Fish Physiol Biochem DOI 10.1007/s10695-014-9998-4
Molecular characterization of the cathepsin B of turbot (Scophthalmus maximus) Ze-jun Zhou • Reng Qiu • Jian Zhang
Received: 31 August 2014 / Accepted: 8 October 2014 Ó Springer Science+Business Media Dordrecht 2014
Abstract Cathepsin B is an enzymatic protein belonging to the peptidase C1 family. It is involved in diverse physiological and pathological functions that include immune response. In this study, we identified and characterized a cathepsin B homolog (SmCatB) from turbot (Scophthalmus maximus). SmCatB is composed of 330 amino acid residues and possesses typical domain architecture of cathepsin B, which contains a propeptide region and a cysteine protease domain, and the latter processes four conserved residues (Q101, C107, H277, and N297) in the active site. SmCatB shares 80.6–87.6 % overall
Ze-jun Zhou and Reng Qiu have contributed equally to this work.
Electronic supplementary material The online version of this article (doi:10.1007/s10695-014-9998-4) contains supplementary material, which is available to authorized users. Z. Zhou R. Qiu J. Zhang (&) Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, China e-mail: [email protected] Z. Zhou R. Qiu University of Chinese Academy of Sciences, Beijing 100049, China R. Qiu China-UK-NYNU-RRes Joint Laboratory of Insect Biology, Nanyang Normal University, Nanyang 473061, Henan, China
sequence identities with the cathepsin B of a number of teleost. SmCatB expression was detected in a wide range of tissues and upregulated by bacterial infection in a time-dependent manner. Recombinant SmCatB (rSmCatB-WT) purified from Escherichia coli exhibited apparent protease activity, which was optimal at 50 °C and pH 5.5. Compared to rSmCatB-WT, the mutant proteins rSmCatB-C107S, rSmCatB-H277A, and rSmCatB-N297A, which bear C107S, H277A, and N297A mutations, respectively, were significantly reduced in protease activity, with the highest reduction observed with rSmCatB-N297A. These results indicate that SmCatB is a bioactive protease that depends on the conserved structural features and that SmCatB is involved in pathogen-induced immune response. Keywords Cathepsin B Scophthalmus maximus Expression Cysteine protease
Introduction In mammals, various cathepsins have been identified, including cathepsins B, C, F, H, K, L, O, S, V, W, and X (Turk et al. 2000). Cathepsin B is one of the best studied cathepsins and still draws wide attention. It is present in almost all mammalian tissues and has traditionally been regarded as a lysosomal mediator of protein turnover (Mort and Buttle 1997). Cathepsin B exhibits dipeptidyl carboxypeptidase, carboxypeptidase, or endopeptidase activity depending on pH as well as the type of substrate
123
Fish Physiol Biochem
(Koga et al. 1991). This variation of proteolytic activity is determined by different structural features of the protein (Musil et al. 1991). Besides the physiological role in intracellular terminal protein degradation, cathepsin B can also exist in a soluble form and bind to the plasma membrane or proteins of extracellular matrix, thus taking a part in various physiological and pathological processes (Sinha et al. 2001). For example, cathepsin B is involved in many biological functions such as MHC-II-mediated antigen presentation, inflammation, bone resorption, apoptosis, hormone maturation, and tumor progression and metastasis (Vannoorden et al. 1988; Uchiyama et al. 1989; Guagliardi et al. 1990; Mizuochi et al.1994; Mort and Buttle 1997; Barrera et al. 2001; Gocheva et al. 2006; Hook et al. 2011; Reichenbach et al. 2012; Withana et al. 2012; Morchang et al. 2013; Tong et al. 2014). Cathepsin B expression is highly upregulated in many malignant tumors and premalignant lesions and has often been positively correlated with a poor prognosis (Kos et al. 2000; Talieri et al. 2004; Herszenyi et al. 2008). In fish, the cathepsin B of Paralichthys olivaceus, Oplegnathus fasciatus, Cynoglossus semilaevis, Oncorhynchus mykiss, Epinephelus coioides, Fundulus heteroclitus, and Danio rerio have been studied (Kwon et al. 2001; Fabra and Cerda` 2004; Zhang et al. 2008; Eykelbosh and Van der Kraak 2010; Tingaud-Sequeira et al. 2011; Whang et al. 2011; Cha et al. 2012; Chen and Sun 2012; Wei et al. 2014), which showed that fish cathepsin B homologues are similar in genetic organization and structural features to mammalian cathepsin B. Fish cathepsin B are known to be involved in immune response, embryonic development, and regulation of follicular apoptosis (Eykelbosh and Van der Kraak 2010; TingaudSequeira et al. 2011; Chen and Sun 2012). Turbot (Scophthalmus maximus) is an important economic fish species cultured in China. However, like most farmed fish, turbot is susceptible to diseases caused by various pathogens, which brings great economic loss to the aquaculture industry. Currently, there is no effective means for the control of infections in turbot, due at least in part to the reason that the immune systems in this fish species remain largely unknown. Since cathepsins are known to be involved in various immune processes, we aimed in this study to examine the expression and activity of a turbot cathepsin. For this purpose, we identified and analyzed the expression and activity of a cathepsin B
123
homologue from turbot (named SmCatB). Our results indicate a possible role for SmCatB in the innate immunity of turbot and add new insight to the structure–function relationship of teleost cathepsin B.
Materials and methods Animals Clinically healthy turbot were purchased from a commercial fish farm in Shandong Province, China, and maintained at 20 °C in aerated seawater. Fish were acclimatized in the laboratory for 2 weeks prior to experimental manipulation. Before experiment, fish were randomly sampled for the examination of the presence of bacteria in blood, liver, kidney, and spleen as reported previously (Zhang et al. 2012). No bacteria were detected from the examined fish. Before tissue collection, fish were euthanized with an overdose of tricaine methanesulfonate (Sigma, St. Louis, MO, USA) as reported previously (Wang et al. 2009). Bacterial strains and culture conditions The Gram-negative fish bacterial pathogen Edwardsiella tarda TX1 has been reported previously (Zhang et al. 2009). E. coli BL21 (DE3) was purchased from TransGen Biotech (Beijing, China). Both strains were cultured in Luria-Bertani broth (LB) medium at 28 °C (for E. tarda) or 37 °C (for E. coli). Cloning of SmCatB A cDNA library of turbot head kidney (HK) and spleen was constructed as reported previously (Zheng et al. 2010). Plasmids were isolated from 1,500 clones and subjected to DNA sequence analysis; one clone was found to contain the cDNA of SmCatB with 50 untranslated regions (UTR). The 30 -UTR was obtained by RACE (rapid amplification of cDNA ends) as described previously (Hu et al. 2010). The nucleotide sequence of SmCatB has been deposited in GenBank database under the accession number KM261797. Sequence analysis Nucleotide and amino acid sequences were analyzed with the BLAST program at the National Center for
Fish Physiol Biochem Table 1 Primers used in this study
a
Underlined nucleotides are restriction sites of the enzymes indicated in the brackets at the ends
Primer
Sequences (50 ? 30 )a
F1
GATATCGCCACCATGCTGCCTGAGGAATTTGA (EcoRV)
R1
CGCGATATCCTTGGGAATGCCTGCCAC (EcoRV)
RTF1
AGCAATGGCAAGGTCAACG
RTR1
TCCAGAAGTCCCAGGCAGA
MCF1
GATCCAGCTGGGCATTTGGCGC
MCR1
CCAGCTGGATCCACAGGAGCCCT
MHF1
GGCGCGGCCATCAAGGTCCTGG
MHR1 MNF1
TGGCCGCGCCACCCAGAGCAGAT GTGCCGCGTCCTGGAACACTGACTG
MNR1
GGACGCGGCACAGAGCCAGTAGG
Biotechnology Information (NCBI). Domain architecture analysis was performed using the simple modular architecture research tool (SMART) version 4.0 and the conserved domain database (CDD) of NCBI. The molecular weight (Mw) and theoretical isoelectric point calculations were carried out with EditSeq in DNASTAR software package (DNASTAR Inc. Madison, WI, USA). Multiple sequence alignment was implemented with the ClustalX program. Phylogenetic analysis was performed using MEGA 4.0 with Neighbor-joining (NJ) algorithm. Quantitative real time reverse transcription-PCR (qRT-PCR) analysis of SmCatB expression in fish tissues SmCatB expression in fish tissues under normal physiological conditions Spleen, gut, heart, gill, brain, kidney, liver, muscle, and blood were taken aseptically from five fish and used for total RNA extraction with the HP Total RNA kit plus RNase-Free DNase Set (Omega Bio-tek, Doraville, GA, USA). One microgram of total RNA was used for cDNA synthesis with the Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA, USA). qRT-PCR was carried out in an Eppendorf Mastercycler (Eppendorf, Hamburg, Germany) using the SYBR ExScript qRT-PCR Kit (Takara, Dalian, China) as described previously (Dang and Sun 2011). The expression level of SmCatB was analyzed using comparative threshold cycle method (2-DDCT) with RNA polymerase II subunit D (RPSD) as a control as reported previously (Zheng and Sun 2011). The primers used for SmCatB were RTF1 and RTR1
(Table 1). Melting curve analysis of amplification products was performed at the end of each PCR to confirm that only one PCR product was amplified and detected. The PCR efficiency (E) and correlation coefficient (R2) of the primers were determined based on the slopes of the standard curves generated using serial fivefold dilutions of sample cDNA. The efficiency was calculated based on the following formula: E (%) = (10-1/slope - 1) 9 100 (Kubista et al. 2006). The acceptable E value was defined as 90–110 %. The experiments were performed three times, and the results are shown as means plus or minus standard errors (SE). SmCatB expression in response to bacterial infection E. tarda TX1 was cultured in LB medium to midlogarithmic phase and resuspended in PBS to 1 9 107 colony forming units (CFU)/ml. Turbot (*14 g) were randomly divided into two groups (30 fish/group) and injected with 100 ll of E. tarda or PBS (control). Fish (five for each time point) from each group were euthanized at 4, 8, 12, 24, 48 post-infection; kidney, spleen, and liver were taken under aseptic conditions and used for qRT-PCR as described above with actin as an internal control (Zheng and Sun 2011). The experiment was performed three times, and the results are shown as means plus or minus standard errors (SE). Plasmid construction The primers used for plasmid construction are listed in Table 1. To construct pEtSmCatB-WT, which expresses a His-tagged protein corresponding to the
123
Fish Physiol Biochem
mature form of SmCatB-WT (residue 79–330), PCR was conducted with PCR primers F1 and R1. The PCR products were ligated with the T–A cloning vector T-Simple (TransGen Biotech, Beijing, China), and the recombinant plasmid was digested with EcoRV to retrieve the SmCatB-containing fragment, which was inserted into pET259 (Hu et al. 2010) at the SwaI site, resulting in pEtSmCatB-WT. pEtSmCatB-C107S, which expresses the mutant protein bearing C107S mutation, was constructed by overlapping PCR as follows: the first PCR was performed with the primers F1 and MCR1, the second PCR was performed with the primers MCF1 and R1, and the fusion PCR was performed with the primer pair F1/R1. The PCR products were digested with EcoRV and inserted into pET259 as described above, resulting in pEtSmCatBC107S. pEtSmCatB-H277A, which expresses the mutant protein bearing H277A mutation, was constructed as described above, except that the first PCR was performed with the primers F1 and MHR1, the second PCR was performed with the primers MHF1 and R1, and the fusion PCR was performed with the primer pair F1/R1. pEtSmCatB-N297A, which expresses the mutant protein bearing N297A mutation, was constructed as described above, except that the first PCR was performed with the primers F1 and MNR1, the second PCR was performed with the primers MNF1 and R1, and the fusion PCR was performed with the primer pair F1/R1.
