Gene 562 (2015) 22–31

Contents lists available at ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

Molecular characterization and developmental expression of vitellogenin in the oriental river prawn Macrobrachium nipponense and the effects of RNA interference and eyestalk ablation on ovarian maturation Hongkun Bai a, Hui Qiao b, Fajun Li a,c, Hongtuo Fu a,b,⁎, Shengming Sun b, Wenyi Zhang b, Shubo Jin a,b, Yongsheng Gong a, Sufei Jiang b, Yiwei Xiong b a

Wuxi Fisheries College, Nanjing Agricultural University, Wuxi 214081, PR China Key Laboratory of Freshwater Fisheries and Germplasm Resources Utilization, Ministry of Agriculture, Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences, Wuxi 214081, PR China c Weifang University of Science and Technology, Shouguang 262700, China b

a r t i c l e

i n f o

Article history: Received 2 August 2014 Received in revised form 17 November 2014 Accepted 5 December 2014 Available online 8 December 2014 Keywords: Macrobrachium nipponense Vitellogenin Eyestalk ablation RNA interference

a b s t r a c t Vitellogenin (Vg) is the precursor of yolk protein, which functions as a nutritive resource that is important for embryonic growth and gonad development. In this study, the cDNA encoding the Vg gene from the oriental river prawn Macrobrachium nipponense was cloned using expressed sequence tag (EST) analysis and the rapid amplification of cDNA ends (RACE) approach. The transcript encoded 2536 amino acids with an estimated molecular mass of 286.810 kDa. Quantitative real-time PCR indicated high expression of Mn-Vg in the female ovary, hemocytes, and hepatopancreas. As ovaries developed, the expression level of Mn-Vg increased in both the hepatopancreas and ovary. In the hepatopancreas, the expression level rose more slowly at the early stage of vitellogenesis and reached the peak more rapidly compared to the expression pattern in ovary. The observed changes in Mn-Vg expression level at different development stages suggest the role of nutrient source in embryonic and larval development. Eyestalk ablation caused the Mn-Vg expression level to increase significantly compared to eyestalk-intact groups during the ovary development stages. Ablation accelerated ovary maturation by removing hormone inhibition of Mn-Vg in the hepatopancreas and ovary. In adult females, Mn-Vg dsRNA injection resulted in decreased expression of Mn-Vg in both the hepatopancreas and ovary, and two injection treatment dramatically delayed ovary maturation. Vg RNA interference down-regulated the vitellogenin receptor (VgR) expression level in the ovary, which illustrates the close relationship between Vg and VgR in the process of vitellogenesis. © 2015 Elsevier B.V. All rights reserved.

1. Introduction The oriental river prawn Macrobrachium nipponense (Crustacea; Decapoda; Palaemonidae) is an important commercial prawn species that is widely distributed in freshwater areas of China and other Asian countries. The total fishing production reaches 230,248 t per year in Abbreviations: M. nipponense, Macrobrachium nipponense; Vg, vitellogenin; Vn, vitellin; VgR, vitellogenin receptor; GIH, gonad-inhibiting hormone; Mn-Vg, Macrobrachium nipponense vitellogenin; qPCR, quantitative real-time PCR; GSI, gonadosomatic index; dsRNA, double-stranded RNA; ELISA, enzyme-linked immunosorbent assay; RNAi, RNA interference; O, ovary; B, brain; L, hepatopancreas; Fx, hemolymph; H, heart; E, eyestalk; AG, abdominal ganglion; CS, cleavage stage; BS, blastula stage; GS, gastrula stage; NS, nauplius stage; PS, protozoea stage; ZS, zoea stage; L1, the first day larva after hatching; L5, the fifth day larva after hatching; L10, the tenth day larva after hatching; L15, the fifteen day larva after hatching; P10, the tenth day post-larvae after metamorphosis; P20, the twenty day post-larvae after metamorphosis; P30, the thirty day post-larvae after metamorphosis. ⁎ Corresponding author at: Wuxi Fisheries College, Nanjing Agricultural University, Wuxi 214081, Jiangsu Province, PR China. E-mail address: [email protected] (H. Fu).

http://dx.doi.org/10.1016/j.gene.2014.12.008 0378-1119/© 2015 Elsevier B.V. All rights reserved.

China (Bureau of Fishery, 2011), with an annual production value of more than 100 million RMB. As the scale of production expanded, “sexual precocity” began to appear. This term refers to early male and female gonad development, which leads to excessive propagation and overpopulation; in the M. nipponense population this occurs especially in autumn. Precocity results in the coexistence of multiple generations, intensive breeding density, and lack of oxygen, which can lead to short life span and low market value of the product. Thus, this phenomenon is restricting the sustainable development of M. nipponense. Understanding the reproductive process and the mechanisms that regulate ovarian maturation in M. nipponense is crucial to improving production of this commercially important species. Vitellogenin (Vg), which is the precursor of vitellin (Vn), is synthesized by female shrimp during gonad maturation. In the mature female prawn, gonad maturity depends on the rapid synthesis and accumulation of Vg in the oocytes during the breeding season (Wilder et al., 2010). In many oviparous vertebrate and invertebrate animals, Vn provides the substrate and energy for embryonic and ovarian development

H. Bai et al. / Gene 562 (2015) 22–31

(e.g., carbohydrates, amino acids, lipids, vitamins, phosphorus, sulfur, and trace elements) (Matozzo et al., 2008). The complete cDNA sequence encoding Vg has been cloned for many species of decapod crustacean. In addition, the molecular characteristics and the regulatory mechanism of Vg have been widely studied (Tsutsui et al., 2000; Yang et al., 2000; Raviv et al., 2006; Okumura et al., 2007; Jia et al., 2013). However, molecular studies of M. nipponense Vg (Mn-Vg) are needed to better understand the mechanisms involved in the reproductive process of this species. In crustaceans, the site and the process of Vg synthesis are still controversial. Mainly have two kinds: extra-ovarian sources, namely by the organ beyond ovary synthesis precursor, Vg was considered to be taken into the developing oocytes from the hemolymph by the vitellogenin receptor (VgR) via receptor-mediated endocytosis. The mechanisms for endocytotic internalization of Vg have been well studied in certain oviparous vertebrates (Schneider, 1992) and insects (Sappington and Raikhel, 1998), but such studies in crustaceans are limited. Vg synthesis also may be endogenous (i.e., auto-synthesis), whereby the oocyte itself produces Vg with participation from relevant organelles. For example, the ovary was found to be the site of Vg synthesis in Penaeus semisulcatus (Browdy et al., 1990) and Callinectes sapidus (Lee and Watson, 1995). However, the Vg gene was uniquely expressed in the hepatopancreas of Macrobrachium rosenbergii (Yang et al., 2000) and Pandalus hypsinotus (Tsutsui et al., 2004). Further studies indicated that both the ovary and hepatopancreas were the Vg synthesis sites in Marsupenaeus japonicus (Okumura et al., 2007), Fenneropenaeus merguiensis (Phiriyangkul et al., 2007), Litopenaeus vannamei (Raviv et al., 2006), Penaeus japonicus (Tsutsui et al., 2000), Metapenaeus ensis and Penaeus monodon (Tiu et al., 2006a, 2006b). In decapods, vitellogenesis is hormonally regulated, and it can be inhibited by the occurrence of hormones in the neurosecretory cells of the X-organ/sinus gland. For example, gonad-inhibiting hormone (GIH), which is synthesized in the X-organ/sinus complex, is thought to play an inhibitory role for the initiation of vitellogenesis in the ovary (De Kleijn et al., 1994; De Kleijn et al., 1998; Gu et al., 2002). Adiyodi and Adiyodi (1970) reported that eyestalk ablation removed the inhibition of neuropeptides and accelerated the accumulation of Vg. In addition, Jayasankar et al. (2002) found that eyestalk ablation increased Vg synthesis in the hepatopancreas of the giant freshwater prawn M. rosenbergii. In P. japonicus, Vg mRNA transcripts were measured both in the hepatopancreas and the ovary in normal and eyestalk-ablated adult shrimp. An obvious increment of mRNA levels was revealed in the ovary, whereas mRNA levels were negligible in the hepatopancreas (Tsutsui et al., 2005). Overall, existing data indicate that the mechanisms for hormonal regulation of Vg synthesis vary among crustaceans. Thus, molecular characterization and functional studies of Vg are critical to understand the reproductive mechanisms in M. nipponense. Such information can be used to improve aquaculture production in practice. In this study, we cloned the cDNA encoding the Vg gene from M. nipponense (Mn-Vg) and conducted structural and phylogenetic analyses. The expression profiles of different tissues and development stages (embryo and larvae) were determined using quantitative realtime PCR (qPCR). qPCR was also used to evaluate the effects of eyestalk ablation to gain a better understanding of the hormonal regulation mechanism involved in Vg synthesis. RNAi technology was firstly applied to investigate the expression pattern of Vg in ovary cycles. The results of this study should be helpful for developing methods to cope with the problem of sexual precocity in the aquaculture setting. 2. Materials and methods 2.1. Experiment animal Adult healthy M. nipponense were obtained from Tai lake in Wuxi, China (120°13′44″E, 31°28′22″N). The body weight of the female/male prawns ranged from 1.26 to 4.25 g. Individuals, feed with paludina

