (TAA) at position 1310. The ORF has the potential to encode a protein of 35,035 Da comprising 318 amino acids. Examination of the DNA sequence for transcriptional and translational regulatory sequences revealed that 9 bp upstream from the ATG codon is a sequence resembling Shine-Dalgamo sequences that have been reported for L. lactis (5). This putative ribosome binding site

u

.:_ i.*ftUXiS.-;_s

itv.0

APPL. ENVIRON. MICROBIOL.

FROSETH AND McKAY

808 48

..j-.

z;E.

2=

0..

21-

A

,

hEN .

.

j

.

S

A.i

_ _r1i,...s,.

-30

_21.5

,

1_8

15.5-

f:0.ffX ..

,_

i.

'e04Q'swS

ojt's'f'wy id

.D _.

.

60

120 180 Amino Acid Position

248

3ee

FIG. 3. Hydropathy profile of the pNP40 nisin resistance protein. Hydropathy analysis was performed by the PC/GENE program with the parameters of Kyte and Doolittle (22), with an interval of nine amino acids.

had a free energy of binding of -9.4 kcal/mol (43) (1 kcal = 4.184 kJ) with the 3' end of the 16S rRNA of L. lactis DSM20250 -(25). Further examination revealed that 23 bp upstream of the putative Shine-Dalgarno sequence were putative -10 and -35 sequences. These last two sequences were separated by 16 nucleotides. Directly downstream of the termination codon was a region of dyad symmetry between nucleotides 1314 and 1352 that could form a stem of up to 14 bp (with four GC pairs and one mismatch) and contained a run of six T residues at the downstream end. The free energy of the putative hairpin loop was calculated to be -12 kcal/mol (43). This symmetrical region may represent a rho-independent terminator sequence. This putative transcription termination sequence was relatively close to the stop codon, being less than 5 bp downstream. The hydropathy profile of the nsr gene product is shown in Fig. 3 (22). The analysis demonstrated that this protein had a strongly hydrophobic domain at the amino terminus. This region is similar to the membrane anchor domains found in integral membrane proteins (46, 50). By using the PC/GENE program and the method of Klein et al. (20), this region was predicted to be a transmembrane segment with outer membrane boundaries at amino acids 2 and 29 and inner membrane boundaries at amino acids 7 and 23. These results suggested that the nsr gene product was an integral membrane protein (20). The protein was also examined for signal sequences by the method of von Heijne (47). A signal sequence processing site was not associated with the hydrophobic domain of the amino terminus, although a potential cleavage site between residues 196 and 197 was observed. To determine homology between the amino acid sequence associated with nisin resistance and those previously reported, a protein sequence homology search was conducted. No significant homology between the protein specified by the putative nsr gene and proteins present in the NBRF/PIR and SWISS-PROT data banks was found as of January 1990. Confirmation of the ORF encoding Nisr. To corroborate the DNA sequence data and determine whether the large ORF encoded Nisr, subcloning of the ORF associated with Nisr was conducted. Sequence analysis identified the presence of two DraI sites resulting in a fragment of 1,202 bp which encompassed the 957-bp ORF and all putative transcriptional and translational control elements, a region with a total size of approximately 1,064 bp (Fig. 2). In addition, AluI and RsaI sites, which resulted in overlapping fragments that separately carried each end of the putative nsr gene,

.^

5_

FIG. 4. Identification of the putative nisin resistance protein by in vitro transcription-translation reactions. DNAs used: lane A, pUC118 vector; lane B, pLLM1 containing the 2.8-kb EcoRI-XbaI fragment expressing four polypeptides of 37, 27, 21, and 15.5 kDa; lane C, pLLM2 containing the 1.7-kb XbaI-SacI fragment expressing polypeptides of 21 and 15.5 kDa; lane D, pLLM3 containing the 1.8-kb EcoRI-KpnI fragment expressing polypeptides of 37 and 27 kDa; lane E, pLLM6 containing the 1.1-kb EcoRI-SacI fragment expressing polypeptides of 28 and 14.5 kDa; lane F, pBluescript SK(+) vector. The positions of 14C-labeled protein molecular mass standards (in kilodaltons) are shown on the right. On the left, the sizes of the nsr gene products are indicated in kilodaltons and the position of the vector-derived 1-lactamase is indicated by the arrowhead.

