Diabetes Research and Clinical Practice, 15 (1992) 0
1992 Elsevier
Science Publishers
31-44
B.V. All rights reserved
37
0168-8227/92/$05.00
DIABET 00574
Molecular biology of islet amyloid polypeptide Masahiro
Nishi ‘, Tokio Sanke ‘, Shinya Ohagi ‘, Kunihiro Ekawa ‘, Hisao Wakasaki ‘, Kishio Nanjo ‘, Graeme I. Bell2 and Donald F. Steiner2
’ The First Department of Medicine, Wakayama University of Medical Science, Wakayama. Japan and ‘Department of Biochemistry and Molecular Biology and Howard Hughes Medical Institute, University of Chicago. Chicago, Illinois, U.S.A.
Summary We investigated the relationship between non-insulin-dependent diabetes mellitus (NIDDM) and islet amyloid polypeptide (IAPP) gene by restriction fragment length polymorphism (RFLP) and polymerase chain reaction (PCR)-direct sequencing analysis. Endonuclease BglII and/or PvuII RFLP analysis revealed no positive correlation of IAPP gene with NIDDM. In PCR-direct sequencing of 25 NIDDM patients, no nucleotide sequence differences were found. These data do not support the view that IAPP plays an important role in the pathogenesis of NIDDM. cDNAs encoding cat, rat, mouse, guinea pig and degu IAPP precursors were also cloned, and comparison of these predicted amino acid sequences clarified the species difference, especially between amyloid-forming and non-amyloid-forming species. Amino acid residues 25-28 of mature IAPP might be responsible for their amyloidogeneity. The alternative splicing transcripts of guinea pig IAPP gene were identified by using PCR. If these types of transcripts are translated, N-terminal mutated IAPP might be produced and act as an antagonist. The signal peptide cleavage site of rat IAPP precursor was also identified by an in vitro translation and processing system. Key words: Islet amyloid polypeptide; Restriction fragment reaction; Alternative splicing; Signal peptide
Introduction Islet amyloidosis is an old and new subject of diabetic research. Since the report of Opie in 190 1 [ 11, islet amyloidosis has been one of the most characteristic morphological features of the islets of patients with non-insulin-dependent diabetes mellitus (NIDDM), although it was not until 1986 Correspondence to: M. Nishi, The First Dept. of Medicine, Wakayama University of Medical Science, 27 Nanaban-cho, Wakayama 640, Japan.
length polymorphism;
Polymerase
chain
[ 21 and 1987 [ 31 that the isolation of islet amyloid fibril protein, islet amyloid polypeptide (IAPP) or amylin, was done. Since that time, the new era of research of islet amyloidosis has come. Determination of the amino acid sequence of IAPP revealed its unexpected similarity to calcitonin gene-related peptide (CGRP). The cloning of cDNA [4] and gene [ 51 encoding human IAPP gave us the useful molecular biological tool to investigate the possible significance of IAPP in the pathogenesis and/or development of NIDDM. Using cDNA as a probe, the
38
linkage of the IAPP gene and NIDDM was investigated by restriction fragment length polymorphism (RFLP) analysis. In other amyloidoses, it was demonstrated that the mutant form of fibril protein, such as transthyretin in familial amyloidotic polyneuropathy, could contribute to form amyloid deposits [6]. The possible mutation or variation of IAPP gene in NIDDM are also investigated by polymerase chain reaction (PCR)direct sequencing analysis. The mechanism of amyloid deposition of IAPP is still unknown, and there exists a species difference in islet amyloidosis. In humans, cats and a few other species, islet amyloid depositions were reported, although in rodents other than degu, no reports of islet amyloid were made (in the case of degu, its amyloid consists of insulin [7]). The primary structure of IAPP in each species may explain this difference. To answer this question, we cloned cDNAs encoding cat, rat, mouse, guinea pig, and degu IAPP precursors. The calcitonin/CGRP1 gene produces two products, calcitonin and CGRP, by alternative splicing. The IAPP gene might also produce other products by alternative splicing because of its evolutionary relationship with the CGRP gene [5]. We have identified an alternative splicing product of guinea pig IAPP gene by PCR. IAPP precursor contains hydrophobic amino
Exon
1
PCR Sequence
-
RFLP and PCR-direct human IAPP gene
analysis
C_)
fB fB
of
Genomic DNA extracted from peripheral leukocytes was digested by 14 restriction enzymes and analyzed by Southern blot hybridization using nick-translated human IAPP cDNA as a probe. In vitro amplification of exon 2 and 3 of the human IAPP gene were carried out by PCR using oligonucleotide primers as shown in Fig. 1. PCRdirect sequencing was done as described [8]. cDNA cloning of mammalian IAPP precursors
The nucleotide and predicted amino acid sequences of cDNAs encoding cat, rat, mouse, guinea pig and degu IAPP precursors were obtained by combination of amplification of homologous DNA fragments (AHF) and rapid amplification of cDNA ends (RACE). AHF was carried out by PCR using oligonucleotide primers A and
1 kb
100 bp
A_)
representation
sequencing
3
5'-TCAGATTGCTTAGAGAAGGA-3' 5'-ACATCAATTAGAACTGTAAG-3' 5'-ATATTCACACTGGAGATGAA-3' 5'-CAGGAAATCACTAGAACATA-3'
Fig. 1. Schematic
Material and Methods
2
Oligonucleotide A C E G
acid segments at its amino-terminal end. It was thought to be a signal peptide, although its cleavage site had not yet been identified. Using an in vitro translation and processing system, we have identified the signal peptide cleavage site of rat IAPP precursor.