23

twice per day, were acclimatized in a recirculating water aquarium system filled with aerated freshwater (25–28 °C) before tissues and embryos were collected. A variety of tissues including: ovary, heart, hepatopancreas, muscle, hemocytes, gill, eyestalk, gut and brain were dissected out from mature female/male prawn. As to the collection of hemocytes, we drawed hemolymph from the body cavity, centrifuged it at 12000 rpm for 10 min, removed the supernatant, and then collected the hemocyte precipitate to extract RNA. Ovarian maturity was classified into six stages according to gonadosomatic index (GSI), color, external morphology and histological feature: Proliferation (stage I, GSI = 0.85 ± 0.46), fusion nucleolus (stage II, GSI = 2.54 ± 1.28), oil globules (stage III, GSI = 4.67 ± 0.98), yolk granule (stage IV, GSI = 7.55 ± 0.40), maturation (stage V, GSI = 9.85 ± 2.74), and paracmasis (stage VI, GSI = 1.24 ± 0.62) (Wu et al., 2009). Each developmental stage of larvae was assessed by the criteria of Chen et al. (2012) and Kang et al. (1996). These samples were maintained in RNA protect liquid (Takara) until total RNA extraction. 2.2. The isolation of RNA and the synthesis of cDNA Total RNA was extracted from mixed tissues using RNAiso Plus Reagent (TaKaRa, Japan). RNA samples were treated with DNase I to remove contaminated genomic DNA for further experiments. First strand cDNA was synthesized from 3 μg total RNA using Reverse Transcriptase M-MLV Kit (TaKaRa, Japan). 2.3. Cloning and sequence analysis of Mn-Vg Initially, the partial fragment of Mn-Vg cDNA was obtained from normalized cDNA library of ovary and testis (article is in press) in our lab. Vg complete sequence was cloned by the method of rapid amplification of the cDNA ends (RACE). The 3′-RACE and 5′-RACE terminal fragments were extended using 3′-full RACE Core Set Ver. 2.0 Kit and 5′-full RACE Kit (TaKaRa, Japan). In addition, we examined the middle sequence by dividing it into five fragments. All the primers used in the clone were listed in Table 1. The PCR products were purified using Gel Extraction kit (Sangon, China), and sequenced by ABI3730 Biosystem, USA analyzer after insertion into PMD-20T vector (Takara, Japan). To confirm the validity of the sequence data that was obtained, each fragment was sequenced at least three times. According to the sequences acquired above, 3′-RACE and 5′-RACE products and the fragment of middle sequence, the full length of Mn-Vg cDNA was spliced. Sequences were analyzed based on the nucleotide and protein databases using the

Table 1 Primers used for cDNA clone. Primer name

Sequence (5′ → 3′)

Purpose

Mn-Vg-R1 Mn-Vg-R2 5′-RACE outer 5′-RACE inner

ATTACAGGTGTGCAGAGTTCCCTC AAGTACCCTACCTGAACCACCT CATGGCTACATGCTGACAGCCTA CGCGGATCCACAGCCTACTGATGA TCAGTCGATG TACCGTCGTTCCACTAGTGATTT CGCGGATCCTCCACTAGTGATTTCAC TATAGG TCTTGTTAACTGGATCGTCCACG AAGCTCTCTTCGTACCTGTTCAG TCTGGCGACAGCCTCAGCTGGT TTGATGACAGTGAACGTTCCTGA CTGGAGCAGTCAAGGTTATGGT TACAGAGCACACGATTCCAGAC GCCAGAGAAAATGGAGTTGGTG TTGGTACTGAGAGCTTCCTTGG GTCAGGCGAAACATCACAAGTC CCTGTGACCTTCTGTTCCTCTC CTGTTGCTTGATGTCACCCTCTC ACCGTGCATTATGGTGGCTTGA

Primer for 5′-RACE primer for 5′-RACE Primer for 5′-RACE Primer for 5′-RACE

3′-RACE outer 3′-RACE inner Mn-Vg-F1 Mn-Vg-F2 VG-A-F1 VG-A-R1 VG-B-F1 VG-B-R1 VG-C-F1 VG-C-R2 VG-D-F1 VG-D-R1 VG-E-F1 VG-E-R1

Primer for 3′-RACE Primer for 3′-RACE Primer for 3′-RACE Primer for 3′-RACE Middle segment A Middle segment A Middle segment B Middle segment B Middle segment C Middle segment C Middle segment D Middle segment D Middle segment E Middle segment E