were identified (Fig. 2). The blunt-ended fragments of 860, 946, and 1,202 bp produced by AluI, RsaI, and DraI, respectively, were cloned independently into the single EcoRV site of pSA3 to generate pLLM9 through pLLM11, respectively. These plasmids were used to transform plasmid-free LM0230, and erythromycin-resistant transformants were evaluated for resistance to nisin. The 1,202-bp DraI fragment conferred nisin resistance at a level equivalent to that expressed by the original 7.8-kb plasmid, pFM011. Therefore, the DraI fragment appeared to encode all the information necessary for transcription and translation of the nsr gene. Transformants containing the AluI or RsaI fragments were found to be as sensitive to nisin as strain LM0230 was. The AluI fragment should result in a truncated ORF of at least 670 bp and a truncated protein of at least 223 amino acids. Therefore, this truncated protein was not sufficient in size to confer resistance to nisin, suggesting that the carboxy terminus of the nsr gene product was important for expression of nisin resistance. The RsaI fragment cloned was missing the transcription and translation initiation signals and the first 101 bp of the large ORF. As expected, these initiation signals were critical to the expression of nisin resistance. In vitro transcription-translation studies. To determine whether the nsr gene encoded a protein involved in nisin resistance, radioactively labeled proteins were expressed from the four plasmids illustrated in Fig. 1 by using in vitro transcription-translation reactions. The labeled proteins were separated by SDS-polyacrylamide gel electrophoresis and detected by fluorography. As shown in Fig. 4, the 2.8-kb EcoRI-XbaI fragment in pLLM1 expressed at least four unique polypeptides of 37, 27, 21, and 15.5 kDa (lane B). The 1.7-kb XbaI-SacI fragment in pLLM2, which did not confer the Nisr phenotype, retained the ability to encode production of the 21- and 15.5-kDa proteins (lane C). This suggested that these two proteins were not involved with nisin resis-