proteins was determined using the Bradford method with bovine serum albumin as a standard. Analysis of the proteolytic activity of rSmCatB The proteolytic activity assay was performed based on the method of Fricker et al. (Fricker et al. 2008). In brief, rSmCatB-WT, rSmCatB-C107S, rSmCatBH277A, and rSmCatB-N297A were diluted in the assay buffer, and dithiothreitol (DTT) was added to the buffer to a final concentration of 0.4 mM. After incubation at 30 °C for 1 h, the protein solution was further diluted to a series of concentrations in assay buffer. The diluted protein or buffer alone (control) was mixed with 1 mM cathepsin B specific substrate Z-Arg-Arg-p-nitroanilide (Sigma-Aldrich, St. Louis, MO, USA). The mixture was incubated at 30 °C for 2 h, and absorbance at 410 nm was determined. The effects of temperature and pH were determined in the same fashion except that the assay was performed at various pH (3.0–8.0 with 0.5 intervals) and temperature (15–70 with 5 °C intervals). Statistical analysis All experiments were performed three times, and statistical analyses were carried out with SPSS 17.0 software (SPSS Inc., Chicago, IL, USA). Data were analyzed with analysis of variance (ANOVA), and statistical significance was defined as P \ 0.05.
Purification of recombinant protein E. coli BL21 (DE3) was transformed with pEtSmCatB-WT, pEtSmCatB-C107S, pEtSmCatB-H277A, and pEtSmCatB-N297A. The transformants were cultured in LB medium at 37 °C to OD600 = 0.6, and isopropyl-b-D-thiogalactopyranoside (IPTG) was added to the culture to a final concentration of 1 mM. After growth at 22 °C for an additional 10 h, recombinant proteins were purified using nickel– nitrilotriacetic acid columns (GE Healthcare, USA) as recommended by the manufacturer. The purified proteins were reconstituted as described previously (Hu et al. 2009). The reconstituted proteins were dialyzed for 24 h against phosphate-buffered saline (PBS). The proteins were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDSPAGE) and visualized after staining with Coomassie brilliant blue R-250. The concentration of the purified
123
Results cDNA and amino acid sequence analysis of SmCatB The SmCatB cDNA comprises an open reading frame (ORF) of 1,726 bp, with a 67 bp 50 -UTR and a 666 bp 30 -UTR. Within the 30 -UTR, a putative polyadenylation signal, AATAAA, is localized at 15 bp upstream from the poly A tail (Fig. 1). The ORF of SmCatB encodes a protein of 330 residues, which was predicted to have a molecular mass of 36.0 kDa and a pI of 6.12. In silico analysis showed that SmCatB has a signal peptide with the cleavage site between residues 18 and 19, a propeptide composed of residues 25–65, and a C1-peptidase domain composed of residues 79–328 (Fig. 1). The peptidase domain contains the catalytic
Fish Physiol Biochem Fig. 1 DNA and amino acid sequences of SmCatB. The nucleotides and amino acids are numbered along the left margin. In the DNA sequence, the translation start and stop codons are in bold, and the putative polyadenylation signal is boxed. In the amino acid sequence, the signal peptide is in italics, the propeptide region is in red, and the C1-peptidase domain is in green. (Color figure online)
triad (C107, H277 and N297) and the oxyanion hole Gln (Q101), which are conserved among teleost and mammalian cathepsin B. In addition, a conserved segment of ‘‘occluding loop’’ characteristic of cathepsin B was also found in SmCatB (Fig. 2). The amino acid sequence of SmCatB shares 80.7–87.6 % overall sequence identities with the cathepsin B proteins of a number of teleost fish including P. olivaceus (87.6 %), O. fasciatus (85.8 %), Hippoglossus hippoglossus (85.5 %), Sparus aurata (84.9 %), Lutjanus argentimaculatus (83.6 %), E. coioides (83.3 %), and Channa striata (80.7 %) (Fig. 2). The overall sequence identities between SmCatB and human and mouse cathepsin B are 68.3 and 66.3 %, respectively. A phylogenetic tree was constructed based on amino acid sequences of cathepsin B from various vertebrate species. The result showed that SmCatB was closest to
the cathepsin B of P. olivaceus and H. hippoglossus (Fig. 3). Expression of SmCatB in fish tissues qRT-PCR analysis showed that under normal physiological conditions, SmCatB expression was highest in spleen and lowest in liver and brain (Fig. 4). Compared to liver, the expression levels in muscle, blood, heart, kidney, gill, gut, and spleen were 1.8-, 2.0-, 2.0-, 8.0-, 14.3-, 15.3-, and 23.1-fold higher, respectively. To examine whether SmCatB expression could be modulated by bacterial infection, turbot were experimentally challenged with the Gram-negative fish pathogen E. tarda. SmCatB expression in kidney, spleen, and liver was analyzed by qRT-PCR at various times postinfection. The PCR efficiency (E) and correlation
123
Fish Physiol Biochem
Fig. 2 Alignment of the amino acid sequences of SmCatB with homologues from teleost and mammals. The percentage numbers in the bracket represent sequence identities with SmCatB. Dots denote gaps introduced for maximum matching. Consensus residues are in black, residues that are C75 % identical are in gray. Residues of the catalytic triad (C107, H277, and N297) are indicated with black triangles. The oxyanion Gln is marked with white triangle. Arrow shows the predicted start residue of the mature protein. The characteristic
occluding loop is boxed. The GenBank accession numbers of the aligned sequences are as follows: PoCatB (Paralichthys olivaceus), ABM47001.1; OfCatB (Oplegnathus fasciatus), AEA48884.1; HhCatB (Hippoglossus hippoglossus), ABJ80 691.1; SaCatB (Sparus aurata), AHZ34284.1; LaCatB (Lutjanus argentimaculatus), ACO82382.1; EcCatB (Epinephelus coioides), AHF27212.1; CsCatB (Channa striata), AGN52 668.1; HsCatB (Homo sapiens), AAC37547.1; MmCatB (Mus musculus), AAA37375.1
coefficient (R2) of the primers were determined to be 102 % and 0.992, respectively. In kidney, SmCatB expression was significantly upregulated at 4, 8, 12, 24, and 48 h post-infection, with peak induction (82-fold) occurring at 12 h post-infection (Fig. 5a). In spleen, significant upregulation of SmCatB expression
occurred at 4, 8, 12, 24, and 48 h post-infection, and maximum induction (102-fold) occurred at 4 h postinfection (Fig. 5b). In liver, SmCatB expression was significantly upregulated at 4, 8, and 12 h postinfection, with maximum induction (27-fold) occurring at 8 h post-infection (Fig. 5c).
123
Fish Physiol Biochem
Fig. 3 Unrooted phylogenetic tree of SmCatB with other cathepsin B from vertebrates. The tree is constructed by the neighbor-joining algorithm using the Mega4.0 program based on the multiple sequence alignment by ClustalW. Bootstrap values of 1,000 replicates (%) are indicated on the branches. The scale bar corresponds to 0.05 estimated amino acid substitution per site. The species’ names and the GenBank accession numbers are as follows: Oplegnathus fasciatus, AEA48884.1; Sparus aurata, AHZ34284.1; Lutjanus argentimaculatus, ACO82382.1; Epinephelus coioides, AHF27212.1;
SmCatB, KM261797; Paralichthys olivaceus, AAT94175.1; Hippoglossus hippoglossus, ABJ80691.1; Channa striata, AGN52668.1; Cynoglossus semilaevis, AEM98130.1; Salmo salar, NP_001133994.1; Danio rerio, AAQ97764.1; Ictalurus punctatus, AHH43031.1; Mus musculus, AAA37375.1; Rattus norvegicus, CAA57792.1; Homo sapiens, AAC37547.1; Bos taurus, AAA03064.1; Sus scrofa, ACB59245.1; Gallus gallus, AAA87075.1; Columba livia, EMC78276.1; Chelonia mydas, EMP27213.1; Micrurus fulvius, JAB54524.1
Characterization of the proteolytic activity of rSmCatB
purified, which bear C107S, H277A and N297A substitutions, respectively. SDS-PAGE analysis showed that the purified proteins appeared as single bands with matching molecular masses (Online Resource Fig. 1). Proteolytic activity analysis showed that compared to the wild type rSmCatB-WT, all three mutants showed severely reduced activity, and the lowest activity was displayed by rSmCatB-N297A (Fig. 6).