24

H. Bai et al. / Gene 562 (2015) 22–31

BLASTX and BLASTN search program (http://www.ncbi.nlm.nih.gov/ BLAST/) of GenBank. The homology search for the nucleotide and protein sequences was carried out by the BLAST algorithm at NCBI (http://www.ncbi.nlm.nih.gov/). Deduced amino acid sequences were obtained using an ORF finder program (http://www.ncbi.nlm.nih.gov/ gorf/gorf.html). The signal sequence was predicted using program SignalP (http://www.cbs.dtu.dk/services/SignalP/). The NetNGlyc 1.0 Server (http://www.cbs.dtu.dk/services/NetNGlyc/) (N-X-S/T) was used to identify glycosylation site. The phosphorylation site was found by the NetPhos 2.0 Server (http://www.cbs.dtu.dk/services/NetPhos/). Phylogenetic analysis of M. nipponense Vg was constructed using the neighbor-joining method of MEGA 5.0. 2.4. Expression of Vg in different development stage and tissue The expression level of Mn-Vg in different development stages of embryo, post-larvae, juvenile prawns and different tissues was demonstrated by qPCR. Total RNA treated with RNase-free DNase I (Sangon, China) to eliminate possible genomic DNA contamination. The concentration of RNA was quantified by BioPhotometer (Eppendorf). 1 μg of total RNA was reverse-transcribed by iScript™ cDNA Synthesis Kit perfect Real Time (BIO-RAD, USA) following the manufacturer's instruction. The qPCR amplifications were carried out in a total volume of 25 μL, containing 1 μL cDNA (50 ng), 10 μl SsoFast™ EvaGreen Supermix (Bio-Rad, USA), 0.5 μL 10 μM of genes specific forward and reverse primer (Table 2), and 13 μL of DEPC-water. The reaction mixture was initially incubated at 95 °C for 30 s to activate the Hot Start Taq DNA polymerase, followed by 40 cycles of 95 °C for 10 s and 60 °C for 10 s, melting cure was performed at the end of qPCR reaction at 65–95 °C (in 0.5 °C inc) for 10 s. At least three replicate qPCRs were performed per sample and three prawns were analyzed for each sample, and amplification of β-actin was used as the internal control (Zhang et al., 2013). The significant differences of expressions were showed at p b 0.05. The relative copy number of Vg mRNA was calculated according to the 2−ΔΔCT comparative CT method (Livak and Schmittgen, 2001).

eyestalk ablation (N ≥ 3). All collect samples were stored at RNA sample protect liquid. qPCR was used to detect the expression pattern after eyestalk ablation. The specific method of transcription and qPCR process is the same with different development stages and tissues. 2.6. RNA interference (RNAi) The specific primers containing T7 promoter site of RNA interference were designed using Snap Dragon tools (http://www.flyrnai.org/cgibin/RNAifind_primers.pl). Vg dsRNA synthesis primers were shown in Table 2. The PCR products were purified with a gel extraction kit (Sangon, Shanghai, China). According to the Transcript Aid™ T7 High Yield Transcription kit (Fermentas, Inc, USA) manufacturer's instructions, gene-specific dsRNA was synthesized in vitro. Purity and integrity of the dsRNA were examined by standard agarose gel electrophoresis. The concentration of dsRNA was measured at 260 nm by using a BioPhotometer (Eppendorf, Hamburg, Germany), and then save at −20 °C. All primers used were listed in Table 2. VgR detection primers were designed according to the sequence of NCBI under accession (GenBank KJ768658). For the short-term in vivo dsRNA injection experiment, 150 health mature female M. nipponense (each weighing 1.6–2.3 g) were selected to inject into pericardial cavity. The female prawns, selected in the proliferation stage (stage I), were assigned to the three treatment groups: Vg-dsRNA injection (N = 50), two Vg-dsRNA injection (N = 50) and vehicle injection (N = 50). Each prawn was injected with 4 μg/g VgdsRNA or 4 μg vehicles. For two injection group, supplemented another 4 μg/g Vg-dsRNA in the seventh day after the first injection. The Vg mRNA expression of the ovary and hepatopancreas were investigated to detect the interference efficiency by qPCR after injection for 1, 3, 5, 7, 9, 11, 13, 15 and 17 days (N ≥ 3). The body weight and ovary weight of each prawn was recorded to measure the GSI. For two injection group, samples were captured respectively in the 1, 5, 9, 13, 17, 21, and 25 days after the injection (N ≥ 3). All tissues were saved in the RNA protect liquid. 2.7. Statistical analysis

2.5. Expression of Mn-Vg gene mRNAs after eyestalk ablation Adult female M. nipponense prawns used in this study were selected from Tai lake Wuxi, approximately 1.50 g–3.0 g in wet weight. The ovary development stage of each prawn was identified in the proliferation (stage I). For eyestalk ablation experiment, about 80 prawns were divided into two groups, one group was served as intact (un-eyestalk ablated) and another one was eyestalk ablated (experimental group). The experiments were performed in duplicate and maintained for a period of 15 days at 28 °C. Female prawn eyestalks were removed by cauterization with red hot tweezer experiment. Samples from different tissues were collected from prawns at 1, 3, 5, 7, 9, 11 and 13 days after

The prawns were weighed and the ovaries were dissected out and indexes were determined using the following formula: gonadsomatic index ðGSIÞ ¼

wet weight of the ovary  100%: wet weight of the prawn

Quantitative data were expressed as means ± SD. Statistical differences were estimated by one-way ANOVA followed by Duncan's multiple range test. 3. Results 3.1. Molecular cloning and structural analysis of the Mn-Vg gene

Table 2 Primers used for quantitative PCR and RNA inference. Primer name VG-Q-F VG-Q-R VG-I-F

Sequence (5′ → 3′)

GAAGTTAGCGGAGATCTGAGGT CCTCGTTGACCAATCTTGAGAG TAATACGACTCACTATAGGTGC CAAGAAAAAGCTCCTGT VG-I-R TAATACGACTCACTATAGGGCC AAAGGTTGGTGCATAGT VG-QI-F TGCTCTTGCTCTACTCAAGTCC VG-QI-R CTGATGACAGTGAACGTTCCTG VGR-QI-F TACCACTTCGTCACAGATGCAG VGR-QI-R CTTGTCGCACCAGTAGATCCTC β-Actin F TATGCACTTCCTCATGCCATC β-Actin R AGGAGGCGGCAGTGGTCAT

Purpose Primer for Mn-Vg expression Primer for Mn-Vg expression Primer for Mn-Vg dsRNA preparation Primer for Mn-Vg dsRNA preparation Primer for Mn-Vg dsRNA detection Primer for Mn-Vg dsRNA detection Primer for Mn-Vg dsRNA detection Primer for Mn-Vg dsRNA detection Primer for β-actin expression primer for β-actin expression

The full-length Mn-Vg gene is 7804 base pairs (bps) long and includes a 5′-terminal untranslated region (UTR) of 34 bp, a 7611 bp open reading frame (ORF) encoding 2536 amino acid (aa) residues, and a 159 bp 3′-terminal UTR (excluding the poly(A) + tail). The MnVg cDNA sequence was submitted to GenBank under the accession number KJ768657. Fig. 1 shows the sketch map of the deduced amino acid sequences, and the specific sequence information for Mn-Vg is provided in Fig. 1s. Mn-Vg has an estimated molecular mass of 286.810 kDa and a theoretical isoelectric point of 9.08. SignalP software analysis revealed that the deduced peptides contained a putative 20 aa signal peptide and a cleavage site between Pro20 and Ser21. The deduced amino acid sequences included six N-glycosylation sites (N-X-S/T) and two putative subtilisin cleavage sites (RQKR). In addition, 151 phosphorylation sites (90 Ser, 40 Thr, and 21 Try) were identified by the NetPhos 2.0 Server. Alignment with other species revealed that the Mn-Vg protein