RESISTANCE IN L. LACTIS SUBSP. LACTIS VOL. 1991 ~~~~~~~NISIN VOL. 1991 57,57,

tance. The 1.8-kb EcoRI-Kpnl fragment in pLLM3 encoding

nisin resistance produced the 37- and 27-kDa proteins (lane D), suggesting that these two proteins were associated with nisin resistance. By using DNA sequence data, the size of the putative nsr gene product was predicted to be 35,035 Da, suggesting that the 37-kDa protein produced by in vitro transcription-translation was indeed the nsr gene product. The EcoRI-Sacl fragment in pLLM6 encoded two unique proteins of 28 and 14.5 kDa (lane E); these proteins were different in size from the four protein bands described above. The EcoRI-SacI fragment of pLLM6 was cloned such that an in-frame stop codon was present six codons downstream from the Sacl site. This should result in a truncated polypeptide of 26.6 kDa being produced from the abbreviated ORF. The in vitro transcription-translation reaction using the EcoRI-SacI fragment did produce a 28-kDa protein, apparently the truncated product of the complete ORF. The production of this truncated protein supported the suggestion that the 37-kDa protein was the nsr gene product. The 27-kDa protein associated with nisin resistance was produced by both the 2.8-kb EcoRI-Xbal and 1.8-kb EcoRlKpnl fragments but not by the truncated 1.1-kb EcoRI-Sacl fragment. Instead, a unique polypeptide of 14.3 kDa was produced and was apparently the truncated product of the 27-kDa protein. The 37- and 27-kDa proteins associated with nisin resistance appeared to be 9 and 12.5 kDa smaller, respectively, when expressed by the truncated ORF encoded by the EcoRI-Sacl fragment. Since both proteins were truncated by approximately the same amount when the ORF associated with nisin resistance was shortened, they both appeared to be encoded by the nsr ORF. Examination of the ORF associated with nisin resistance for additional ribosome binding sites and associated initiation codons revealed a sequence at nucleotide positions 629 to 634 with a calculated free energy of binding (43) of - 16.6 kcallmol with the 3' end of L. lactis 168 rRNA (25). This potential ribosome binding site was 46 nucleotides upstream from an AUG codon which was in frame to the major ORF. Between the potential Shine-Dalgarno sequence and the initiation codon was a palindromic region with a free energy of binding of -7.0 kcallmol. If formed, this hairpin loop would bring the potential ribosome binding site and initiation codon into direct proximity. The product of this possible internal gene would have a molecular mass of 23 kDa, and the truncated product of this protein, produced by the 1.1-kb EcoRI-SacI fragment, would have a mass of 14.6 kDa. Examination of nisin-producing L. lactis subsp. lactis genomic DNA for homology with the nsr gene. The Nis' phenotype originally identified on pNP40 was not associated with nisin production; the host strain of pNP40, biovar diacetylactis DRC3, was not a nisin producer (28). The level of nisin resistance encoded by DRC3 was about 1/10 of that expressed by nisin-producing strains of L. lactis subsp. lactis (9, 16). As the mechanism(s) of nisin resistance expressed by biovar diacetylactis DRC3 and by nisin-producing strains is not known, it is unknown whether the genes encoding nisin resistance are similar. DNA homology between the genomic DNA of a nisin producer and the putative nsr gene from biovar diacetylactis DRC3 was examined. Total genomic DNA was isolated from the nisin-producing strain L. lactis subsp. lactis 11454, the nisin-producing transconjugant L. lactis subsp. lactis JS21 (41), the plasmid-free recipient strain LM2306, and the recipient strain containing pFMOll. The DNA was digested with EcoRI and probed with the 1.2-kb Dral fragment of pFM011, which encoded the entire nsr gene. As expected, the probe hybridized strongly to the

809

7.8-kb fragment of pFMO11 in LM0230 (results not shown). The probe did not hybridize to the 11454, JS21, or LM2306 digest, suggesting that the strain 11454 nisin resistance determinant does not share significant homology with nsr from pNP40. DISCUSSION To characterize the nisin resistance determinant of pFM011, the DNA sequence of a 1.3-kb EcoRI-Ndel fragment from this plasmid and additional flanking DNA was determined and found to encode a single large ORF of 957 nucleotides. The start codon for this ORF was located 354 nucleotides from the EcoRI site, and the first in-frame stop codon was 26 nucleotides from the NdeI site. By using the consensus lactococcal promoter sequence previously described (5, 45), a putative promoter sequence was found to be located within 40 nucleotides of the start codon. The 50-bp region upstream of the promoter sequence was AT rich (64%), though this percentage was at the low end of the range of 64 to 79% reported by van der Vossen et al. (45) for lactococcal promoters. Sequences within the promoter with dyad symmetry which might represent the binding site of a regulatory protein were not observed. A putative ribosome binding site with a free energy of binding of -9.4 kcal/mol with the 3' end of the L. lactis 165 rRNA was identified (25, 43). Additionally, a palindromic region which resembled a rho-independent termination sequence was located S nudleotides downstream of the termination codon. The free energy of the putative hairpin loop was calculated to be -12 kcal/mol, and the downstream portion of this sequence included six contiguous thymine residues. This termination region was particularly close to the termination codon, although a similar proximity is also seen in some ORFs sequenced from a bacteriocinogenic plasmid of Clostridium