D+ F+
fE fG
primers B - 5'-GGCTGTAGTTATTTGACAGT-3' D - 5'-ATCTCAGCCATCTAGGTGTT-3' F - 5'-TCACATGGCTGGATCCAGCT-3'
of the human IAPP gene. The primers used for PCR and/or DNA sequencing
are noted.
39
B (Table 1). PCR reaction products were analyzed by the gel. Predicted 119 bp DNA fragments were eluted from the gel, subcloned and sequenced. The RACE protocol was carried out as described [9]. The RACE reaction products were subcloned into the HincII site of pGEM4Z, identified by colony hybridization and sequenced.
fied by HPLC degradation.
Alternative splicing of guinea pig IAPP gene
Among 14 restriction enzymes used, RFLP was identified in BglII (9 kb and 7 kb) and PvuII (21 kb and 17 kb) (Fig. 2). In our analysis, the allele of BglII 9 kb always coexisted with PvuII 18 kb and BglII 7 kb coexisted with PvuII 21 kb. The frequencies of each of the alleles in healthy controls and patients with NIDDM showed no significant difference (Table 2). In PCR-direct sequencing analysis, coding regions of exon 2 and 3 of human IAPP genes were amplified and sequenced. The sequences of 25 patients with NIDDM were identical to one another and to the sequence of the cloned gene.
RFLP and PCR-direct man IAPP gene
Signal peptide cleavage site of rat IAPP precursor
The cDNA for rat IAPP precursor was subcloned into pSP64T [lo]. The plasmid thus constructed (pSPRIAP) was linearized by XbaI and used for mRNA synthesis. mRNA synthesis was carried out using the mCAP kit (Stratagene) and SP6 RNA polymerase. In vitro translation and processing was carried out using rabbit reticulocyte lysate and canine pancreatic microsomal membrane (Promega Co., Madison, WI, U.S.A.) following the manufacturer’s instructions, except for using [ ‘H]Val instead of [ 3H]Leu. Five microliter of each reaction was analyzed onto 17.5% SDSpolyacrylamide gel electrophoresis and followed by autoradiography. Putative proIAPP was puri-
cDNA cloning of mammalian IAPP precursors
Primers for AHF
Primer A
CYS TGC
3 Asn AAC
4 Thr ACT
Primer B
34 Ser 3’-AGG
35 Asn TTA
36 Thr TGT
Amino acid numbering
2
5 Ala GCC
6 Thr ACA
CYs TGY
37
38
39
40
Try ATA
Gly CCG
Lys TTC
Arg GC-5 ’
is relative to the N-terminus
sequencing analysis qf hu-
The nucleotide sequences of cat, rat, mouse, guinea pig and degu IAPP precursors were obtained by the combination of AHF and RACE. A comparison of the amino acid sequences of six mammals is shown in Fig. 3. Mammalian IAPP precursors have similar structural organization to that of the human. Each has four domains: a signal peptide, N-terminal propeptide, IAPP and C-terminal propeptide. The IAPP domain of each precursor is flanked by Lys-Arg and Gly-
TABLE 1
1
by Edman
Results
cDNAs synthesized from total RNAs of human islets, human insulinoma, cat, rat, mouse, guinea pig and degu pancreas were amplified by PCR using oligonucleotide primers corresponding to 5 ’ - and 3 ‘-untranslated region of each IAPP precursor. PCR products were analyzed by agarose gel electrophoresis, subcloned into pGEM4Z and sequenced.
Lys 5’-AAG
and microsequenced
7
of mature IAPP.