To examine the proteolytic activity of SmCatB, rSmCatB without the propeptide was purified from E. coli as a His-tagged protein. rSmCatB exhibited a single band on SDS-PAGE with a molecular mass of about 27 kDa (Online Resource Fig. 1), which is consistent with the Mw predicted for the mature protein of SmCatB. rSmCatB-WT displayed apparent proteolytic activity against a cathepsin B specific substrate in a dose-dependent manner (Fig. 6). To examine whether the conserved residues C107S, H277A, and N297A were required for the proteolytic activity of SmCatB, the mutant proteins rSmCatBC107S, rSmCatB-H277A, and rSmCatB-N297A were
Effect of temperature and pH on the activity of rSmCatB-WT To measure the effect of temperature on the activity of rSmCatB-WT, the protein was subjected to enzymatic assay at different temperatures ranging from 15 to
123
Fish Physiol Biochem
Fig. 4 SmCatB expression in fish tissues. SmCatB expression in the liver, brain, muscle, blood, heart, kidney, gill, gut, and spleen of turbot was determined by quantitative real time RTPCR. The expression level in liver was set as 1. Data are presented as mean ± SE (N = 3)
70 °C. The results revealed that rSmCatB-WT showed optimal protease activity at 50 °C. Greater than 60 % of the maximum activity was maintained at 25–55 °C (Fig. 7a). The assessment of pH effect indicated that the protease activity of rSmCatB-WT increased as pH rose from 3.0 to 5.5 and decreased as pH increased from 5.5 to 8.0 (Fig. 7b). At pH 5.5, rSmCatB-WT displayed maximum activity. At the pH between 4.5 and 7.0, rSmCatB-WT retained [60 % of the maximum activity.
Discussion In this study, we identified and characterized SmCatB, a cathepsin B gene from turbot. The deduced amino acid sequence of SmCatB contains many typical features of cathepsin B, such as a signal peptide, a propeptide region, a C1-peptidase domain that contained the catalytic triad (C107, H277, and N297) and the oxyanion hole Gln (Q101), and the conserved segment of ‘‘occluding loop,’’ which in previous reports has been shown to restrict access to the active site and plays an important role in the dipeptidyl carboxypeptidase activity of cathepsin B (Illy et al. 1997; Quraishi et al. 1999). These structural features indicate that SmCatB is a homolog of cathepsin B. Consistently, sequence alignment and phylogenetic tree analysis revealed that SmCatB shares high levels of identities with a large number of known cathepsin B
123
and that it was more closely related to those known fish cathepsin B than to mammal cathepsin B. These results support the notion that cathepsin B is an
Fish Physiol Biochem b Fig. 5 Expression of SmCatB in fish tissues in response to
Edwardsiella tarda infection. Turbot was infected with E. tarda or PBS (control), and SmCatB expression in kidney (a), spleen (b), and liver (c) were determined by quantitative real time RTPCR at various time points. For the convenience of comparison, at each time point the expression levels of the control fish were set as 1, and the expression levels in bacteria-infected fish were shown as fold difference relative to the control fish. Data are presented as mean ± SE (N = 3). **P \ 0.01
Fig. 6 Activity of rSmCatB-WT, rSmCatB-C107S, rSmCatBH277A, and rSmCatB-N297A. Proteins in different concentrations were incubated with cathepsin B specific substrate, and the activity of the protease was determined. Data are shown as mean ± SE (N = 3)
evolutionarily conserved protein with potentially important physiological function. In mammals, cathepsin B is the most abundantly expressed cathepsin, and its expression occurs in multiple tissues/cells including skeletal tissues, plasma membrane caveolae of differentiating myoblasts, epithelial cells and APC’s like dendritic cells (DCs), and macrophages (Howie et al. 1985; Jane et al. 2006). In this study, we found that SmCatB was expressed ubiquitously in nine tissues of turbot. Similar ubiquitous expressions of cathepsin genes have also been reported in other teleost species including Japanese flounder, rock bream, tongue sole, orange-spotted grouper, and miiuy croaker (Zhang et al. 2008; Whang et al. 2011; Chen and Sun 2012; Che et al. 2014; Wei et al. 2014). These observations suggest that cathepsins may have fundamental functions in fish. In our study, we observed high levels of SmCatB expression in spleen, gut, and kidney, suggesting that SmCatB may be involved in host immunity. Several reports have shown that cathepsin expression can be stimulated by various bacteria, such
Fig. 7 Effects of temperature and pH on the activity of rSmCatB-WT. The effects of temperature (a) and pH (b) on the activity of rSmCatB-WT were determined against cathepsin B specific substrate. Enzyme activities were expressed as percentages of the maximum activity. Data represent mean ± SE (N = 3)
as E. tarda (Whang et al. 2011), Vibrio anguillarum (Chen and Sun 2012), and Vibrio harveyi (Jia and Zhang 2009). Likewise, in our study, we observed significant inductions of SmCatB expression in kidney, spleen, and liver after an experimental infection with E. tarda. These results indicate that SmCatB is involved in host immune response against bacterial infection. Previous studies showed that cathepsin B possesses carboxypeptidase activity, and that as a lysosomal cysteine protease, cathepsin B functions to degrade proteins that have entered the lysosomal system (Bohley and Seglen 1992). In our study, we found that rSmCatB-WT exhibited dose-dependent activity against cathepsin B specific substrate, while mutant proteins with amino acid substitutions at the catalytic triad Cys107, His277, and Asn297 exhibited severely impaired enzyme activity, suggesting that Cys107, His277, and Asn297 are essential to the proteolytic
123
Fish Physiol Biochem
activity of SmCatB, which is consistent with the putative role of Cys107, His277, and Asn297 in catalysis. Similarly, a previous study of the cathepsin B of tongue sole showed that glutamic acid substitution at His277 located in the catalytic site was dramatically reduced in proteolytic activity of the enzyme (Chen and Sun 2012). Enzymatic analysis showed that the protease activity of rSmCatB depended on temperature and pH. At the temperature range of 15–50 °C, rSmCatB-WT exhibited 36–100 % of maximum activity, suggesting that the protein is an active protease. rSmCatB-WT exhibited optimal hydrolysis at pH 5.5, and retained [60 % of the maximum activity at pH between 4.5 and 7.0, suggesting that the protein is an acid protease. These results are similar to those of some native and recombinant cathepsin B of teleost, such as carp (Cyprinus carpio), mackerel (Scomber austra1asicus), silver carp (Hypophthalmichthys molitrix), and tongue sole (C. semilaevis) (Jiang et al. 1994; Aranishi et al. 1997; Liu et al. 2008; Chen and Sun 2012), which is also in agreement with the observation that in mammals cysteine proteases function in acidic environments such as those in lysosomes. In summary, the results obtained from the present work reveal that SmCatB is a cathepsin B homologue whose expression occurs in a wide range of tissues and is positively regulated by bacterial stimulation. The protease activity of rSmCatB-WT is dependent on the conserved residues Cys107, His277, and Asn297 and influenced by temperature and pH. These results suggest that cathepsin B may play an important role both in physiological and pathological processes. Acknowledgments This work was supported by the grants of the Chinese Ministry of Science and Technology (2012BAD17B01) and the Taishan Scholar Program of Shandong Province.