perfringens (10). The relationship of NiSr to the ORF determined by sequencing was confirmed by subcloning. A 1,202-bp Dral fragment including the entire 957-bp ORF and associated putative transcription- and translation-regulatory sequences was cloned into L. lactis LM0230. This fragment conferred nisin resistance at the same level as pFMO11, which was approximately half that conferred by intact pNP4O in the LM0230 background (9). The difference in expression should not be due to copy number, as replication of pFMO11, composed entirely of the 7.8-kb EcoRI fragment of pNP40, is controlled by an oriR derived from pNP40. Therefore, unless pNP4O replication is controlled via an additional oriR, the copy numbers of pFM011 and pNP40 should be similar. Additionally, the level of nisin resistance expressed by pFM011 was equivalent to that expressed by the 1,202-bp Dral fragment cloned into pSA3. This shuttle vector contains an oriR derived from pIPS0l (15), and it is unlikely the copy number of the pSA3 origin is equivalent to that of

pFMO11. This suggests that the copy number may not be an

important factor influencing expression of nisin resistance. An alternative explanation is that a strong promoter is present upstream of the nsr gene in pNP4O and results in additional transcripts. The nsr gene was located at one end of the EcoRI fragment originally cloned from pNP40, and no apparent transcription termination regions were identified in the DNA sequenced upstream of the gene. Therefore, cloning of the EcoRI fragment could have reduced the number of nsr transcripts, thus reducing the nisin MIC for the transformant strains. The protein encoded by the entire nsr gene was predicted

810

FROSETH AND McKAY

to have a mass of 35,035 Da. The predicted amino acid sequence of this protein showed little homology with sequences available in the NBRF/PIR and SWISS-PROT data banks. The complete nsr gene product contained a strongly hydrophobic amino terminus (Fig. 3). This hydrophobic region was predicted to be a transmembrane segment (20) and did not appear to be associated with a consensus signal sequence cleavage site (47). This result supported the prediction that the nsr gene product was an integral membrane protein with one major transmembrane sequence located at the amino terminus. We cannot rule out the possibility that the amino terminus represented a secretory signal, as these signals show significant variability (48, 50). A cytoplasmic membrane location for the nsr gene product would resemble previously reported colicin models. Colicin Ia belongs to the class of pore-forming colicins that act at the cytoplasmic membrane and result in destruction of a cell's energy potential (31). The colicin Ta immunity protein is located in the cytoplasmic membrane (32), as are immunity proteins for other pore-forming colicins (2, 11, 38, 49). Nisin and other lantibiotics have been shown to depolarize bacterial and artificial membranes by forming voltage-dependent multistate pores (21). Other authors have also suggested that nisin activity targets the cytoplasmic membrane (12). Therefore, gross similarities between the pore-forming colicins and nisin may include the location of immunity or resistance determinants. This is further suggested by the prediction that the nsr gene product is an integral membrane protein. In vitro transcription-translation of DNA encoding the nsr gene resulted in two protein products of 37 and 28 kDa. The 37-kDa polypeptide was almost certainly the nisin resistance protein (that is, the product of the entire nsr gene). This protein was encoded by the plasmids conferring nisin resistance, and it was reduced in size by the expected amount when a plasmid containing a truncated nsr gene was evaluated. Additionally, this polypeptide was essentially the same size as that predicted from the DNA sequence. The 28-kDa protein was also associated with the nsr gene by in vitro transcription-translation: the polypeptide was expressed by all plasmids producing the 37-kDa product, and truncation of the nsr gene also resulted in a reduction in size of the 28-kDa polypeptide (Fig. 4). This smaller polypeptide may be the result of proteolysis of the resistance protein occurring in the transcription-translation reaction or may be the product of an internal translation initiation sequence. An internal ribosome binding site with strong homology to the 3' end of the 16S rRNA of L. lactis was present between nucleotides 629 and 634, with a downstream AUG codon at nucleotide 681. Between these two recognition sites was a palindromic region which could result in bringing the ribosome binding site and initiation codon into direct proximity. The product of this internal ORF would be identical to the nsr gene product but would lack the first 109 amino acid residues, thus missing the membrane-associated portion of the entire protein. This could represent a means of ensuring both a cytoplasmic and a membrane location for the resistance protein. Further research is needed to determine whether the 28-kDa polypeptide is the product of proteolysis or an internal translation initiation sequence involved in nisin