8 Ala GC-3’
Fig. 2. RFLP analysis of human IAPP genes. Ten micrograms of genomic DNAs are digested by BglII or PvuII, electrophoresed, blotted, and hybridized with nick-translated human IAPP cDNA. Fragment sizes are indicated.
TABLE 2 Frequencies
of haplotypes
and alleles of PvuII or BglII RFLPs at human IAPP locus in normals and NIDDM Haplotype
patients
Allele
PVUII BgZII
21 kb/21 kb I kb/l kb
21 kbjl8 kb I kb/9 kb
18 kb/lS kb 9 kb/9 kb
21 kb I kb
18 kb 9 kb
Normal (n = 54) NIDDM (n = 50)
52% (28/54) 56% (28/50)
35% (19/54) 32% (16/50)
13% (7/54) 12% (6/50)
69% 72%
31% 28%
Lys(Arg)-Arg, suggesting that the mature IAPPs of these animals are also generated by proteolytic processing and C-terminally amidated. The size of each of the precursors differed slightly, being
89-amino acid residues in human and cat, 93 residues in rat and mouse, 92 residues in guinea pig and 91 residues in degu. The predicted amino acid sequence identities between the IAPP
41 N-Terminal
Propeptlde
Signal Peptlde
I*l*t
Alyloid
Polypaptida
C-Termin.3, prOpeF:l'??
IPIES:::HQVEKR KCWTAWWQRuwrLWXS sHHK;uLSS~sH1Y GKFWAVEVLKREPLNYLPL I@91 ,891 -----::: N____- -___----_---____IR----L-_-___-p--_-____ ___ST_DI-N___-__-_F
Human MGILKLQVFLIVLSVALNHLKA cat -CL---p_V____L___H---Rat MRC-SR-PAV-LI-----G--RM0"s.e M-C-S--PAV-LI----S---RGuinea Pig -CL-R-p_T_L__C____E__0. degus -CL-Q-P_V_LL_FA___T___
__,,G_G,.NP--D-- ------------_____~____L-PV-PP-_________ ____“A_~PN__~_~~_~_ __-_-AGDpN__S_DF_)N __“R_GSNP_MD-- __-_-_-_---_-----R-___L-PV-PP-__---____
Flbrli-fCrPL?g regxr
Fig. 3. Comparison
domains
of
5 mammals
and
(93,
,931 _S_A_DTG___G__ ___-_-----_-Y----R--8-L_-A-Lp-D---___ _____p*ISD-_L_H____ (92, ___A-fJTD_R-D-- --_----_---_~____~__~_~__~-pp_~______ _R___Q_“c~~_t_H__-_ ,g;,
of amino acid sequences
human
IAPP were 89% (cat), 84% (rat and mouse) and 78 % (guinea pig and degu).
Alternative splicing of guinea pig IAPP gene
The gel analysis of PCR products of guinea pig IAPP transcripts showed two major products (A and B in Fig. 4). Sequencing analysis revealed that A was consistent with the normal transcripts and that B was a truncated form of the IAPP precursor, which deleted 87 nucleotides. The 5’-end of this deletion corresponds to the exon
rres:ci>es
of six mammalian
23-Zil
IAPP precursors.
2/intron 2 junction of the human gene and the 3’-end is suitable for the consensus sequence of the splice acceptor site, suggesting that this transcript was produced by alternative splicing (Fig. 5). From the other species, however, we could not find this type of alternatively spliced transcript. Signal peptide cleavage site of rat IAPP precursor
The autoradiograph of in vitro translated and processed products of rat IAPP precursor separated by 17.5% SDS-PAGE is shown in Fig. 6. The
bP 13531078872-
603-
310281Fig. 4. The gel analysis of mammalian
IAPP gene transcripts amplified by PCR. Two major guinea pig IAPP gene transcripts amplified by PCR are indicated as A and B.
42
ACATTAAAAGGACTGATTTATTCTTCTCAGAAAATCTGAGAAGCA ~________________________-_-___________-_-...