H. Bai et al. / Gene 562 (2015) 22–31

Signal peptide

25

RERR RERR

GLLG

Fig. 1. The sketch map of the deduced amino acid sequences of M. nipponense Vg. The conserved domain (Vitellogenin_N, DUF 1943, VWFD) of VG was colored. Putative signal peptide and subtilisin cleavage sites (RQKR) are highlighted.

contains conserved domains, including Vitellogenin_N, VWFD, and the domain of unknown function (DUF) 1943 super family. The first two are highly conserved in other insect and crustacean species. A BLAST search revealed that Mn-Vg was highly similar to the Vg of the following crustaceans: M. rosenbergii (91% identity), Exopalaemon carinicauda (76% identity), P. hypsinotus (61% identity), P. japonica (60% identity), Cherax quadricarinatus (39% identity), Homarus americanus (38% identity), M. japonicus (38% identity), F. chinensis (38% identity), and P. merguiensis (37% identity). A neighbor-joining phylogenic tree (Fig. 2) was constructed based on the Vg amino acid sequences of all reported decapods, three representative copepods, and five hexapods. The branches of the phylogenic tree revealed that Mn-Vg was most closely related to M. rosenbergii, followed by P. japonica and P. hypsinotus. Vgs of all crustaceans clustered together as a group. However, copepods and hexapods formed a distinctive cluster separated from the other crustacean Vg proteins, and Vgs from decapods were more closely related to those of copepods than to those of hexapods. 3.2. Tissue distribution of the Mn-Vg gene The distribution and expression of the Mn-Vg gene were analyzed by qPCR in selected female prawn tissues. Mn-Vg was highly expressed in the hepatopancreas (Fig. 3) (P b 0.001), followed by the ovary and hemocytes. Expression was significantly lower in the other tissues (i.e., brain, gill, heart, and abdominal ganglion). In male prawn tissues, few mRNA transcripts were detected, and they were present at extremely low levels (i.e., testis, brain, gill, heart, and abdominal ganglion). The expression level in male tissues is less than one per few million when compared with the expression level of female hepatopancreas. 3.3. Expression of the Mn-Vg gene in larvae and post-larvae The expression pattern of Mn-Vg at different developmental stages (embryo, larvae, and post-larvae) was evaluated by qPCR. Mn-Vg was highly expressed in the cleavage, gastrula, and zoea stages, but expression declined slightly in the blastula and nauplius stages (Fig. 4). Once larvae ruptured the embryonic membrane, Vg expression decreased significantly and was maintained at relatively low level. However, a sharp increase in expression occurred beginning 20 days after metamorphosis, and the highest expression level was measured 30 days after metamorphosis. The expression level of 30 days post-larval showed significant difference with other development stages. 3.4. Expression of the Mn-Vg gene in different stages of ovarian development Fig. 5 shows the expression pattern of Mn-Vg in the ovary and hepatopancreas during the reproductive cycle. The qPCR results show that the Mn-Vg level increased in both organs as ovarian development progressed. In the hepatopancreas, the expression level gradually increased from stages I to III and then abruptly increased and peaked at stage IV. After reproductive molting, the expression of Mn-Vg in stage VI decreased rapidly to reach the same level of stage I. In the ovary, Mn-Vg gene expression increased gradually from stage I to stage V and reached the peaked. In the ovary, the expression level rose more rapidly at the early stage of vitellogenesis and reached the peak more

slowly compared to the expression pattern in hepatopancreas. However, the relative expression level in the hepatopancreas was much higher than that in the ovary. 3.5. Expression of Mn-Vg mRNAs after eyestalk ablation The expression level of the Mn-Vg after eyestalk removal was monitored by qPCR in the ovary and hepatopancreas (Fig. 6). When compared with the control female prawn group, the reproductive molt cycle in the eyestalk ablation group was dramatically shortened both in two tissues. In the hepatopancreas, Mn-Vg expression was upregulated 3 days after eyestalk ablation and reached a level of 3000fold higher than that of the control group (P b 0.01). Overall, the magnitude of gene expression level detected in the experimental group was much higher than that in the control group. As the ovary developed, Mn-Vg expression in the hepatopancreas peaked 7 days after eyestalk ablation in the treatment group, whereas it peaked at 9 days in the control group. A similar expression pattern was found in the ovary, but the expression level in the eyestalk ablation group peaked 4 days in advance of the control group. 3.6. Expression of Vg and VgR after RNAi Many researchers have reported that injection of double stranded RNA (dsRNA) leads to gene silencing. When RNA interference (RNAi) was used in this study, the Vg-dsRNA clearly inhibited development of the ovary based on the gonadosomatic index (GSI) (Fig. 7a) and expression pattern data. In the ovary, injection of Vg-dsRNA resulted in an 80% decrease of Vg expression after 3 days (Fig. 7b). Although the expression level increased in both the test and control groups as the ovary matured, different patterns were observed. When the control group had completed a normal reproductive cycle, the experimental group was still in the yolk accumulation phase (stage III). The same expression pattern was detected in the hepatopancreas (Fig. 7c). These results illustrate that RNAi was able to delay the development cycle of the ovary. In order to detect the effectiveness of Vg-dsRNA in inhibiting maturation of the ovary, we injected another 4 μg/g of dsRNA in the two injection group after one week. The delay in maturation in the experimental group was even more pronounced compared to that in the one injection and control groups. When the control prawns had begun a new reproductive cycle, the two injection group was still in the pre-vitellogenesis stage accumulating yolk protein (Fig. 8). qPCR analysis indicated that injection of Vg-dsRNA resulted in downregulation of VgR. The Mn-VgR gene transcript level declined by 90% in the ovary, presumably due to decreased Vg expression (Fig. 7d). In the process of ovarian maturation, the level of Mn-VgR fluctuated in the control group, whereas it stayed low in the Vg RNAi group. 4. Discussion In this study, we identified the complete Mn-Vg transcript sequence, which is approximately 8 kb in size with 2536 aas encoded by its ORF. The deduced amino acid sequences revealed the common characteristic sequence of insect Vg (Chen et al., 1997; Sappington and Raikhel, 1998; Sappington et al., 2002), with considerable conservation, particularly in the N-terminus. The vitellogenin N-terminal and VYWD domains are

26

H. Bai et al. / Gene 562 (2015) 22–31





Fenneropenaeus merguiensis Fenneropenaeus chinensis



Penaeus semisulcatus



Litopenaeus vannamei Penaeus monodon

 

Marsupenaeus japonicus 

Metapenaeus ensis Cherax quadricarinatus



 

Homarus americanus Macrobrachium nipponense

Decapods

Macrobrachium rosenbergii Pandalopsis japonica

 

Pandalus hypsinotus Upogebia major Portunus trituberculatus



Callinectes sapidus



Charybdis feriatus

 

 

Scylla paramamosain Tigriopus japonicas Lepeophtheirus salmonis

Copepods

Paracyclopina nana  

Bombyx mori Spodoptera litura Apis mellifera



Blattella germanica

 