References Aranishi F, Hara K, Osatomi K, Ishihara T (1997) Purification and characterization of cathepsin B from hepatopancreas of carp Cyprinus carpio. Comp Biochem Phys B 117: 579–587 Barrera CA, Ye G, Espejo R, Gunasena S, Almanza R, Leary JF, Crowe SE, Ernst PB, Reyes VE (2001) Expression of cathepsins B, L, S, and D by gastric epithelial cells implicates them as antigen presenting cells in local immune responses. Hum Immunol 62:1081–1091
123
Bohley P, Seglen PO (1992) Proteases and proteolysis in the lysosome. Experientia 48:151–157 Cha IS, Kwon J, Mun JY, Park SB, Jang HB, Nho SW, del Castillo CS, Hikima J, Aoki T, Jung TS (2012) Cathepsins in the kidney of olive flounder, Paralichthys olivaceus, and their responses to bacterial infection. Dev Comp Immunol 38:538–544 Che R, Wang R, Xu T (2014) Comparative genomic of the teleost cathepsin B and H and involvement in bacterial induced immunity of miiuy croaker. Fish Shellfish Immunol 41:163–171 Chen L, Sun L (2012) Cathepsin B of Cynoglossus semilaevis: identification, expression, and activity analysis. Comp Biochem Phys B 161:54–59 Dang W, Sun L (2011) Determination of internal controls for quantitative real time RT-PCR analysis of the effect of Edwardsiella tarda infection on gene expression in turbot (Scophthalmus maximus). Fish Shellfish Immun 30:720–728 Eykelbosh AJ, Van der Kraak G (2010) A role for the lysosomal protease cathepsin B in zebrafish follicular apoptosis. Comp Biochem Phys A 156:218–223 Fabra M, Cerda` J (2004) Ovarian cysteine proteinases in the teleost Fundulus heteroclitus: molecular cloning and gene expression during vitellogenesis and oocyte maturation. Mol Reprod Dev 67:282–294 Fricker SP, Mosi RM, Cameron BR, Baird I, Zhu YB, Anastassov V, Cox J, Doyle PS, Hansell E, Lau G, Langille J, Olsen M, Qin L, Skerlj R, Wong RSY, Santucci Z, McKerrow JH (2008) Metal compounds for the treatment of parasitic diseases. J Inorg Biochem 102:1839–1845 Gocheva V, Zeng W, Ke DX, Klimstra D, Reinheckel T, Peters C, Hanahan D, Joyce JA (2006) Distinct roles for cysteine cathepsin genes in multistage tumorigenesis. Gene Dev 20:543–556 Guagliardi LE, Koppelman B, Blum JS, Marks MS, Cresswell P, Brodsky FM (1990) Co-localization of molecules involved in antigen processing and presentation in an early endocytic compartment. Nature 343:133–139 Herszenyi L, Farinati F, Cardin R, Istvan G, Molnar LD, Hritz I, De Paoli M, Plebani M, Tulassay Z (2008) Tumor marker utility and prognostic relevance of cathepsin B, cathepsin L, urokinase-type plasminogen activator, plasminogen activator inhibitor type-1, CEA and CA 19-9 in colorectal cancer. BMC Cancer 8:194 Hook G, Hook V, Kindy M (2011) The cysteine protease inhibitor, E64d, reduces brain amyloid-beta and improves memory deficits in alzheimer’s disease animal models by inhibiting cathepsin B, but not BACE1, beta-secretase activity. J Alzheimers Dis 26:387–408 Howie AJ, Burnett D, Crocker J (1985) The distribution of cathepsin-B in human-tissues. J Pathol 145:307–314 Hu YH, Liu CS, Hou JH, Sun L (2009) Identification, characterization, and molecular application of a virulence-associated autotransporter from a pathogenic pseudomonas fluorescens strain. Appl Environ Microb 75:4333–4340 Hu YH, Zheng WJ, Sun L (2010) Identification and molecular analysis of a ferritin subunit from red drum (Sciaenops ocellatus). Fish Shellfish Immun 28:678–686 Illy C, Quraishi O, Wang J, Purisima E, Vernet T, Mort JS (1997) Role of the occluding loop in cathepsin B activity. J. Biol. Chem. 272:1197–1202
Fish Physiol Biochem Jane DT, Morvay L, DaSilva L, Cavallo-Medved D, Sloane BF, Dufresne MJ (2006) Cathepsin B localizes to plasma membrane caveolae of differentiating myoblasts and is secreted in an active form at physiological pH. Biol Chem 387:223–234 Jia A, Zhang XH (2009) Molecular cloning, characterization and expression analysis of cathepsin D from turbot Scophthalmus maximus. Fish Shellfish Immunol. 26:606– 613 Jiang ST, Lee JJ, Chen HC (1994) Purification and characterization of cathepsin-B from ordinary muscle of mackerel (Scomber Australasicus). J Agric Food Chem 42:1073– 1079 Koga H, Yamada H, Nishimura Y, Kato K, Imoto T (1991) Multiple proteolytic action of rat liver cathepsin B: specificities and pH-dependences of the endo- and exopeptidase activities. J. Biochem. 110:179–188 Kos J, Werle B, Lah T, Brunner N (2000) Cysteine proteinases and their inhibitors in extracellular fluids: markers for diagnosis and prognosis in cancer. Int J Biol Marker 15:84–89 Kubista M, Andrade JM, Bengtsson M, Forootan A, Jona´k J, Lind K, Sindelka R, Sjo¨back R, Sjo¨green B, Stro¨mbom L, Sta˚hlberg A, Zoric N (2006) The real-time polymerase chain reaction. Mol Aspects Med 27:95–125 Kwon JY, Prat F, Randall C, Tyler CR (2001) Molecular characterization of putative yolk processing enzymes and their expression during oogenesis and embryogenesis in rainbow trout (Oncorhynchus mykiss). Biol Reprod 65: 1701–1709 Liu H, Yin LJ, Zhang N, Li SH, Ma CW (2008) Isolation of cathepsin B from the muscle of silver carp (Hypophthalmichthys molitrix) and comparison of cathepsins B and L actions on surimi gel softening. Food Chem 110:310–318 Mizuochi T, Yee ST, Kasai M, Kakiuchi T, Muno D, Kominami E (1994) Both cathepsinB and cathepsinD are necessary for processing of ovalbumin as well as for degradation of class II MHC invariant chain. Immunol Lett 43:189–193 Morchang A, Panaampon J, Suttitheptumrong A, Yasamut U, Noisakran S, Yenchitsomanus PT, Limjindaporn T (2013) Role of cathepsin B in dengue virus-mediated apoptosis. Biochem Biophys Res Commun 438:20–25 Mort JS, Buttle DJ (1997) Cathepsin B. Int J Biochem Cell B 29:715–720 Musil D, Zucic D, Turk D, Engh RA, Mayr I, Huber R, Popovic T, Turk V, Towatari T, Katunuma N, Bode W (1991) The ˚ X-ray crystal structure of human liver refined 2.15 A cathepsin B: the structural basis for its specificity. EMBO J 10:2321–2330 Quraishi O, Nagler DK, Fox T, Sivaraman J, Cygler M, Mort JS, Storer AC (1999) The occluding loop in cathepsin B defines the pH dependence of inhibition by its propeptide. Biochemistry 38:5017–5023 Reichenbach G, Starzinski-Powitz A, Doll M, Hrgovic I, Valesky EM, Kippenberger S, Bernd A, Kaufmann R, Meissner M (2012) Ligand activation of peroxisome proliferator-activated receptor delta suppresses cathepsin B expression in human endothelial cells in a posttranslational manner. Exp Dermatol 21:751–757 Sinha AA, Jamuar MP, Wilson MJ, Rozhin J, Sloane BF (2001) Plasma membrane association of cathepsin B in human
prostate cancer: biochemical and immunogold electron microscopic analysis. Prostate 49:172–184 Talieri M, Papadopoulou S, Scorilas A, Xynopoulos D, Arnogianaki N, Plataniotis G, Yotis J, Agnanti N (2004) Cathepsin B and cathepsin D expression in the progression of colorectal adenoma to carcinoma. Cancer Lett 205:97–106 Tingaud-Sequeira A, Carnevali O, Cerda J (2011) Cathepsin B differential expression and enzyme processing and activity during Fundulus heteroclitus embryogenesis. Comp Biochem Phys A 158:221–228 Tong B, Wan B, Wei Z, Wang T, Zhao P, Dou Y, Lv Z, Dai Y, Xia Y (2014) Role of cathepsin B in regulating migration and invasion of fibroblast-like synoviocytes into inflamed tissue from patients with rheumatoid arthritis. Clin Exp Immunol 177:586–597 Turk B, Turk D, Turk V (2000) Lysosomal cysteine proteases: more than scavengers. BBA-Protein Struct M 1477:98–111 Uchiyama Y, Watanabe M, Watanabe T, Ishii Y, Matsuba H, Waguri S, Kominami E (1989) Variations in immunocytochemical localization of cathepsin B and thyroxine in follicular cells of the rat thyroid gland and plasma TSH concentrations over 24 hours. Cell Tissue Res 256:355–360 Vannoorden CJF, Smith RE, Rasnick D (1988) Cysteine proteinase activity in arthritic rat knee joints and the effects of a selective systemic inhibitor, Z-Phe-AlaCH2F. J Rheumatol 15:1525–1535 Wang HR, Hu YH, Zhang WW, Sun L (2009) Construction of an attenuated Pseudomonas fluorescens strain and evaluation of its potential as a cross-protective vaccine. Vaccine 27:4047–4055 Wei SN, Huang YH, Huang XH, Cai J, Yan Y, Guo CY, Qin QW (2014) Characterization of cathepsin B gene from orangespotted grouper, Epinephelus coioides involved in SGIV infection. Fish Shellfish Immun 36:194–205 Whang I, De Zoysa M, Nikapitiya C, Lee Y, Kim Y, Lee S, Oh C, Jung SJ, Oh MJ, Choi CY, Yeo SY, Kim BS, Kim SJ, Lee J (2011) Molecular characterization and expression analysis of cathepsin B and L cysteine proteases from rock bream (Oplegnathus fasciatus). Fish Shellfish Immun 30:763–772 Withana NP, Blum G, Sameni M, Slaney C, Anbalagan A, Olive MB, Bidwell BN, Edgington L, Wang L, Moin K (2012) Cathepsin B inhibition limits bone metastasis in breast cancer. Cancer Res 72:1199–1209 Zhang FT, Zhang YB, Chen YD, Zhu R, Dong CW, Li YY, Zhang QY, Gui JF (2008) Expressional induction of Paralichthys olivaceus cathepsin B gene in response to virus, poly I: C and lipopolysaccharide. Fish Shellfish Immun 25:542–549 Zhang M, Jiao XD, Hu YH, Sun L (2009) Attenuation of Edwardsiella tarda virulence by small peptides that interfere with luxS/autoinducer type 2 quorum sensing. Appl Environ Microb 75:3882–3890 Zhang M, Hu YH, Xiao ZZ, Sun Y, Sun L (2012) Construction and analysis of experimental DNA vaccines against megalocytivirus. Fish Shellfish Immun 33:1192–1198 Zheng WJ, Sun L (2011) Evaluation of housekeeping genes as references for quantitative real time RT-PCR analysis of gene expression in Japanese flounder (Paralichthys olivaceus). Fish Shellfish Immun 30:638–645 Zheng WJ, Hu YH, Xiao ZZ, Sun L (2010) Cloning and analysis of a ferritin subunit from turbot (Scophthalmus maximus). Fish Shellfish Immun 28:829–836
123
Molecular characterization of the cathepsin B of turbot (Scophthalmus maximus) Ze-jun Zhou • Reng Qiu • Jian Zhang
Received: 31 August 2014 / Accepted: 8 October 2014 Ó Springer Science+Business Media Dordrecht 2014
Abstract Cathepsin B is an enzymatic protein belonging to the peptidase C1 family. It is involved in diverse physiological and pathological functions that include immune response. In this study, we identified and characterized a cathepsin B homolog (SmCatB) from turbot (Scophthalmus maximus). SmCatB is composed of 330 amino acid residues and possesses typical domain architecture of cathepsin B, which contains a propeptide region and a cysteine protease domain, and the latter processes four conserved residues (Q101, C107, H277, and N297) in the active site. SmCatB shares 80.6–87.6 % overall
Ze-jun Zhou and Reng Qiu have contributed equally to this work.