A B
-22 Met ATG ___
Signal Peptide Cys Leu Leu Arg Leu Pro Val Thr TGC CTC CTT AGG CTG CCA GTA ACG --- -__ ___ _-- .._ _-___
-10 -1 Leu Leu Val Leu Cys Val Ala Leu Am Glu Leu Lys Ala CTC CTT GTG CTC TGT GTT GCA CTA AAC GAA CTG AAA 'XT .. . ... -__ __- -__ ___ ___ ___ ___ _-- -.. .__ ---
N-propeptide Thr Ser Ile Ala Ser Asp Thr ACA TCC ATT GCA AGT GAG ACC --_ ___ _-- --_ __d-
B
10 IAPP 20 Gly His Gln Val Gly Lys Arg Lys Cys Am Thr Ala Thr Cys Ala Thr Gln Arg Leu Thr GGC CAT CAG GTG GGC AA.4 CGA AAG TGC AAC ACT GCC ACG TGT GCG ACA CAA CCC CTG ACA 87 bp deletion
A B
30 40 Am Phe Leu Val Arg Ser Ser His Am Leu Gly Ala Ala Leu Leu Pro Thr Asp Val Gly AAT TTT TTG GTT CGT TCC AGC CAC AAC CTT GGC GCT GCT CTC CTG CCT ACT CAT GTG GGA _ _.. _.. _.. .._ __. ___ ___ .. . ___
A B
50 C-propeptide 60 Ser Am Thr Tyr Gly Lys Arg Asn Ala Pro Gln Ile Ser Asp Arg Glu Leu Leu His Tyr TCC UT ACA TAT GGC AAG AGG AAC GCA CCT CAG ATT TCA GAG AGA GAA CTC CTA CAT TAT _.. __. ._. __. ___ .._ ___ .__ _.. .._ ___ __. _.. ._. _.. .__
A B
70 Leu Pro Leu End CTA CCC CTA TAG AGGTCCACATCCCTTTATAGCTCTCATTTCATGTATTCGCTGATGATTTCCTGTACACATC~ . .. ... ._. ____....____....______________.._...___________.____..~.~~......
A B
CAGTGCCTCTTTCATTTGTAGTGTG ... . ......_......____.___
A
Fig. 5. The nucleotide sequences ofguinea pig IAPP PCR products A and B. The region corresponding to oligonucleotide primers used for PCR are underlined. Dashes indicate same nucleotides as fragments A. The 87 bp deletion of fragment B is indicated by horizontal arrows.
amount of processed products (proIAPP) were increasing according to the amount of added canine pancreatic membrane. ProIAPP purified by HPLC was microsequenced by Edman de-
gradation. The radioactivity of the degraded amino acids of each cycle revealed that the 3rd and the 1 lth amino acids from the signal peptide cleavage site are valine (Fig. 7). This result, thereWil-Val
dpm
- 12.5K Prepro Pro
IAPPl lAPP’-
-
6 5K
-
3.4K
&?
II .
..I
,.“...L
11121314151817181920 2122232425 RNA
Memb
-
+
+
+
+
0
0
0.5
1 0
1.5
+
20
Fig. 6. In vitro translation and processing of rat IAPP precursor mRNA. Prepro- or proIAPP are indicated. The sizes of molecular weight markers (30 K-3.4 K) are indicated.
Cycles Fig. 7. The microsequencing of purified ProIAPP. ProIAPP labeled by [3H]Val is purified by HPLC and microsequenced by Edman degradation. The radioactivity of degraded amino acids of each of the cycles is counted.
43 fore, indicates that the signal peptide cleavage site of rat IAPP precursor is located between the 23rd residue alanine and the 24th residue threonine.
Discussion The cloning of mammalian IAPP cDNAs indicated that IAPP was derived from 84-93 amino acid precursors by proteolytic processing and that its C-terminal was amidated. The amino acid conservation among mammalian IAPPs suggests some of its physiological functions. There have been several reports about the actions of IAPP [ 1 l-151, although at present its real physiological functions are still unknown. Among various IAPP molecules, N- and C-terminal regions are well conserved, although the middle part of IAPP has considerable species variations. It is interesting that the 25-28 amino acid residues of IAPP of the amyloid-forming species (human and cat) are Ala-Ile-Leu-Ser and that those of the non-amyloid-forming species (rat, mouse, and guinea pig) are not. This fact suggests that the 25-28 amino acid residues of IAPP may influence its amyloidogeneity and explain the species difference of islet amyloid deposition. The presence of a signal peptide-like hydrophobic amino acid sequence in its N-terminal end implies that IAPP is a secreted peptide, and the secretion of IAPP has already been demonstrated [ 161. The cleavage of this hydrophobic sequence by canine microsomal membrane also demonstrated that it was really a signal peptide and the determination of the signal peptide cleavage site showed us the exact N-terminal end of the proIAPP. IAPP is structurally related to CGRP. Since the calcitonin/CGRP-1 gene produces 2 products by alternative splicing and the CGRP-2 gene also contains a calcitonin-like sequence in its intron, the IAPP gene might thus possibly produce products other than IAPP by alternative splicing. PCR analysis of mammalian IAPP gene transcripts found a guinea pig IAPP gene alternative splicing product. If this transcript is translated, N-terminal mutated IAPP may be produced. In
the case of CGRP, the N-terminal deleted one (CGRP8-37) acts as an antagonist [ 171. Therefore, this alternative splicing product of guinea pig IAPP gene may also act as an IAPP antagonist, and play a role in regulating IAPP actions. The PCR-direct sequencing analysis of the protein coding region of IAPP genes of 25 patients with NIDDM found no mutations, and this suggests that the structural abnormality of IAPP or its precursor is unlikely to play a significant role in the formation of amyloid deposition. Whether IAPP or islet amyloid deposition is a significant factor in the pathogenesis of NIDDM is an important question. RFLP analysis of the IAPP gene showed no significant correlation with NIDDM, and the PCR-direct sequencing analysis of human IAPP genes of 25 patients with NIDDM also detected no mutations. These results do not support the views that IAPP is a significant factor in the pathogenesis of NIDDM and that structurally abnormal IAPP or its precursor may lead to amyloid depositions, although further work about IAPP gene expression, its processing and its physiological roles will be necessary.