Hexapods

Leucophaea maderae

0.2 Fig. 2. A phylogenetic tree of vitellogenin amino acid sequences. Numbers at branch nodes represent the confidence level of posterior probability. The sequences used were as follows: Fenneropenaeus merguiensis, AAR88442; Fenneropenaeus chinensis, ABC86571; Penaeus semisulcatus, AAL12620; Litopenaeus vannamei, AAP76571; Penaeus monodon, ABB89953; Marsupenaeus japonicus, BAB01568; Metapenaeus ensis, AAN40701; Cherax quadricarinatus AAG17936; Homarus americanus ABO09863; Macrobrachium rosenbergii, BAB69831; Pandalopsis japonica, ACU51164; Pandalus hypsinotus BAD11098; Upogebia major, BAF91417; Portunus trituberculatus AAX94762; Callinectes sapidus, ABC41925; Charybdis feriatus, AAU93694; Scylla paramamosain, ACO36035; Tigriopus japonicus, ABZ91537.1; Lepeophtheirus salmonis ABU41134; Paracyclopina nana, ADD73551.1; Bombyx mori NP_001037309.1; Spodoptera litura, ABU68426.1 Apis mellifera NP_001011578; Blattella germanica, CAA06379; Leucophaea maderae, BAB19327; Macrobrachium nipponense, KJ768657.

widely found in insects and vertebrates (Baker, 1988). The GLLG motif within the VYWD domain is a sequence unique to decapods. Although its function has not been clearly established, the GL/ICG motif and cysteine residues are necessary for the oligomerization of vertebrate Vg, thus this motif might contain receptor binding sites (Mayadas and Wagner, 1992; Mouchel et al., 1996). In our study, a DUF also was found in Mn-

Vg. This DUF family is thought to be particularly present in decapods (e.g., M. rosenbergii, P. japonicus, and P. hypsinotus), but it has rarely been examined in insects and vertebrates (Smolenaars et al., 2007). This domain family possesses a structure consisting of several large open beta sheets (Thompson and Banaszak, 2002), and a thorough study is needed to identify its exact function.

Fig. 3. The expression profile of Mn-Vg in different tissues was revealed by real-time quantitative PCR. The amount of Vg mRNA was normalized to the β-actin transcript level. Data are shown as means ± SD of three replicates in various tissues. a): O—ovary; FL—hepatopancreas, FB—brain; Fx—hemocytes; FAG—abdominal ganglion; FH—heart; FE—eyestalk. b) T—testis; ML—hepatopancreas, MB—brain; Mx—hemocytes; MAG—abdominal ganglion; MH—heart; ME—eyestalk. Statistical analyses were performed with one-way ANOVA analysis (a and b indicate a significant difference).

H. Bai et al. / Gene 562 (2015) 22–31

Fig. 4. The temporal expression of Mn-Vg in the different development larvae before the metamorphosis and post-larvae after the metamorphosis was revealed by real-time quantitative PCR. The amount of Mn-Vg mRNA was normalized to the β-actin transcript level. Data are shown as means ± SD of three repeated samples during the larvae and post-larvae. CS—cleavage stage; BS—blastula stage; GS—gastrula stage; NS—nauplius stage; ZS—zoea stage; L1—the first day larvae after hatching; P1—the first day post-larvae after metamorphosis, and so on. Statistical analyses were performed with one-way ANOVA analysis (a, b, c, d, and e indicate a significant difference with each other).

As in the Vgs of other crustaceans (Abdu et al., 2002; Okuno et al., 2002; Phiriyangkul and Utarabhand, 2006; Zmora et al., 2007; Jia et al., 2013), the Vg in M. nipponense had no phosvitin or polyserine domains, which contain tandem serine repeats; in contrast, these domains are present in many vertebrate and insect Vgs. Multiple serine residues strung together could be a sites for casein kinase II phosphorylation (Kuenzel et al., 1987; Meggio and Pinna, 1988), which plays a role in receptor binging during receptor-mediated endocytosis in insects (Wahli, 1988). The absence of phosvitin and polyserine domains in crustaceans implies that another mechanism is responsible for Vg receptor binding during endocytosis of Vg. The Mn-Vg protein includes six Nglycosylation sites, which may be involved in protein folding and transport and in recognition between Vg and its target, the oocyte (Roth et al., 2010).

27

Most decapod crustacean Vg pre-propeptides are cleaved into three fragments at two processing sites. Mn-Vg contains two cleavage sites (R-X-K/R-R) that are targeted by enzymes of the subtilisin family; these sites are also present in other crustacean species (P. japonica, M. rosenbergii, H. americanus, and C. quadricarinatus). The RXRR cleavage site commonly occurs at aa residues 707–730. However, the cleavage mechanism at the second processing site [(R/K) XX (R/K)] is not consistent and shows more sequence variability. The second site could not be examined in the brachyuran and penaeid (Jeon et al., 2010; Kang et al., 2008). Vgs can be divided into two or more peptides from the position of these cleavage sites. To the best of our knowledge, the variability of the Vn level was investigated by enzyme-linked immunosorbent assay (ELISA) in Procambarus clarkii (Xie, 2009). The expression of Vn fluctuated as the embryo developed and exhibited a rest period around the gastrula stage. Vn expression then decreased after the rupture of the embryonic membrane. In our study of M. nipponense, qPCR analysis indicated that Mn-Vg expression also fluctuated during embryonic development. It was significantly highly expressed and peaked at day 1 of larval development, then declined and stayed at a low level. This expression pattern is consistent with that of Vn in P. clarkii. These results indicate that Vg is necessary for embryonic and larval development, which suggests that Vg provides a stream of energy, carbohydrates, and vitamins to fuel embryogenesis and early larval development. The gastrula stage is critical to embryonic development because massive quantities of nutrients are synthesized and consumed during this stage. During the larval stage, however, the endogenous nutrients from Vn gradually are replaced by exogenous feeding (Li, 2004). In addition, expression of Vg was detected in juvenile females at 20 days postlarval stage when the primordia of sex gland began to differentiation (in press). This pattern suggests that the Mn-Vg gene plays a role in the process of sex gland differentiation. Vg also showed sex-dependent expression in the silkworm Bombyx mori (Yano et al., 1994) and the honeybee Apis mellifera (Guidugli et al., 2005). Our study is the first to report the involvement of Vg in the development of embryonic and postembryonic Palaemonidae. Vgs are commonly expressed in a sex- and tissue-specific manner in many species. In many decapod species, the female hepatopancreas is considered to be the major site of Vg gene expression. Vg was only detected in the female hepatopancreas and hemolymph in species such as M. rosenbergii (Okuno et al., 2002), P. hypsinotus (Tsutsui et al., 2004), and C. quadricarinatus (Abdu et al., 2002). In Penaeids such as M. japonicus (Okumura et al., 2007) and F. merguiensis (Phiriyangkul

Fig. 5. Quantitative analysis of Mn-Vg transcripts using real-time PCR in ovary (a) and hepatopancreas (b) in different development stages of ovaries. I—proliferation stage, II—fusion nucleolus stage; III—oil globules stage, IV—yolk granule stage, V—maturation stage, VI—paracmasis stage. Each data point represents the mean and standard deviation (n ≥ 3 samples). Statistical analyses were performed with one-way ANOVA analysis (a, b, c, and d indicate a significant difference with each other).