resistance. The level of nisin resistance encoded by strain DRC3 was approximately 1/10 of that of nisin-producing strains, suggesting that the two mechanisms of resistance were dissimilar. A 1,202-bp fragment of pFMO11 encoding the putative nsr gene was used to probe an EcoRI digest of genomic DNA from the nisin producer L. lactis subsp. lactis 11454 and a

APPL. ENVIRON. MICROBIOL.

nisin-producing transconjugant of this strain. No homologous bands were identified, further suggesting that this nsr gene is distinct from the nisin immunity gene. Buchman et al. (3) have reported the sequence of the nisin production gene

of strain 11454. Further sequencing of this nisin production gene block should allow direct comparison of the nisin immunity and resistance genes. In addition to being useful as a selectable marker (9a) and in the construction of a food-grade cloning vector, a characterized nsr gene should be useful in constructing multiple starter strains containing a nisin producer. Single strains of nisin producers may result in undesirable organoleptic properties of the finished product (16, 24). While a multiple-strain starter could circumvent these problems, all strains of a nisin-producing multiple starter would have to be nisin resistant. The nsr gene could be fundamental in constructing such strains for commercial purposes, as nisin is being used as an antimicrobial agent in foods (16). Further elucidation of the mechanism of nisin resistance may aid in understanding the mechanism of nisin activity and comparing it to that of other lantibiotics. ACKNOWLEDGMENTS We thank Mark Dalton and the University of Minnesota Molecular Biology Computing Center for assistance with the DNA sequence analysis. We also thank Kayla Polzin for helpful discussions and suggestions. This research was supported in part by Kraft, Inc., Glenview, Illinois, and in part by the Kraft General Foods Chair in Food Science awarded to L. L. McKay. This research was conducted as part of the Minnesota-South Dakota Dairy Foods Research Center. REFERENCES 1. Anderson, D. G., and L. L. McKay. 1983. Simple and rapid method for isolating large plasmid DNA from lactic streptococci. Appl. Environ. Microbiol. 46:549-552. 2. Bishop, L. J., E. S. Bjes, V. L. Davidson, and W. J. Cramer. 1985. Localization of the immunity protein-reactive domain in unmodified and chemically modified COOH-terminal peptides of colicin El. J. Bacteriol. 164:237-244. 3. Buchman, G. W., S. Banerjee, and J. N. Hansen. 1988. Structure, expression, and evolution of a gene encoding the precursor of nisin, a small protein antibiotic. J. Biol. Chem. 263:1626016266. 4. Dao, M. L., and J. J. Ferretti. 1985. Streptococcus-Escherichia coli shuttle vector pSA3 and its use in the cloning of streptococcal genes. Appl. Environ. Microbiol. 49:115-119. 5. de Vos, W. M. 1987. Gene cloning and expression in lactic streptococci. FEMS Microbiol. Rev. 46:281-295. 6. de Vos, W. M., P. Vos, G. Simons, and S. David. 1989. Gene organization and expression in mesophilic lactic acid bacteria. J. Dairy Sci. 72:3398-3405. 7. Dower, W. J. 1988. Transformation of E. coli to extremely high efficiency by electroporation. Molecular biology reports, no. 6. Bio-Rad Laboratories, Richmond, Calif. 8. Froseth, B. R., S. K. Harlander, and L. L. McKay. 1988. Plasmid-mediated reduced phage sensitivity in Streptococcus lactis KR5. J. Dairy Sci. 71:275-284. 9. Froseth, B. R., R. E. Herman, and L. L. McKay. 1988. Cloning of nisin resistance determinant and replication origin on 7.6kilobase EcoRI fragment of pNP40 from Streptococcus lactis subsp. diacetylactis DRC3. Appl. Environ. Microbiol. 54:21362139. 9a.Froseth, B. R., and L. L. McKay. J. Dairy Sci., in press. 10. Garnier, T., and S. T. Cole. 1988. Complete nucleotide sequence and genetic organization of the bacteriocinogenic plasmid, pIP404, from Clostridium perfringens. Plasmid 19:134-150. 11. Goldman, K., J. L. Suit, and C. Kayalar. 1985. Identification of the plasmid-encoded immunity protein for colicin El in the inner membrane of Escherichia coli. FEBS Lett. 190:319-323.