Acknowledgements This work was supported by National Institutes of Health Grants DK13914 and DK20595, Howard Hughes Medical Institute, and Grant-in Aid for Scientific Research (No. 01480294) from the Ministry of Education, Science and Culture of Japan.
References Opie, E. (1901) The relation ofdiabetes mellitus to lesions of the pancreas: hyaline degeneration of the islands of Langerhans. J. Exp. Med. 5, 527-540. Westermark, P., Wernstedt, C., Wilander, E. and Sletten, K. (1986) A novel peptide in the calcitonin gene related peptide family as an amyloid fibril protein in the endocrine pancreas. Biochem. Biophys. Res. Commun. 140, 827-831.
44 3 Clark, A., Lewis, C.E., Willis, AC. et al. (1987) Islet amyloid formed from diabetes-associated peptide may be pathogenic in type-2 diabetes. Lancet ii, 231-234. 4 Sanke, T., Bell, G.I., Sample, C., Rubenstein, AC. and Steiner, D.F. (1988) An islet amyloid peptide is derived from an 89-amino acid precursor by proteolytic processing. J. Biol. Chem. 262, 17243-17246. 5 Nishi, M., Sanke, T., Seino, S. et al. (1989) Human islet amyloid polypeptide gene: complete nucleotide sequence, chromosomal localization, and evolutionary history. Mol. Endocrinol. 3, 1775-1781. 6 Pepys, M.B. (1988) Amyloidosis: some recent developments. Q.J. Med. 76, 283-298. 7 Hellman, U., Wernstedt, C., Westermark, P., O’Brien, T.D., Rathbun, W.B. and Johnson, K.H. (1990) Amino acid sequence from degu islet amyloid-derived insulin shows unique sequence characteristics. Biochem. Biophys. Res. Commun. 169, 571-577. 8 Kadowaki, T., Kadowaki, H. and Taylor, S.I. (1990) A nonsense mutation causing decreased levels of insulin receptor mRNA: detection by a simplified technique for direct sequencing of genomic DNA amplified by the polymerase chain reaction. Proc. Natl. Acad. Sci. U.S.A. 87, 658-662. 9 Frohman, M.A., Dush, M.K. and Martin, G.R. (1988) Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc. Natl. Acad. Sci. U.S.A. 85, 8998-9002. 10 Krieg, P.A. and Melton, D.A. (1984) Functional messen-
11
12
13
14
15
16
17
ger RNAs are produced by SP6 in vitro transcription of cloned cDNAs. Nucleic Acids Res. 12, 7057-7070. Cooper, G.J.S., Leighton, B., Dimitriadis, G.D. et al. (1988) Amylin found in amyloid deposits in human type 2 diabetes mellitus may be a hormone that regulates glycogen metabolism in skeletal muscle. Proc. Natl. Acad. Sci. U.S.A. 85, 7763-7766. Datta, H.K., Zaidi, M., Wimalawansa, S.J. et al. (1989) In vivo and in vitro effects of amylin and amylin-amide on calcium metabolism in the rat and rabbit. Biochem. Biophys. Res. Commun. 162, 876-881. Brain, S.D., Wimalawansa, S., MacIntyre, I. and Williams, T.J. (1990) The demonstration of vasodilator activity of pancreatic amylin amide in the rabbit. Am. J. Pathol. 136, 487-490. Ohsawa, H., Kanatsuka, A., Yamaguchi, T., Makino, H. and Yoshida, S. (1989) Islet amyloid polypeptide inhibits glucose-stimulated insulin secretion from isolated rat pancreatic islets. Biochem. Biophys. Res. Commun. 160, 961-967. Sowa, R., Sanke, T., Hirayama, J. et al. (1990) Islet amyloid polypeptide amide causes peripheral insulin resistance in vivo. Diabetologia 33, 118-120. Kanatsuka, A., Makino, H., Ohsawa, H. et al. (1989) Secretion of islet amyloid polypeptide in response to glucose. FEBS Lett. 259, 199-201. Chiba, T., Yamaguchi, A., Yamatani, T. et al. (1989) Calcitonin gene-related peptide receptor antagonist human CGRP-[8-371. Am. J. Physiol. 256, E331-E335.