28

H. Bai et al. / Gene 562 (2015) 22–31

Fig. 6. Expression level of Mn-Vg after eyestalk ablation in ovary (a) and hepatopancreas (b); each data point represents the mean and standard deviation (n ≥ 3 samples). Statistical analyses were performed with one-way ANOVA analysis. 1–13d represent the days after eyestalk ablation (a, b, c, d, e, f, g, and x indicate a significant difference with each other).

et al., 2007), Vg is thought to be expressed only in the female hepatopancreas, hemolymph, and ovary. In our study, qPCR results indicated that Mn-Vg was highly expressed in the female hepatopancreas, followed

by the ovary, and the hemocytes, and expressed at very low levels in male tissues. These results imply the presence of the following extra-ovarian Vg synthesis pathway in mature M. nipponense females: Vg is generally

Fig. 7. Real-time PCR analysis of injection with vg dsRNA (4 μg/g). a) represents the effects of Mn-vg knock-down on gonad stimulation index (GSI) of prawns; b) represents the relative Mn-vg expression levels in the ovary after RNA inference; c) represents the relative Mn-vg expression levels in the hepatopancreas after RNA inference; d) represents the relative Mn-VgR expression levels in the ovary after inject with vg-dsRNA. Each data point represents the mean and standard deviation (n ≥ 3 samples). Statistical analyses were performed with oneway ANOVA analysis (a, b, c, d, e, f, g, and h indicate a significant difference with each other).

H. Bai et al. / Gene 562 (2015) 22–31

29

Fig. 8. Real-time PCR analysis of relative Mn-VgR expression levels in the ovary after inject with twice Vg dsRNA (4 ug/g); a) represent the effects of twice-injection effect on gonad stimulation index (GSI); b) represent the relative Mn-Vg expression levels in the ovary after twice RNA inference. Each data point represents the mean and standard deviation (n ≥ 3 samples). Statistical analyses were performed with one-way ANOVA analysis (a, b, c, d, e, and f indicate a significant difference with each other).

synthesized in the hepatopancreas, released into hemolymph, and then deposited in developing oocytes through receptor-mediated endocytosis. This premise is consistent with results of previous studies of L. vannamei (Quackenbush, 1989), P. semisulcatus (Fainzilber et al., 1992), and M. rosenbergii (Lee and Chang, 1999; Soroka et al., 2000). However, we cannot rule out the possibility that an auto-synthesis pathway also exists in the ovary. Vg in known to exhibit a variable transcript level during the course of an oogenic cycle (Phiriyangkul et al., 2007; Raviv et al., 2006). In crustaceans, Vg gene synthesis activity increases from the primary vitellogenesis stage to the final maturation of the ovary and then declines after oviposition; this pattern has been documented in M. japonicus (Okumura et al., 2007) and Scylla paramamosain (Jia et al., 2013). In the current study, this fluctuation also was detected in both the ovary and the hepatopancreas of M. nipponense. In the ovary, the expression level increased from the pre-vitellogenesis stage and peaked at the maturation stage. In contrast, the rise in the hepatopancreas was sharp and delayed. On the whole, the relative expression level of Vg was much higher in the hepatopancreas than in the ovary. Based on the Mn-Vg tissue distribution and expression pattern during development of the ovary, we conclude that the hepatopancreas and ovary are both sites of Mn-Vg synthesis, but the hepatopancreas is the main synthesis site. This premise is consistent with previous studies of L. vannamei (Raviv et al., 2006), M. japonicus (Okumura et al., 2007), M. ensis (Tsang et al., 2003), and F. merguiensis (Phiriyangkul et al., 2007). However, Vg was only synthesized in the hepatopancreas in M. rosenbergii (Okuno et al., 2002). Eyestalk ablation is thought to cut off the source of GIH and result in rapid vitellogenesis, as was reported in the giant freshwater prawn M. rosenbergii (Murmu et al., 2007). Furthermore, eyestalk ablation induced an increase of Vg mRNA in the ovary but not in the hepatopancreas in M. japonicus (Tsutsui et al., 2005; Okumura et al., 2007) and in L. vannamei (Raviv et al., 2006). In our study, the expression pattern of Mn-Vg after eyestalk ablation was evaluated in the ovary and hepatopancreas. Eyestalk ablation accelerated maturation of the ovary. MnVg was dramatically up-regulated in both the hepatopancreas and ovary 3 days after eyestalk removal in comparison with intact females. The accumulation of Vg in the hepatopancreas was sharply, but accumulation in the ovary was more stable; this result suggests that eyestalk hormone particularly regulates the process of Vg translation, release from the hepatopancreas, and then incorporation into the oocytes. Our findings also indicated that the target tissues for hormone inhibition are the hepatopancreas and the ovary and the hepatopancreas was the main effect sites.

Few studies of Vg RNAi have been published. In this study, we detected the expression pattern and GSI changes after Vg-dsRNA injection into the hepatopancreas or ovary of M. nipponense. Our results show that Mn-vg RNAi treatment effectively inhibited the development of ovary in M. nipponense. The expression level of Mn-Vg was significantly decreased in both tissues compared with the control group. In addition, the control group completed oviposition and reached stage I within 13 days, whereas the Vg-dsRNA group took 17 or more days. Thus, injection of 4 μg/g Vg-dsRNA delayed oocyte development and extended the ovarian cycle. This critical discovery can be used to develop a new method to solve the sexual precocity problem that is widely prevalent in M. nipponense and Eriocheir sinensis culture areas (Xu and Jiang, 2001; Yang, 2007). To demonstrate the feasibility of using RNAi technology in practice, we conducted the two injection experiment. Our results indicate that two injections of Mn-Vg RNAi effectively inhibited ovary development, as the ovary remained in the state of un-development under the influence of RNAi. These results will be helpful for further research on sexual precocity and to increase commercially production in this species. Upon its release into the hemolymph, Vg is taken up by the oocytes through receptor-mediated endocytosis, which is an essential reproductive process ubiquitous in all eukaryotes (Roth and Porter, 1964; Warrier and Subramoniam, 2002). Under the influence of RNAi, the down-regulated expression of the VgR transcript in the ovary was synchronized with the expression of Vg, which suggests that the Vg gene can effectively control the expression of VgR during the process of vitellogenesis. In a previous study, Mekuchi et al. (2008) found that M. japonicus VgR dsRNA injection leading to a decrease in the Vn content of the ovary. However, our study is the first report to investigate the relationship between these two genes through Vg-dsRNA injection in a crustacean. In summary, we cloned the complete Vg cDNA sequence in M. nipponense and identified the domain organization and expression patterns in different tissues, different developmental stages, and during the ovary development cycle. The main sites of Vg synthesis in M. nipponense are the ovary and hepatopancreas. Eyestalk ablation accelerated ovary maturation by removing the hormone inhibition of Mn-Vg. RNAi inhibited maturation of the ovary, which established a theoretical basis for solving the sexual precocity issue in aquaculture practice. In addition, Vg RNAi down-regulated Mn-VgR gene expression in the ovary, which implies a close relationship between Vg and VgR in the process of vitellogenesis. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.gene.2014.12.008.