VOL. 57, 1991

12. Henning, S., R. Metz, and W. P. Hammes. 1986. Studies on the mode of action of nisin. Int. J. Food Microbiol. 3:121-134. 13. Herman, R. E., and L. L. McKay. 1986. Cloning and expression of the P-D-galactosidase gene from Streptococcus thermophilus in Escherichia coli. Appl. Environ. Microbiol. 52:45-50. 14. Holmes, D. S., and M. Quigley. 1981. A rapid boiling method for the preparation of bacterial plasmids. Anal. Biochem. 114:193197. 15. Horodniceanu, T., D. H. Bouanchaud, G. Bieth, and Y. A. Chabbert. 1976. R plasmids in Streptococcus agalactiae (group B). Antimicrob. Agents Chemother. 10:795-801. 16. Hurst, A. 1981. Nisin. Adv. Appl. Microbiol. 27:85-123. 17. Jarvis, B., and J. Farr. 1971. Partial purification, specificity and mechanism of action of the nisin-inactivating enzyme from Bacillus cereus. Biochim. Biophys. Acta 227:232-240. 18. Klaenhammer, T. R. 1987. Plasmid-directed mechanisms for bacteriophage defense in lactic streptococci. FEMS Microbiol. Rev. 46:313-325. 19. Klaenhammer, T. R. 1988. Bacteriocins of lactic acid bacteria. Biochimie 70:337-349. 20. Klein, P., M. Kanehisa, and C. DeLisi. 1985. The detection and classification of membrane-spanning proteins. Biochim. Biophys. Acta 815:468-476. 21. Kordel, M., F. Schuller, and H.-G. Sahl. 1989. Interaction of the pore forming-peptide antibiotics pep 5, nisin and subtilin with non-energized liposomes. FEBS Lett. 244:99-102. 22. Kyte, J., and R. F. Doolittle. 1982. A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 157:105-132. 23. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London) 227:680-685. 24. Lipinska, E. 1977. Nisin and its applications, p. 103-130. In V. M. Woodbine (ed.), Antibiotics and antibiosis in agriculture. Butterworths, London. 25. Ludwig, W., E. Seewaldt, R. Kilpper-Balz, K. H. Schleifer, L. Magrum, C. R. Woese, G. E. Fox, and E. Stackebrandt. 1985. The phylogenetic position of Streptococcus and Enterococcus. J. Gen. Microbiol. 131:543-551. 26. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 27. McIntyre, D. A., and S. K. Harlander. 1989. Improved electroporation efficiency of intact Lactococcus lactis subsp. lactis cells grown in defined media. AppI. Environ. Microbiol. 55: 2621-2626. 28. McKay, L. L., and K. A. Baldwin. 1984. Coniugative 40megadalton plasmid in Streptococcus lactis subsp. diacetylactis DRC3 is associated with resistance to nisin and bacteriophage. Appl. Environ. Microbiol. 47:68-74. 29. Messing, J. 1983. New M13 cloning vectors. Methods Enzymol. 101:20-78. 30. Polzin, K. M., and M. Shimizu-Kadota. 1987. Identification of a new insertion element, similar to gram-negative IS26, on the lactose plasmid of Streptococcus lactis ML3. J. Bacteriol. 169:5481-5488. 31. Pugsley, A. P. 1984. The ins and outs of colicins. Part I. Production, and translocation across membranes. Microbiol. Sci. 1:168-175. 32. Pugsley, A. P. 1984. The ins and outs of colicins. Part II. Lethal action, immunity and ecological implications. Microbiol. Sci.