1992 Elsevier
Science Publishers
31-44
B.V. All rights reserved
37
0168-8227/92/$05.00
DIABET 00574
Molecular biology of islet amyloid polypeptide Masahiro
Nishi ‘, Tokio Sanke ‘, Shinya Ohagi ‘, Kunihiro Ekawa ‘, Hisao Wakasaki ‘, Kishio Nanjo ‘, Graeme I. Bell2 and Donald F. Steiner2
’ The First Department of Medicine, Wakayama University of Medical Science, Wakayama. Japan and ‘Department of Biochemistry and Molecular Biology and Howard Hughes Medical Institute, University of Chicago. Chicago, Illinois, U.S.A.
Summary We investigated the relationship between non-insulin-dependent diabetes mellitus (NIDDM) and islet amyloid polypeptide (IAPP) gene by restriction fragment length polymorphism (RFLP) and polymerase chain reaction (PCR)-direct sequencing analysis. Endonuclease BglII and/or PvuII RFLP analysis revealed no positive correlation of IAPP gene with NIDDM. In PCR-direct sequencing of 25 NIDDM patients, no nucleotide sequence differences were found. These data do not support the view that IAPP plays an important role in the pathogenesis of NIDDM. cDNAs encoding cat, rat, mouse, guinea pig and degu IAPP precursors were also cloned, and comparison of these predicted amino acid sequences clarified the species difference, especially between amyloid-forming and non-amyloid-forming species. Amino acid residues 25-28 of mature IAPP might be responsible for their amyloidogeneity. The alternative splicing transcripts of guinea pig IAPP gene were identified by using PCR. If these types of transcripts are translated, N-terminal mutated IAPP might be produced and act as an antagonist. The signal peptide cleavage site of rat IAPP precursor was also identified by an in vitro translation and processing system. Key words: Islet amyloid polypeptide; Restriction fragment reaction; Alternative splicing; Signal peptide
Introduction Islet amyloidosis is an old and new subject of diabetic research. Since the report of Opie in 190 1 [ 11, islet amyloidosis has been one of the most characteristic morphological features of the islets of patients with non-insulin-dependent diabetes mellitus (NIDDM), although it was not until 1986 Correspondence to: M. Nishi, The First Dept. of Medicine, Wakayama University of Medical Science, 27 Nanaban-cho, Wakayama 640, Japan.
length polymorphism;
Polymerase
chain
[ 21 and 1987 [ 31 that the isolation of islet amyloid fibril protein, islet amyloid polypeptide (IAPP) or amylin, was done. Since that time, the new era of research of islet amyloidosis has come. Determination of the amino acid sequence of IAPP revealed its unexpected similarity to calcitonin gene-related peptide (CGRP). The cloning of cDNA [4] and gene [ 51 encoding human IAPP gave us the useful molecular biological tool to investigate the possible significance of IAPP in the pathogenesis and/or development of NIDDM. Using cDNA as a probe, the
38
linkage of the IAPP gene and NIDDM was investigated by restriction fragment length polymorphism (RFLP) analysis. In other amyloidoses, it was demonstrated that the mutant form of fibril protein, such as transthyretin in familial amyloidotic polyneuropathy, could contribute to form amyloid deposits [6]. The possible mutation or variation of IAPP gene in NIDDM are also investigated by polymerase chain reaction (PCR)direct sequencing analysis. The mechanism of amyloid deposition of IAPP is still unknown, and there exists a species difference in islet amyloidosis. In humans, cats and a few other species, islet amyloid depositions were reported, although in rodents other than degu, no reports of islet amyloid were made (in the case of degu, its amyloid consists of insulin [7]). The primary structure of IAPP in each species may explain this difference. To answer this question, we cloned cDNAs encoding cat, rat, mouse, guinea pig, and degu IAPP precursors. The calcitonin/CGRP1 gene produces two products, calcitonin and CGRP, by alternative splicing. The IAPP gene might also produce other products by alternative splicing because of its evolutionary relationship with the CGRP gene [5]. We have identified an alternative splicing product of guinea pig IAPP gene by PCR. IAPP precursor contains hydrophobic amino
Exon
1
PCR Sequence
-
RFLP and PCR-direct human IAPP gene