Electronic supplementary material The online version of this article (doi:10.1007/s10695-014-9998-4) contains supplementary material, which is available to authorized users. Z. Zhou R. Qiu J. Zhang (&) Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, China e-mail: [email protected] Z. Zhou R. Qiu University of Chinese Academy of Sciences, Beijing 100049, China R. Qiu China-UK-NYNU-RRes Joint Laboratory of Insect Biology, Nanyang Normal University, Nanyang 473061, Henan, China
sequence identities with the cathepsin B of a number of teleost. SmCatB expression was detected in a wide range of tissues and upregulated by bacterial infection in a time-dependent manner. Recombinant SmCatB (rSmCatB-WT) purified from Escherichia coli exhibited apparent protease activity, which was optimal at 50 °C and pH 5.5. Compared to rSmCatB-WT, the mutant proteins rSmCatB-C107S, rSmCatB-H277A, and rSmCatB-N297A, which bear C107S, H277A, and N297A mutations, respectively, were significantly reduced in protease activity, with the highest reduction observed with rSmCatB-N297A. These results indicate that SmCatB is a bioactive protease that depends on the conserved structural features and that SmCatB is involved in pathogen-induced immune response. Keywords Cathepsin B Scophthalmus maximus Expression Cysteine protease
Introduction In mammals, various cathepsins have been identified, including cathepsins B, C, F, H, K, L, O, S, V, W, and X (Turk et al. 2000). Cathepsin B is one of the best studied cathepsins and still draws wide attention. It is present in almost all mammalian tissues and has traditionally been regarded as a lysosomal mediator of protein turnover (Mort and Buttle 1997). Cathepsin B exhibits dipeptidyl carboxypeptidase, carboxypeptidase, or endopeptidase activity depending on pH as well as the type of substrate
123
Fish Physiol Biochem
(Koga et al. 1991). This variation of proteolytic activity is determined by different structural features of the protein (Musil et al. 1991). Besides the physiological role in intracellular terminal protein degradation, cathepsin B can also exist in a soluble form and bind to the plasma membrane or proteins of extracellular matrix, thus taking a part in various physiological and pathological processes (Sinha et al. 2001). For example, cathepsin B is involved in many biological functions such as MHC-II-mediated antigen presentation, inflammation, bone resorption, apoptosis, hormone maturation, and tumor progression and metastasis (Vannoorden et al. 1988; Uchiyama et al. 1989; Guagliardi et al. 1990; Mizuochi et al.1994; Mort and Buttle 1997; Barrera et al. 2001; Gocheva et al. 2006; Hook et al. 2011; Reichenbach et al. 2012; Withana et al. 2012; Morchang et al. 2013; Tong et al. 2014). Cathepsin B expression is highly upregulated in many malignant tumors and premalignant lesions and has often been positively correlated with a poor prognosis (Kos et al. 2000; Talieri et al. 2004; Herszenyi et al. 2008). In fish, the cathepsin B of Paralichthys olivaceus, Oplegnathus fasciatus, Cynoglossus semilaevis, Oncorhynchus mykiss, Epinephelus coioides, Fundulus heteroclitus, and Danio rerio have been studied (Kwon et al. 2001; Fabra and Cerda` 2004; Zhang et al. 2008; Eykelbosh and Van der Kraak 2010; Tingaud-Sequeira et al. 2011; Whang et al. 2011; Cha et al. 2012; Chen and Sun 2012; Wei et al. 2014), which showed that fish cathepsin B homologues are similar in genetic organization and structural features to mammalian cathepsin B. Fish cathepsin B are known to be involved in immune response, embryonic development, and regulation of follicular apoptosis (Eykelbosh and Van der Kraak 2010; TingaudSequeira et al. 2011; Chen and Sun 2012). Turbot (Scophthalmus maximus) is an important economic fish species cultured in China. However, like most farmed fish, turbot is susceptible to diseases caused by various pathogens, which brings great economic loss to the aquaculture industry. Currently, there is no effective means for the control of infections in turbot, due at least in part to the reason that the immune systems in this fish species remain largely unknown. Since cathepsins are known to be involved in various immune processes, we aimed in this study to examine the expression and activity of a turbot cathepsin. For this purpose, we identified and analyzed the expression and activity of a cathepsin B
123
homologue from turbot (named SmCatB). Our results indicate a possible role for SmCatB in the innate immunity of turbot and add new insight to the structure–function relationship of teleost cathepsin B.
Materials and methods Animals Clinically healthy turbot were purchased from a commercial fish farm in Shandong Province, China, and maintained at 20 °C in aerated seawater. Fish were acclimatized in the laboratory for 2 weeks prior to experimental manipulation. Before experiment, fish were randomly sampled for the examination of the presence of bacteria in blood, liver, kidney, and spleen as reported previously (Zhang et al. 2012). No bacteria were detected from the examined fish. Before tissue collection, fish were euthanized with an overdose of tricaine methanesulfonate (Sigma, St. Louis, MO, USA) as reported previously (Wang et al. 2009). Bacterial strains and culture conditions The Gram-negative fish bacterial pathogen Edwardsiella tarda TX1 has been reported previously (Zhang et al. 2009). E. coli BL21 (DE3) was purchased from TransGen Biotech (Beijing, China). Both strains were cultured in Luria-Bertani broth (LB) medium at 28 °C (for E. tarda) or 37 °C (for E. coli). Cloning of SmCatB A cDNA library of turbot head kidney (HK) and spleen was constructed as reported previously (Zheng et al. 2010). Plasmids were isolated from 1,500 clones and subjected to DNA sequence analysis; one clone was found to contain the cDNA of SmCatB with 50 untranslated regions (UTR). The 30 -UTR was obtained by RACE (rapid amplification of cDNA ends) as described previously (Hu et al. 2010). The nucleotide sequence of SmCatB has been deposited in GenBank database under the accession number KM261797. Sequence analysis Nucleotide and amino acid sequences were analyzed with the BLAST program at the National Center for
Fish Physiol Biochem Table 1 Primers used in this study
a
Underlined nucleotides are restriction sites of the enzymes indicated in the brackets at the ends
Primer
Sequences (50 ? 30 )a
F1
GATATCGCCACCATGCTGCCTGAGGAATTTGA (EcoRV)
R1
CGCGATATCCTTGGGAATGCCTGCCAC (EcoRV)
RTF1
AGCAATGGCAAGGTCAACG
RTR1
TCCAGAAGTCCCAGGCAGA
MCF1
GATCCAGCTGGGCATTTGGCGC
MCR1
CCAGCTGGATCCACAGGAGCCCT
MHF1
GGCGCGGCCATCAAGGTCCTGG
MHR1 MNF1
TGGCCGCGCCACCCAGAGCAGAT GTGCCGCGTCCTGGAACACTGACTG
MNR1
GGACGCGGCACAGAGCCAGTAGG
Biotechnology Information (NCBI). Domain architecture analysis was performed using the simple modular architecture research tool (SMART) version 4.0 and the conserved domain database (CDD) of NCBI. The molecular weight (Mw) and theoretical isoelectric point calculations were carried out with EditSeq in DNASTAR software package (DNASTAR Inc. Madison, WI, USA). Multiple sequence alignment was implemented with the ClustalX program. Phylogenetic analysis was performed using MEGA 4.0 with Neighbor-joining (NJ) algorithm. Quantitative real time reverse transcription-PCR (qRT-PCR) analysis of SmCatB expression in fish tissues SmCatB expression in fish tissues under normal physiological conditions Spleen, gut, heart, gill, brain, kidney, liver, muscle, and blood were taken aseptically from five fish and used for total RNA extraction with the HP Total RNA kit plus RNase-Free DNase Set (Omega Bio-tek, Doraville, GA, USA). One microgram of total RNA was used for cDNA synthesis with the Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA, USA). qRT-PCR was carried out in an Eppendorf Mastercycler (Eppendorf, Hamburg, Germany) using the SYBR ExScript qRT-PCR Kit (Takara, Dalian, China) as described previously (Dang and Sun 2011). The expression level of SmCatB was analyzed using comparative threshold cycle method (2-DDCT) with RNA polymerase II subunit D (RPSD) as a control as reported previously (Zheng and Sun 2011). The primers used for SmCatB were RTF1 and RTR1
(Table 1). Melting curve analysis of amplification products was performed at the end of each PCR to confirm that only one PCR product was amplified and detected. The PCR efficiency (E) and correlation coefficient (R2) of the primers were determined based on the slopes of the standard curves generated using serial fivefold dilutions of sample cDNA. The efficiency was calculated based on the following formula: E (%) = (10-1/slope - 1) 9 100 (Kubista et al. 2006). The acceptable E value was defined as 90–110 %. The experiments were performed three times, and the results are shown as means plus or minus standard errors (SE). SmCatB expression in response to bacterial infection E. tarda TX1 was cultured in LB medium to midlogarithmic phase and resuspended in PBS to 1 9 107 colony forming units (CFU)/ml. Turbot (*14 g) were randomly divided into two groups (30 fish/group) and injected with 100 ll of E. tarda or PBS (control). Fish (five for each time point) from each group were euthanized at 4, 8, 12, 24, 48 post-infection; kidney, spleen, and liver were taken under aseptic conditions and used for qRT-PCR as described above with actin as an internal control (Zheng and Sun 2011). The experiment was performed three times, and the results are shown as means plus or minus standard errors (SE). Plasmid construction The primers used for plasmid construction are listed in Table 1. To construct pEtSmCatB-WT, which expresses a His-tagged protein corresponding to the
123
Fish Physiol Biochem
mature form of SmCatB-WT (residue 79–330), PCR was conducted with PCR primers F1 and R1. The PCR products were ligated with the T–A cloning vector T-Simple (TransGen Biotech, Beijing, China), and the recombinant plasmid was digested with EcoRV to retrieve the SmCatB-containing fragment, which was inserted into pET259 (Hu et al. 2010) at the SwaI site, resulting in pEtSmCatB-WT. pEtSmCatB-C107S, which expresses the mutant protein bearing C107S mutation, was constructed by overlapping PCR as follows: the first PCR was performed with the primers F1 and MCR1, the second PCR was performed with the primers MCF1 and R1, and the fusion PCR was performed with the primer pair F1/R1. The PCR products were digested with EcoRV and inserted into pET259 as described above, resulting in pEtSmCatBC107S. pEtSmCatB-H277A, which expresses the mutant protein bearing H277A mutation, was constructed as described above, except that the first PCR was performed with the primers F1 and MHR1, the second PCR was performed with the primers MHF1 and R1, and the fusion PCR was performed with the primer pair F1/R1. pEtSmCatB-N297A, which expresses the mutant protein bearing N297A mutation, was constructed as described above, except that the first PCR was performed with the primers F1 and MNR1, the second PCR was performed with the primers MNF1 and R1, and the fusion PCR was performed with the primer pair F1/R1.