NISIN RESISTANCE IN L. LACTIS SUBSP. LACTIS

811

1:203-205. 32a.Ramos, M., and S. K. Harlander. Appl. Microbiol. Biotechnol., in press. 33. Rodriquez, R. L., and R. C. Tait. 1983. Recombinant DNA techniques: an introduction. Addison-Wesley Publishing Co., Reading, Mass. 34. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 35. Sanders, M. E. 1988. Phage resistance in lactic acid bacteria. Biochimie 70:411-421. 36. Sanders, M. E., P. J. Leonard, W. D. Sing, and T. R. Klaenhammer. 1986. Conjugal strategy for construction of fast acidproducing, bacteriophage-resistant lactic streptococci for use in dairy fermentations. Appl. Environ. Microbiol. 52:1001-1007. 37. Schleifer, K. H. 1987. Recent changes in taxonomy of lactic acid bacteria. FEMS Microbiol. Rev. 46:201-203. 38. Schramm, E., T. Olschlager, W. Troger, and V. Braun. 1988. Sequence, expression and localization of the immunity protein for colicin B. Mol. Gen. Genet. 211:176-182. 39. Shearman, C., H. Underwood, K. Jury, and M. Gasson. 1989. Cloning and DNA sequence analysis of a Lactococcus bacteriophage lysin gene. Mol. Gen. Genet. 218:214-221. 40. Simon, D., and A. Chopin. 1988. Construction of a plasmid family and its use for molecular cloning in Streptococcus lactis. Biochimie 70:559-566. 41. Steele, J. L., and L. L. McKay. 1986. Partial characterization of the genetic basis for sucrose metabolism and nisin production in Streptococcus lactis. Appl. Environ. Microbiol. 51:57-64. 42. Terzaghi, B. E., and W. E. Sandine. 1975. Improved media for lactic streptococci and their bacteriophages. Appl. Microbiol. 29:807-813. 43. Tinoco, I., P. N. Borer, B. Dengler, M. D. Levine, 0. C. Uhlenbeck, D. M. Crothers, and J. Gralla. 1973. Improved estimation of secondary structure in ribonucleic acids. Nature (London) New Biol. 246:40-41. 44. Toneguzzo, F., S. Glynn, E. Levi, S. Mjolsness, and A. Hayday. 1988. Use of chemically modified T7 DNA polymerase for manual and automated sequencing of supercoiled DNA. BioTechniques 6:460-469. 45. van der Vossen, J. M. B. M., D. van der Lelie, and G. Venema. 1987. Isolation and characterization of Streptococcus cremoris Wg2-specific promoters. Appl. Environ. Microbiol. 53:24522457. 46. von Heijne, G. 1981. Membrane proteins. The amino acid composition of membrane-penetrating segments. Eur. J. Biochem. 120:275-278. 47. von Heijne, G. 1986. A new method for predicting signal sequence cleavage sites. Nucleic Acids Res. 14:4683-4690. 48. Watson, M. E. E. 1984. Compilation of published signal sequences. Nucleic Acids Res. 12:5145-5164. 49. Weaver, C. A., A. H. Redborg, and J. Konisky. 1981. Plasmiddetermined immunity of Escherichia coli K-12 to colicin Ia is mediated by a plasmid-encoded membrane protein. J. Bacteriol. 148:817-828. 50. Wickner, W. T., and H. F. Lodish. 1985. Multiple mechanisms of protein insertion into and across membranes. Science 230: 400-407. 51. Wong, L.-M., D. K. Weber, T. Johnson, and A. Y. Sakoguchi. 1988. Supercoil sequencing using unpurified templates produced by rapid boiling. BioTechniques 6:839-843.