analysis
C_)
fB fB
of
Genomic DNA extracted from peripheral leukocytes was digested by 14 restriction enzymes and analyzed by Southern blot hybridization using nick-translated human IAPP cDNA as a probe. In vitro amplification of exon 2 and 3 of the human IAPP gene were carried out by PCR using oligonucleotide primers as shown in Fig. 1. PCRdirect sequencing was done as described [8]. cDNA cloning of mammalian IAPP precursors
The nucleotide and predicted amino acid sequences of cDNAs encoding cat, rat, mouse, guinea pig and degu IAPP precursors were obtained by combination of amplification of homologous DNA fragments (AHF) and rapid amplification of cDNA ends (RACE). AHF was carried out by PCR using oligonucleotide primers A and
1 kb
100 bp
A_)
representation
sequencing
3
5'-TCAGATTGCTTAGAGAAGGA-3' 5'-ACATCAATTAGAACTGTAAG-3' 5'-ATATTCACACTGGAGATGAA-3' 5'-CAGGAAATCACTAGAACATA-3'
Fig. 1. Schematic
Material and Methods
2
Oligonucleotide A C E G
acid segments at its amino-terminal end. It was thought to be a signal peptide, although its cleavage site had not yet been identified. Using an in vitro translation and processing system, we have identified the signal peptide cleavage site of rat IAPP precursor.
D+ F+
fE fG
primers B - 5'-GGCTGTAGTTATTTGACAGT-3' D - 5'-ATCTCAGCCATCTAGGTGTT-3' F - 5'-TCACATGGCTGGATCCAGCT-3'
of the human IAPP gene. The primers used for PCR and/or DNA sequencing
are noted.
39
B (Table 1). PCR reaction products were analyzed by the gel. Predicted 119 bp DNA fragments were eluted from the gel, subcloned and sequenced. The RACE protocol was carried out as described [9]. The RACE reaction products were subcloned into the HincII site of pGEM4Z, identified by colony hybridization and sequenced.
fied by HPLC degradation.
Alternative splicing of guinea pig IAPP gene
Among 14 restriction enzymes used, RFLP was identified in BglII (9 kb and 7 kb) and PvuII (21 kb and 17 kb) (Fig. 2). In our analysis, the allele of BglII 9 kb always coexisted with PvuII 18 kb and BglII 7 kb coexisted with PvuII 21 kb. The frequencies of each of the alleles in healthy controls and patients with NIDDM showed no significant difference (Table 2). In PCR-direct sequencing analysis, coding regions of exon 2 and 3 of human IAPP genes were amplified and sequenced. The sequences of 25 patients with NIDDM were identical to one another and to the sequence of the cloned gene.
RFLP and PCR-direct man IAPP gene
Signal peptide cleavage site of rat IAPP precursor
The cDNA for rat IAPP precursor was subcloned into pSP64T [lo]. The plasmid thus constructed (pSPRIAP) was linearized by XbaI and used for mRNA synthesis. mRNA synthesis was carried out using the mCAP kit (Stratagene) and SP6 RNA polymerase. In vitro translation and processing was carried out using rabbit reticulocyte lysate and canine pancreatic microsomal membrane (Promega Co., Madison, WI, U.S.A.) following the manufacturer’s instructions, except for using [ ‘H]Val instead of [ 3H]Leu. Five microliter of each reaction was analyzed onto 17.5% SDSpolyacrylamide gel electrophoresis and followed by autoradiography. Putative proIAPP was puri-
cDNA cloning of mammalian IAPP precursors
Primers for AHF
Primer A
CYS TGC
3 Asn AAC
4 Thr ACT
Primer B
34 Ser 3’-AGG
35 Asn TTA
36 Thr TGT
Amino acid numbering
2
5 Ala GCC
6 Thr ACA
CYs TGY
37
38
39
40
Try ATA
Gly CCG
Lys TTC
Arg GC-5 ’
is relative to the N-terminus
sequencing analysis qf hu-
The nucleotide sequences of cat, rat, mouse, guinea pig and degu IAPP precursors were obtained by the combination of AHF and RACE. A comparison of the amino acid sequences of six mammals is shown in Fig. 3. Mammalian IAPP precursors have similar structural organization to that of the human. Each has four domains: a signal peptide, N-terminal propeptide, IAPP and C-terminal propeptide. The IAPP domain of each precursor is flanked by Lys-Arg and Gly-
TABLE 1
1
by Edman
Results
cDNAs synthesized from total RNAs of human islets, human insulinoma, cat, rat, mouse, guinea pig and degu pancreas were amplified by PCR using oligonucleotide primers corresponding to 5 ’ - and 3 ‘-untranslated region of each IAPP precursor. PCR products were analyzed by agarose gel electrophoresis, subcloned into pGEM4Z and sequenced.