30

H. Bai et al. / Gene 562 (2015) 22–31

Acknowledgments The project was supported by the Freshwater Fisheries Research Center, China Central Governmental Research Institutional Basic Special Research Project from the Public Welfare Fund (2013JBFM15), the National Natural Science Foundation of China (Grant No. 31272654), the National Science & Technology Supporting Program of the 12th Fiveyear Plan of China (Grant No. 2012BAD26B04), Jiangsu Provincial Natural Science Foundation for Young Scholars of China (Grant No. BK2012091), the Science & Technology Supporting Program of Jiangsu Province (Grant No. BE2012334), and the three aquatic projects of Jiangsu Province (D2013-6). References Abdu, U., Davis, C., Khalaila, I., Sagi, A., 2002. The vitellogenin cDNA of Cherax quadricarinatus encodes a lipoprotein with calcium binding ability, and its expression is induced following the removal of the androgenic gland in a sexually plastic system. Gen. Comp. Endocrinol. 127 (3), 263–272. Adiyodi, K.G., Adiyodi, R.G., 1970. Endocrine control of reproduction in decapod Crustacea. Biol. Rev. 45 (2), 121–164. Baker, M.E., 1988. Is vitellogenin an ancestor of apolipoprotein B-100 of human lipoprotein and human lipoprotein lipase. Biochemistry 255, 1057–1060. Browdy, C.L., Fainzilber, M., Tom, M., Loya, Y., Lubzens, E., 1990. Vitellin synthesis in relation to oogenesis in in vitro-incubated ovaries of Penaeus semisulcatus (Crustaceas, Decapoda, Penaeidae). Exp. Zool. 255, 205–215. Bureau of Fishery, Ministry of Agriculture, P.R.C., 2011. Fisheries economic statistics. China Fishery Yearbook. China Agricultural Press, Beijing, p. 236. Chen, J.S., Sappington, T.W., Raikhel, A.S., 1997. Extensive sequence conservation among insect, nematode, and vertebrate vitellogenins reveals ancient common ancestry. Mol. Evol. 44 (4), 440–451. Chen, Y., Zhu, Q., Chen, H., Zhu, X.L., Cui, Z., Qiu, G.F., 2012. The morphological and histological observation of embryonic development in the oriental river prawn Macrobrachium nipponense. J. Shanghai Ocean Univ. 21 (1), 33–40. De Kleijn, D.P., Janssen, K.P., Waddy, S.L., Hegeman, R., Lai, W.Y., Martens, G.J., Van Herp, F., 1998. Expression of the crustacean hyperglycaemic hormones and the Gonad inhibiting hormone during the reproductive cycle of the female American lobster Homarus americanus. J. Endocrinol. 156 (2), 291–298. Fainzilber, M., Tom, M., Shafir, M., Applebaum, S.W., Lubzens, E., 1992. Is there extraovarian synthesis of vitellogenin in penaeid shrimp. Biol. Bull. 183 (2), 233–241. Gu, P.L., Tobe, S.S., Chow, B.K., Chu, K.H., He, J.G., Chan, S.M., 2002. Characterization of an additional molt inhibiting hormone-like neuropeptide from the shrimp Metapenaeus ensis. Peptides 23 (11), 1875–1883. Guidugli, K.R., Piulachs, M.D., Bellés, X., Lourenço, A.P., Simões, Z.L., 2005. Vitellogenin expression in queen ovaries and in larvae of both sexes of Apis mellifera. Arch. Insect Biochem. Physiol. 59 (4), 211–218. Jayasankar, V., Tsutsui, N., Jasmani, S., Saido-Sakanaka, H., Yang, W.J., Okuno, A., Tran, T.T., Aida, K., Wilder, M.N., 2002. Dynamics of vitellogenin mRNA expression and changes in hemolymph vitellogenin levels during ovarian maturation in the giant freshwater prawn Macrobrachium rosenbergii. J. Exp. Zool. 293 (5), 675–682. Jeon, J.M., et al., 2010. Characterization of two vitellogenin cDNAs from a Pandalus shrimp (Pandalopsis japonica): expression in hepatopancreas is down-regulated by endosulfan exposure. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 157 (1), 102–112. Jia, X., Chen, Y., Zou, Z., Lin, P., Wang, Y., Zhang, Z., 2013. Characterization and expression profile of Vitellogenin gene from Scylla paramamosain. Gene 520 (2), 119–130. Kang, X.J., Sun, T.C., Wang, S.A., 1996. Preliminary study on the isolated culture of the fertilized egg and embryonic development of the Macrobrachium. nipponense (Crustacea Decapoda). J. Hebei Univ. (Nat. Sci. Ed.) 16 (4), 41–45. Kang, B.J., et al., 2008. Vitellogenesis in both sexes of gonochoristic mud shrimp, Upogebia major (Crustacea): analyses of vitellogenin gene expression and vitellogenin processing. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 149, 589–598. Kleijn, D.P., Jansse, K.P., Martens, G.J., Herp, F., 1994. Cloning and expression of two crustacean hyperglycemic-hormone mRNAs in the eyestalk of the crayfish Orconectes limosus. Eur. J. Biochem. 224 (2), 623–629. Kuenzel, E.A., Mulligan, J.A., Sommercorn, J., Krebs, E.G., 1987. Substrate specificity determinants for casein kinase II as deduced from studies with synthetic peptides. J. Biol. Chem. 262 (19), 9136–9140. Lee, F.Y., Chang, C.F., 1999. Hepatopancreas is the likely organ of vitellogenin synthesis in the freshwater prawn, Macrobrachium rosenbergii. J. Exp. Zool. 284 (7), 798–806. Lee, C.Y., Watson, R.D., 1995. In vitro study of vitellogenesis in the blue crab (Callinectes sapidus): site and control of vitellin synthesis. J. Exp. Zool. 271 (5), 364–372. Li, H.D., 2004. Nutrition on Embryonic Development of Redclaw Crayfish, Cherax quadricarinatus. (Master degree thesis). Hua Dong Normal University of China, Shang Hai. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2 (− Delta Delta C (T)). Method. Methods 25, 402–408. Matozzo, V., Gagne, F., Marin, M.G., Ricciardi, F., Blaise, C., 2008. Vitellogenin as a biomarker of exposure to estrogenic compounds in aquatic invertebrates: a review. Environ. Int. 34 (4), 531–545.