proteins was determined using the Bradford method with bovine serum albumin as a standard. Analysis of the proteolytic activity of rSmCatB The proteolytic activity assay was performed based on the method of Fricker et al. (Fricker et al. 2008). In brief, rSmCatB-WT, rSmCatB-C107S, rSmCatBH277A, and rSmCatB-N297A were diluted in the assay buffer, and dithiothreitol (DTT) was added to the buffer to a final concentration of 0.4 mM. After incubation at 30 °C for 1 h, the protein solution was further diluted to a series of concentrations in assay buffer. The diluted protein or buffer alone (control) was mixed with 1 mM cathepsin B specific substrate Z-Arg-Arg-p-nitroanilide (Sigma-Aldrich, St. Louis, MO, USA). The mixture was incubated at 30 °C for 2 h, and absorbance at 410 nm was determined. The effects of temperature and pH were determined in the same fashion except that the assay was performed at various pH (3.0–8.0 with 0.5 intervals) and temperature (15–70 with 5 °C intervals). Statistical analysis All experiments were performed three times, and statistical analyses were carried out with SPSS 17.0 software (SPSS Inc., Chicago, IL, USA). Data were analyzed with analysis of variance (ANOVA), and statistical significance was defined as P \ 0.05.
Purification of recombinant protein E. coli BL21 (DE3) was transformed with pEtSmCatB-WT, pEtSmCatB-C107S, pEtSmCatB-H277A, and pEtSmCatB-N297A. The transformants were cultured in LB medium at 37 °C to OD600 = 0.6, and isopropyl-b-D-thiogalactopyranoside (IPTG) was added to the culture to a final concentration of 1 mM. After growth at 22 °C for an additional 10 h, recombinant proteins were purified using nickel– nitrilotriacetic acid columns (GE Healthcare, USA) as recommended by the manufacturer. The purified proteins were reconstituted as described previously (Hu et al. 2009). The reconstituted proteins were dialyzed for 24 h against phosphate-buffered saline (PBS). The proteins were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDSPAGE) and visualized after staining with Coomassie brilliant blue R-250. The concentration of the purified
123
Results cDNA and amino acid sequence analysis of SmCatB The SmCatB cDNA comprises an open reading frame (ORF) of 1,726 bp, with a 67 bp 50 -UTR and a 666 bp 30 -UTR. Within the 30 -UTR, a putative polyadenylation signal, AATAAA, is localized at 15 bp upstream from the poly A tail (Fig. 1). The ORF of SmCatB encodes a protein of 330 residues, which was predicted to have a molecular mass of 36.0 kDa and a pI of 6.12. In silico analysis showed that SmCatB has a signal peptide with the cleavage site between residues 18 and 19, a propeptide composed of residues 25–65, and a C1-peptidase domain composed of residues 79–328 (Fig. 1). The peptidase domain contains the catalytic
Fish Physiol Biochem Fig. 1 DNA and amino acid sequences of SmCatB. The nucleotides and amino acids are numbered along the left margin. In the DNA sequence, the translation start and stop codons are in bold, and the putative polyadenylation signal is boxed. In the amino acid sequence, the signal peptide is in italics, the propeptide region is in red, and the C1-peptidase domain is in green. (Color figure online)
triad (C107, H277 and N297) and the oxyanion hole Gln (Q101), which are conserved among teleost and mammalian cathepsin B. In addition, a conserved segment of ‘‘occluding loop’’ characteristic of cathepsin B was also found in SmCatB (Fig. 2). The amino acid sequence of SmCatB shares 80.7–87.6 % overall sequence identities with the cathepsin B proteins of a number of teleost fish including P. olivaceus (87.6 %), O. fasciatus (85.8 %), Hippoglossus hippoglossus (85.5 %), Sparus aurata (84.9 %), Lutjanus argentimaculatus (83.6 %), E. coioides (83.3 %), and Channa striata (80.7 %) (Fig. 2). The overall sequence identities between SmCatB and human and mouse cathepsin B are 68.3 and 66.3 %, respectively. A phylogenetic tree was constructed based on amino acid sequences of cathepsin B from various vertebrate species. The result showed that SmCatB was closest to
the cathepsin B of P. olivaceus and H. hippoglossus (Fig. 3). Expression of SmCatB in fish tissues qRT-PCR analysis showed that under normal physiological conditions, SmCatB expression was highest in spleen and lowest in liver and brain (Fig. 4). Compared to liver, the expression levels in muscle, blood, heart, kidney, gill, gut, and spleen were 1.8-, 2.0-, 2.0-, 8.0-, 14.3-, 15.3-, and 23.1-fold higher, respectively. To examine whether SmCatB expression could be modulated by bacterial infection, turbot were experimentally challenged with the Gram-negative fish pathogen E. tarda. SmCatB expression in kidney, spleen, and liver was analyzed by qRT-PCR at various times postinfection. The PCR efficiency (E) and correlation
123
Fish Physiol Biochem
Fig. 2 Alignment of the amino acid sequences of SmCatB with homologues from teleost and mammals. The percentage numbers in the bracket represent sequence identities with SmCatB. Dots denote gaps introduced for maximum matching. Consensus residues are in black, residues that are C75 % identical are in gray. Residues of the catalytic triad (C107, H277, and N297) are indicated with black triangles. The oxyanion Gln is marked with white triangle. Arrow shows the predicted start residue of the mature protein. The characteristic
occluding loop is boxed. The GenBank accession numbers of the aligned sequences are as follows: PoCatB (Paralichthys olivaceus), ABM47001.1; OfCatB (Oplegnathus fasciatus), AEA48884.1; HhCatB (Hippoglossus hippoglossus), ABJ80 691.1; SaCatB (Sparus aurata), AHZ34284.1; LaCatB (Lutjanus argentimaculatus), ACO82382.1; EcCatB (Epinephelus coioides), AHF27212.1; CsCatB (Channa striata), AGN52 668.1; HsCatB (Homo sapiens), AAC37547.1; MmCatB (Mus musculus), AAA37375.1
coefficient (R2) of the primers were determined to be 102 % and 0.992, respectively. In kidney, SmCatB expression was significantly upregulated at 4, 8, 12, 24, and 48 h post-infection, with peak induction (82-fold) occurring at 12 h post-infection (Fig. 5a). In spleen, significant upregulation of SmCatB expression
occurred at 4, 8, 12, 24, and 48 h post-infection, and maximum induction (102-fold) occurred at 4 h postinfection (Fig. 5b). In liver, SmCatB expression was significantly upregulated at 4, 8, and 12 h postinfection, with maximum induction (27-fold) occurring at 8 h post-infection (Fig. 5c).
123
Fish Physiol Biochem
Fig. 3 Unrooted phylogenetic tree of SmCatB with other cathepsin B from vertebrates. The tree is constructed by the neighbor-joining algorithm using the Mega4.0 program based on the multiple sequence alignment by ClustalW. Bootstrap values of 1,000 replicates (%) are indicated on the branches. The scale bar corresponds to 0.05 estimated amino acid substitution per site. The species’ names and the GenBank accession numbers are as follows: Oplegnathus fasciatus, AEA48884.1; Sparus aurata, AHZ34284.1; Lutjanus argentimaculatus, ACO82382.1; Epinephelus coioides, AHF27212.1;
SmCatB, KM261797; Paralichthys olivaceus, AAT94175.1; Hippoglossus hippoglossus, ABJ80691.1; Channa striata, AGN52668.1; Cynoglossus semilaevis, AEM98130.1; Salmo salar, NP_001133994.1; Danio rerio, AAQ97764.1; Ictalurus punctatus, AHH43031.1; Mus musculus, AAA37375.1; Rattus norvegicus, CAA57792.1; Homo sapiens, AAC37547.1; Bos taurus, AAA03064.1; Sus scrofa, ACB59245.1; Gallus gallus, AAA87075.1; Columba livia, EMC78276.1; Chelonia mydas, EMP27213.1; Micrurus fulvius, JAB54524.1
Characterization of the proteolytic activity of rSmCatB
purified, which bear C107S, H277A and N297A substitutions, respectively. SDS-PAGE analysis showed that the purified proteins appeared as single bands with matching molecular masses (Online Resource Fig. 1). Proteolytic activity analysis showed that compared to the wild type rSmCatB-WT, all three mutants showed severely reduced activity, and the lowest activity was displayed by rSmCatB-N297A (Fig. 6).