Mayadas, T.N., Wagner, D.D., 1992. Vicinal cysteines in the pro-sequence play a role in von Willebrand factor multimer assembly. Proc. Natl. Acad. Sci. U. S. A. 89, 3531–3535. Meggio, F., Pinna, L.A., 1988. Phosphorylation of phosvitin by casein kinase-2 provides the evidence that phosphoserines can replace carboxylic amino acids as specificity determinants. Biochim. Biophys. Acta 971 (2), 227–231. Mekuchi, M., Ohira, T., Kawazoe, I., Jasmani, S., Suitoh, K., Kim, Y.K., Jayasankar, V., Nagasawa, H., Wilder, M.N., 2008. Characterization and expression of the putative ovarian lipoprotein receptor in the kuruma prawn, Marsupenaeus japonicus. Zool. Sci. 25 (4), 428–437. Mouchel, N., Trichet, V., Betz, A., Le Pennec, J.P., Wolff, J., 1996. Characterization of vitellogenin from rainbow trout (Oncorhynchus mykiss). Gene 174 (1), 59–64. Murmu, K., Sahu, N.P., Mallik, S.K., Reddy, A.K., Kohli, M.P.S., 2007. Rematuration of spent Macrobrachium rosenbergii female broodstock through dietary manipulation and eyestalk ablation. Isr. J. Aquacult. - Bamidgeh 59, 104–110. Okumura, T., Yamano, K., Sakiyama, K., 2007. Vitellogenin gene expression and hemolymph vitellogenin during vitellogenesis, final maturation, and oviposition in female kuruma prawn, Marsupenaeus japonicus. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 147 (4), 1028–1037. Okuno, A., Yang, W.J., et al., 2002. Deduced primary structure of vitellogenin in the giant freshwater prawn, Macrobrachium rosenbergii, and yolk processing during ovarian maturation. J. Exp. Zool. 292 (5), 417–429. Phiriyangkul, P., Utarabhand, P., 2006. Molecular characterization of a cDNA encoding vitellogenin in the banana shrimp, Penaeus (Litopenaeus) merguiensis and sites of vitellogenin mRNA expression. Mol. Reprod. Dev. 73 (4), 410–423. Phiriyangkul, P., Puengyam, P., Jakobsen, I.B., Utarabhand, P., 2007. Dynamics of vitellogenin mRNA expression during vitellogenesis in the banana shrimp, Penaeus (Fenneropenaeus) merguiensis using real-time PCR. Mol. Reprod. Dev. 74 (9), 1198–1207. Quackenbush, L.S., 1989. Vitellogenesis in the shrimp, Penaeus vannamei: in vitro studies of the isolated hepatopancreas and ovary. Comp. Biochem. Physiol. B 94 (2), 253–261. Raviv, S., Parnes, S., Segall, C., Davis, C., Sagi, A., 2006. Complete sequence of Litopenaeus vannamei (Crustacea: Decapoda) vitellogenin cDNA and its expression in endocrinologically induced sub-adult females. Gen. Comp. Endocrinol. 145 (1), 39–50. Roth, T.F., Porter, K.R., 1964. Yolk protein uptake in the oocyte of the mosquito Aedes aegypti. J. Cell Biol. 20 (2), 313–332. Roth, Z., et al., 2010. N-glycan moieties of the crustacean egg yolk protein and their glycosylation sites. J. Glycoconj. 27 (1), 159–169. Sappington, T.W., Raikhel, A.S., 1998. Molecular characteristics of insect vitellogenins and vitellogenin receptors. Insect Biochem. Mol. Biol. 28 (5), 277–300. Sappington, T.W., Oishi, K., Raikhel, A.S., 2002. Structural characteristics of insect vitellogenins. Prog. Vitellogenesis 12 (Part A), 69–101. Schneider, W.J., 1992. Lipoprotein receptors in oocyte growth. Clin. Invest. 70 (5), 385–390. Smolenaars, M.M., Madsen, O., Rodenburg, K.W., et al., 2007. Molecular diversity and evolution of the large lipid transfer protein superfamily. J. Lipid Res. 48 (3), 489–502. Soroka, Y., Milner, Y., Sagi, A., 2000. The hepatopancreas as a site of yolk protein synthesis in the prawn Macrobrachium rosenbergii. Invertebr. Reprod. Dev. 37 (1), 61–68. Thompson, J.R., Banaszak, L.J., 2002. Lipid–protein interactions in lipovitellin. J. Biochem. 41 (30), 9398–9409. Tiu, S.H.K., Hui, J.H., He, J.G., Tobe, S.S., Chan, S.M., 2006a. Characterization of vitellogenin in the shrimp Metapenaeus ensis: expression studies and hormonal regulation of MeVg1 transcription in vitro. Mol. Reprod. Dev. 73 (4), 424–436. Tiu, S.H.K., Hui, J.H.L., Mak, A.S.C., He, J., Chan, S., 2006b. Equal contribution of hepatopancreas and ovary to the production of vitellogenin (PmVg1) transcripts in the tiger shrimp, Penaeus monodon. Aquaculture 254 (1), 666–674. Tsang, W., Quackenbush, L.S., Chow, B.K.C., Tiu, S.H.K., He, J., Chan, S., 2003. Organization of the shrimp vitellogenin gene: evidence of multiple genes and tissue specific expression by the ovary and hepatopancreas. Gene 303, 99–109. Tsutsui, N., et al., 2000. Molecular characterization of a cDNA encoding vitellogenin and its expression in the hepatopancreas and ovary during vitellogenesis in the kuruma prawn, Penaeus japonicus. Zool. Sci. 17 (5), 651–660. Tsutsui, N., et al., 2004. Molecular characterization of a cDNA encoding vitellogenin in the coonstriped shrimp, Pandalus hypsinotus and site of vitellogenin mRNA expression. J. Exp. Zool. A Ecol. Genet. Physiol. 301 (10), 802–814. Tsutsui, N., Kim, Y.K., Jasmani, S., Ohira, T., Wilder, M.N., Aida, K., 2005. The dynamics of vitellogenin gene expression differs between intact and eyestalk ablated kuruma prawn, Penaeus (Marsupenaeus) japonicus. Fish. Sci. 71 (2), 249–256. Wahli, W., 1988. Evolution and expression of vitellogenin genes. Trends Genet. 4 (8), 227–232. Warrier, S., Subramoniam, T., 2002. Receptor mediated yolk protein uptake in the crab Scylla serrata: crustacean vitellogenin receptor recognizes related mammalian serum lipoproteins. Mol. Reprod. Dev. 61 (4), 536–548. Wilder, M.N., Okumura, T., Tsutsui, N., 2010. Reproductive mechanisms in Crustacea focusing on selected prawn species: vitellogenin structure, processing and synthetic control. Aqua Biosci. Monogr. 3, 73–110. Wu, P., Qi, D., Chen, L.Q., et al., 2009. Gene discovery from an ovary cDNA library of oriental river prawn Macrobrachium nipponense by ESTs annotation. J. Comp. Biochem. Physiol. D 4 (2), 111–120. Xie, S., 2009. The Early Development and Vitellin Levels of the Crayfish Procambarus clarkii. (Master degree thesis), Hebei University (June). Xu, R.W., Jiang, J.P., 2001. A preliminary study on causes of sexual premature of Eriocheir sinensis. J. Zhejiang Ocean Univ. 3, 002. Yang, H.J., 2007. Technical measures to control the precocious puberty in Macrobrachium nipponense. J. Fish. 10, 48-48 (guide to be rich).

H. Bai et al. / Gene 562 (2015) 22–31 Yang, W.J., Ohira, T., Tsutsui, N., Subramoniam, T., Huong, D.T.T., Aida, K., Wilder, M.N., 2000. Determination of amino acid sequence and site of mRNA expression of four vitellins in the giant freshwater prawn, Macrobrachium rosenbergii. J. Exp. Zool. 287 (6), 413–422. Yano, K., Sakurai, M.T., Izumi, S., Tomino, S., 1994. Vitellogenin gene of the silkworm, Bombyx mori: structure and sex-dependent expression. FEBS Lett. 356 (2), 207–211.

31

Zhang, Y.P., Jiang, S.F., Xiong, Y.W., Sun, S.M., Qiao, H., Jin, S.B., Gong, Y.S., Fu, H.T., 2013. Molecular cloning and expression analysis of extra sex combs gene during development in Macrobrachium nipponense. Turk. J. Fish. Aquat. Sci. 13, 331–340. Zmora, N., Trant, J., Chan, S.M., Chung, J.S., 2007. Vitellogenin and its messenger RNA during ovarian development in the female blue crab, Callinectes sapidus: gene expression, synthesis, transport, and cleavage. Biol. Reprod. 77 (1), 138–146.