To examine the proteolytic activity of SmCatB, rSmCatB without the propeptide was purified from E. coli as a His-tagged protein. rSmCatB exhibited a single band on SDS-PAGE with a molecular mass of about 27 kDa (Online Resource Fig. 1), which is consistent with the Mw predicted for the mature protein of SmCatB. rSmCatB-WT displayed apparent proteolytic activity against a cathepsin B specific substrate in a dose-dependent manner (Fig. 6). To examine whether the conserved residues C107S, H277A, and N297A were required for the proteolytic activity of SmCatB, the mutant proteins rSmCatBC107S, rSmCatB-H277A, and rSmCatB-N297A were
Effect of temperature and pH on the activity of rSmCatB-WT To measure the effect of temperature on the activity of rSmCatB-WT, the protein was subjected to enzymatic assay at different temperatures ranging from 15 to
123
Fish Physiol Biochem
Fig. 4 SmCatB expression in fish tissues. SmCatB expression in the liver, brain, muscle, blood, heart, kidney, gill, gut, and spleen of turbot was determined by quantitative real time RTPCR. The expression level in liver was set as 1. Data are presented as mean ± SE (N = 3)
70 °C. The results revealed that rSmCatB-WT showed optimal protease activity at 50 °C. Greater than 60 % of the maximum activity was maintained at 25–55 °C (Fig. 7a). The assessment of pH effect indicated that the protease activity of rSmCatB-WT increased as pH rose from 3.0 to 5.5 and decreased as pH increased from 5.5 to 8.0 (Fig. 7b). At pH 5.5, rSmCatB-WT displayed maximum activity. At the pH between 4.5 and 7.0, rSmCatB-WT retained [60 % of the maximum activity.
Discussion In this study, we identified and characterized SmCatB, a cathepsin B gene from turbot. The deduced amino acid sequence of SmCatB contains many typical features of cathepsin B, such as a signal peptide, a propeptide region, a C1-peptidase domain that contained the catalytic triad (C107, H277, and N297) and the oxyanion hole Gln (Q101), and the conserved segment of ‘‘occluding loop,’’ which in previous reports has been shown to restrict access to the active site and plays an important role in the dipeptidyl carboxypeptidase activity of cathepsin B (Illy et al. 1997; Quraishi et al. 1999). These structural features indicate that SmCatB is a homolog of cathepsin B. Consistently, sequence alignment and phylogenetic tree analysis revealed that SmCatB shares high levels of identities with a large number of known cathepsin B
123
and that it was more closely related to those known fish cathepsin B than to mammal cathepsin B. These results support the notion that cathepsin B is an
Fish Physiol Biochem b Fig. 5 Expression of SmCatB in fish tissues in response to
Edwardsiella tarda infection. Turbot was infected with E. tarda or PBS (control), and SmCatB expression in kidney (a), spleen (b), and liver (c) were determined by quantitative real time RTPCR at various time points. For the convenience of comparison, at each time point the expression levels of the control fish were set as 1, and the expression levels in bacteria-infected fish were shown as fold difference relative to the control fish. Data are presented as mean ± SE (N = 3). **P \ 0.01
Fig. 6 Activity of rSmCatB-WT, rSmCatB-C107S, rSmCatBH277A, and rSmCatB-N297A. Proteins in different concentrations were incubated with cathepsin B specific substrate, and the activity of the protease was determined. Data are shown as mean ± SE (N = 3)
evolutionarily conserved protein with potentially important physiological function. In mammals, cathepsin B is the most abundantly expressed cathepsin, and its expression occurs in multiple tissues/cells including skeletal tissues, plasma membrane caveolae of differentiating myoblasts, epithelial cells and APC’s like dendritic cells (DCs), and macrophages (Howie et al. 1985; Jane et al. 2006). In this study, we found that SmCatB was expressed ubiquitously in nine tissues of turbot. Similar ubiquitous expressions of cathepsin genes have also been reported in other teleost species including Japanese flounder, rock bream, tongue sole, orange-spotted grouper, and miiuy croaker (Zhang et al. 2008; Whang et al. 2011; Chen and Sun 2012; Che et al. 2014; Wei et al. 2014). These observations suggest that cathepsins may have fundamental functions in fish. In our study, we observed high levels of SmCatB expression in spleen, gut, and kidney, suggesting that SmCatB may be involved in host immunity. Several reports have shown that cathepsin expression can be stimulated by various bacteria, such
Fig. 7 Effects of temperature and pH on the activity of rSmCatB-WT. The effects of temperature (a) and pH (b) on the activity of rSmCatB-WT were determined against cathepsin B specific substrate. Enzyme activities were expressed as percentages of the maximum activity. Data represent mean ± SE (N = 3)
as E. tarda (Whang et al. 2011), Vibrio anguillarum (Chen and Sun 2012), and Vibrio harveyi (Jia and Zhang 2009). Likewise, in our study, we observed significant inductions of SmCatB expression in kidney, spleen, and liver after an experimental infection with E. tarda. These results indicate that SmCatB is involved in host immune response against bacterial infection. Previous studies showed that cathepsin B possesses carboxypeptidase activity, and that as a lysosomal cysteine protease, cathepsin B functions to degrade proteins that have entered the lysosomal system (Bohley and Seglen 1992). In our study, we found that rSmCatB-WT exhibited dose-dependent activity against cathepsin B specific substrate, while mutant proteins with amino acid substitutions at the catalytic triad Cys107, His277, and Asn297 exhibited severely impaired enzyme activity, suggesting that Cys107, His277, and Asn297 are essential to the proteolytic
123
Fish Physiol Biochem
activity of SmCatB, which is consistent with the putative role of Cys107, His277, and Asn297 in catalysis. Similarly, a previous study of the cathepsin B of tongue sole showed that glutamic acid substitution at His277 located in the catalytic site was dramatically reduced in proteolytic activity of the enzyme (Chen and Sun 2012). Enzymatic analysis showed that the protease activity of rSmCatB depended on temperature and pH. At the temperature range of 15–50 °C, rSmCatB-WT exhibited 36–100 % of maximum activity, suggesting that the protein is an active protease. rSmCatB-WT exhibited optimal hydrolysis at pH 5.5, and retained [60 % of the maximum activity at pH between 4.5 and 7.0, suggesting that the protein is an acid protease. These results are similar to those of some native and recombinant cathepsin B of teleost, such as carp (Cyprinus carpio), mackerel (Scomber austra1asicus), silver carp (Hypophthalmichthys molitrix), and tongue sole (C. semilaevis) (Jiang et al. 1994; Aranishi et al. 1997; Liu et al. 2008; Chen and Sun 2012), which is also in agreement with the observation that in mammals cysteine proteases function in acidic environments such as those in lysosomes. In summary, the results obtained from the present work reveal that SmCatB is a cathepsin B homologue whose expression occurs in a wide range of tissues and is positively regulated by bacterial stimulation. The protease activity of rSmCatB-WT is dependent on the conserved residues Cys107, His277, and Asn297 and influenced by temperature and pH. These results suggest that cathepsin B may play an important role both in physiological and pathological processes. Acknowledgments This work was supported by the grants of the Chinese Ministry of Science and Technology (2012BAD17B01) and the Taishan Scholar Program of Shandong Province.
References Aranishi F, Hara K, Osatomi K, Ishihara T (1997) Purification and characterization of cathepsin B from hepatopancreas of carp Cyprinus carpio. Comp Biochem Phys B 117: 579–587 Barrera CA, Ye G, Espejo R, Gunasena S, Almanza R, Leary JF, Crowe SE, Ernst PB, Reyes VE (2001) Expression of cathepsins B, L, S, and D by gastric epithelial cells implicates them as antigen presenting cells in local immune responses. Hum Immunol 62:1081–1091
123
Bohley P, Seglen PO (1992) Proteases and proteolysis in the lysosome. Experientia 48:151–157 Cha IS, Kwon J, Mun JY, Park SB, Jang HB, Nho SW, del Castillo CS, Hikima J, Aoki T, Jung TS (2012) Cathepsins in the kidney of olive flounder, Paralichthys olivaceus, and their responses to bacterial infection. Dev Comp Immunol 38:538–544 Che R, Wang R, Xu T (2014) Comparative genomic of the teleost cathepsin B and H and involvement in bacterial induced immunity of miiuy croaker. Fish Shellfish Immunol 41:163–171 Chen L, Sun L (2012) Cathepsin B of Cynoglossus semilaevis: identification, expression, and activity analysis. Comp Biochem Phys B 161:54–59 Dang W, Sun L (2011) Determination of internal controls for quantitative real time RT-PCR analysis of the effect of Edwardsiella tarda infection on gene expression in turbot (Scophthalmus maximus). Fish Shellfish Immun 30:720–728 Eykelbosh AJ, Van der Kraak G (2010) A role for the lysosomal protease cathepsin B in zebrafish follicular apoptosis. Comp Biochem Phys A 156:218–223 Fabra M, Cerda` J (2004) Ovarian cysteine proteinases in the teleost Fundulus heteroclitus: molecular cloning and gene expression during vitellogenesis and oocyte maturation. Mol Reprod Dev 67:282–294 Fricker SP, Mosi RM, Cameron BR, Baird I, Zhu YB, Anastassov V, Cox J, Doyle PS, Hansell E, Lau G, Langille J, Olsen M, Qin L, Skerlj R, Wong RSY, Santucci Z, McKerrow JH (2008) Metal compounds for the treatment of parasitic diseases. J Inorg Biochem 102:1839–1845 Gocheva V, Zeng W, Ke DX, Klimstra D, Reinheckel T, Peters C, Hanahan D, Joyce JA (2006) Distinct roles for cysteine cathepsin genes in multistage tumorigenesis. Gene Dev 20:543–556 Guagliardi LE, Koppelman B, Blum JS, Marks MS, Cresswell P, Brodsky FM (1990) Co-localization of molecules involved in antigen processing and presentation in an early endocytic compartment. Nature 343:133–139 Herszenyi L, Farinati F, Cardin R, Istvan G, Molnar LD, Hritz I, De Paoli M, Plebani M, Tulassay Z (2008) Tumor marker utility and prognostic relevance of cathepsin B, cathepsin L, urokinase-type plasminogen activator, plasminogen activator inhibitor type-1, CEA and CA 19-9 in colorectal cancer. BMC Cancer 8:194 Hook G, Hook V, Kindy M (2011) The cysteine protease inhibitor, E64d, reduces brain amyloid-beta and improves memory deficits in alzheimer’s disease animal models by inhibiting cathepsin B, but not BACE1, beta-secretase activity. J Alzheimers Dis 26:387–408 Howie AJ, Burnett D, Crocker J (1985) The distribution of cathepsin-B in human-tissues. J Pathol 145:307–314 Hu YH, Liu CS, Hou JH, Sun L (2009) Identification, characterization, and molecular application of a virulence-associated autotransporter from a pathogenic pseudomonas fluorescens strain. Appl Environ Microb 75:4333–4340 Hu YH, Zheng WJ, Sun L (2010) Identification and molecular analysis of a ferritin subunit from red drum (Sciaenops ocellatus). Fish Shellfish Immun 28:678–686 Illy C, Quraishi O, Wang J, Purisima E, Vernet T, Mort JS (1997) Role of the occluding loop in cathepsin B activity. J. Biol. Chem. 272:1197–1202
Fish Physiol Biochem Jane DT, Morvay L, DaSilva L, Cavallo-Medved D, Sloane BF, Dufresne MJ (2006) Cathepsin B localizes to plasma membrane caveolae of differentiating myoblasts and is secreted in an active form at physiological pH. Biol Chem 387:223–234 Jia A, Zhang XH (2009) Molecular cloning, characterization and expression analysis of cathepsin D from turbot Scophthalmus maximus. Fish Shellfish Immunol. 26:606– 613 Jiang ST, Lee JJ, Chen HC (1994) Purification and characterization of cathepsin-B from ordinary muscle of mackerel (Scomber Australasicus). J Agric Food Chem 42:1073– 1079 Koga H, Yamada H, Nishimura Y, Kato K, Imoto T (1991) Multiple proteolytic action of rat liver cathepsin B: specificities and pH-dependences of the endo- and exopeptidase activities. J. Biochem. 110:179–188 Kos J, Werle B, Lah T, Brunner N (2000) Cysteine proteinases and their inhibitors in extracellular fluids: markers for diagnosis and prognosis in cancer. Int J Biol Marker 15:84–89 Kubista M, Andrade JM, Bengtsson M, Forootan A, Jona´k J, Lind K, Sindelka R, Sjo¨back R, Sjo¨green B, Stro¨mbom L, Sta˚hlberg A, Zoric N (2006) The real-time polymerase chain reaction. Mol Aspects Med 27:95–125 Kwon JY, Prat F, Randall C, Tyler CR (2001) Molecular characterization of putative yolk processing enzymes and their expression during oogenesis and embryogenesis in rainbow trout (Oncorhynchus mykiss). Biol Reprod 65: 1701–1709 Liu H, Yin LJ, Zhang N, Li SH, Ma CW (2008) Isolation of cathepsin B from the muscle of silver carp (Hypophthalmichthys molitrix) and comparison of cathepsins B and L actions on surimi gel softening. Food Chem 110:310–318 Mizuochi T, Yee ST, Kasai M, Kakiuchi T, Muno D, Kominami E (1994) Both cathepsinB and cathepsinD are necessary for processing of ovalbumin as well as for degradation of class II MHC invariant chain. Immunol Lett 43:189–193 Morchang A, Panaampon J, Suttitheptumrong A, Yasamut U, Noisakran S, Yenchitsomanus PT, Limjindaporn T (2013) Role of cathepsin B in dengue virus-mediated apoptosis. Biochem Biophys Res Commun 438:20–25 Mort JS, Buttle DJ (1997) Cathepsin B. Int J Biochem Cell B 29:715–720 Musil D, Zucic D, Turk D, Engh RA, Mayr I, Huber R, Popovic T, Turk V, Towatari T, Katunuma N, Bode W (1991) The ˚ X-ray crystal structure of human liver refined 2.15 A cathepsin B: the structural basis for its specificity. EMBO J 10:2321–2330 Quraishi O, Nagler DK, Fox T, Sivaraman J, Cygler M, Mort JS, Storer AC (1999) The occluding loop in cathepsin B defines the pH dependence of inhibition by its propeptide. Biochemistry 38:5017–5023 Reichenbach G, Starzinski-Powitz A, Doll M, Hrgovic I, Valesky EM, Kippenberger S, Bernd A, Kaufmann R, Meissner M (2012) Ligand activation of peroxisome proliferator-activated receptor delta suppresses cathepsin B expression in human endothelial cells in a posttranslational manner. Exp Dermatol 21:751–757 Sinha AA, Jamuar MP, Wilson MJ, Rozhin J, Sloane BF (2001) Plasma membrane association of cathepsin B in human
prostate cancer: biochemical and immunogold electron microscopic analysis. Prostate 49:172–184 Talieri M, Papadopoulou S, Scorilas A, Xynopoulos D, Arnogianaki N, Plataniotis G, Yotis J, Agnanti N (2004) Cathepsin B and cathepsin D expression in the progression of colorectal adenoma to carcinoma. Cancer Lett 205:97–106 Tingaud-Sequeira A, Carnevali O, Cerda J (2011) Cathepsin B differential expression and enzyme processing and activity during Fundulus heteroclitus embryogenesis. Comp Biochem Phys A 158:221–228 Tong B, Wan B, Wei Z, Wang T, Zhao P, Dou Y, Lv Z, Dai Y, Xia Y (2014) Role of cathepsin B in regulating migration and invasion of fibroblast-like synoviocytes into inflamed tissue from patients with rheumatoid arthritis. Clin Exp Immunol 177:586–597 Turk B, Turk D, Turk V (2000) Lysosomal cysteine proteases: more than scavengers. BBA-Protein Struct M 1477:98–111 Uchiyama Y, Watanabe M, Watanabe T, Ishii Y, Matsuba H, Waguri S, Kominami E (1989) Variations in immunocytochemical localization of cathepsin B and thyroxine in follicular cells of the rat thyroid gland and plasma TSH concentrations over 24 hours. Cell Tissue Res 256:355–360 Vannoorden CJF, Smith RE, Rasnick D (1988) Cysteine proteinase activity in arthritic rat knee joints and the effects of a selective systemic inhibitor, Z-Phe-AlaCH2F. J Rheumatol 15:1525–1535 Wang HR, Hu YH, Zhang WW, Sun L (2009) Construction of an attenuated Pseudomonas fluorescens strain and evaluation of its potential as a cross-protective vaccine. Vaccine 27:4047–4055 Wei SN, Huang YH, Huang XH, Cai J, Yan Y, Guo CY, Qin QW (2014) Characterization of cathepsin B gene from orangespotted grouper, Epinephelus coioides involved in SGIV infection. Fish Shellfish Immun 36:194–205 Whang I, De Zoysa M, Nikapitiya C, Lee Y, Kim Y, Lee S, Oh C, Jung SJ, Oh MJ, Choi CY, Yeo SY, Kim BS, Kim SJ, Lee J (2011) Molecular characterization and expression analysis of cathepsin B and L cysteine proteases from rock bream (Oplegnathus fasciatus). Fish Shellfish Immun 30:763–772 Withana NP, Blum G, Sameni M, Slaney C, Anbalagan A, Olive MB, Bidwell BN, Edgington L, Wang L, Moin K (2012) Cathepsin B inhibition limits bone metastasis in breast cancer. Cancer Res 72:1199–1209 Zhang FT, Zhang YB, Chen YD, Zhu R, Dong CW, Li YY, Zhang QY, Gui JF (2008) Expressional induction of Paralichthys olivaceus cathepsin B gene in response to virus, poly I: C and lipopolysaccharide. Fish Shellfish Immun 25:542–549 Zhang M, Jiao XD, Hu YH, Sun L (2009) Attenuation of Edwardsiella tarda virulence by small peptides that interfere with luxS/autoinducer type 2 quorum sensing. Appl Environ Microb 75:3882–3890 Zhang M, Hu YH, Xiao ZZ, Sun Y, Sun L (2012) Construction and analysis of experimental DNA vaccines against megalocytivirus. Fish Shellfish Immun 33:1192–1198 Zheng WJ, Sun L (2011) Evaluation of housekeeping genes as references for quantitative real time RT-PCR analysis of gene expression in Japanese flounder (Paralichthys olivaceus). Fish Shellfish Immun 30:638–645 Zheng WJ, Hu YH, Xiao ZZ, Sun L (2010) Cloning and analysis of a ferritin subunit from turbot (Scophthalmus maximus). Fish Shellfish Immun 28:829–836
123