Lys 5’-AAG
and microsequenced
7
of mature IAPP.
8 Ala GC-3’
Fig. 2. RFLP analysis of human IAPP genes. Ten micrograms of genomic DNAs are digested by BglII or PvuII, electrophoresed, blotted, and hybridized with nick-translated human IAPP cDNA. Fragment sizes are indicated.
TABLE 2 Frequencies
of haplotypes
and alleles of PvuII or BglII RFLPs at human IAPP locus in normals and NIDDM Haplotype
patients
Allele
PVUII BgZII
21 kb/21 kb I kb/l kb
21 kbjl8 kb I kb/9 kb
18 kb/lS kb 9 kb/9 kb
21 kb I kb
18 kb 9 kb
Normal (n = 54) NIDDM (n = 50)
52% (28/54) 56% (28/50)
35% (19/54) 32% (16/50)
13% (7/54) 12% (6/50)
69% 72%
31% 28%
Lys(Arg)-Arg, suggesting that the mature IAPPs of these animals are also generated by proteolytic processing and C-terminally amidated. The size of each of the precursors differed slightly, being
89-amino acid residues in human and cat, 93 residues in rat and mouse, 92 residues in guinea pig and 91 residues in degu. The predicted amino acid sequence identities between the IAPP
41 N-Terminal
Propeptlde
Signal Peptlde
I*l*t
Alyloid
Polypaptida
C-Termin.3, prOpeF:l'??
IPIES:::HQVEKR KCWTAWWQRuwrLWXS sHHK;uLSS~sH1Y GKFWAVEVLKREPLNYLPL I@91 ,891 -----::: N____- -___----_---____IR----L-_-___-p--_-____ ___ST_DI-N___-__-_F
Human MGILKLQVFLIVLSVALNHLKA cat -CL---p_V____L___H---Rat MRC-SR-PAV-LI-----G--RM0"s.e M-C-S--PAV-LI----S---RGuinea Pig -CL-R-p_T_L__C____E__0. degus -CL-Q-P_V_LL_FA___T___
__,,G_G,.NP--D-- ------------_____~____L-PV-PP-_________ ____“A_~PN__~_~~_~_ __-_-AGDpN__S_DF_)N __“R_GSNP_MD-- __-_-_-_---_-----R-___L-PV-PP-__---____
Flbrli-fCrPL?g regxr
Fig. 3. Comparison
domains
of
5 mammals
and
(93,
,931 _S_A_DTG___G__ ___-_-----_-Y----R--8-L_-A-Lp-D---___ _____p*ISD-_L_H____ (92, ___A-fJTD_R-D-- --_----_---_~____~__~_~__~-pp_~______ _R___Q_“c~~_t_H__-_ ,g;,
of amino acid sequences
human
IAPP were 89% (cat), 84% (rat and mouse) and 78 % (guinea pig and degu).
Alternative splicing of guinea pig IAPP gene
The gel analysis of PCR products of guinea pig IAPP transcripts showed two major products (A and B in Fig. 4). Sequencing analysis revealed that A was consistent with the normal transcripts and that B was a truncated form of the IAPP precursor, which deleted 87 nucleotides. The 5’-end of this deletion corresponds to the exon
rres:ci>es
of six mammalian
23-Zil
IAPP precursors.
2/intron 2 junction of the human gene and the 3’-end is suitable for the consensus sequence of the splice acceptor site, suggesting that this transcript was produced by alternative splicing (Fig. 5). From the other species, however, we could not find this type of alternatively spliced transcript. Signal peptide cleavage site of rat IAPP precursor
The autoradiograph of in vitro translated and processed products of rat IAPP precursor separated by 17.5% SDS-PAGE is shown in Fig. 6. The
bP 13531078872-
603-
310281Fig. 4. The gel analysis of mammalian
IAPP gene transcripts amplified by PCR. Two major guinea pig IAPP gene transcripts amplified by PCR are indicated as A and B.
42
ACATTAAAAGGACTGATTTATTCTTCTCAGAAAATCTGAGAAGCA ~________________________-_-___________-_-...
A B
-22 Met ATG ___
Signal Peptide Cys Leu Leu Arg Leu Pro Val Thr TGC CTC CTT AGG CTG CCA GTA ACG --- -__ ___ _-- .._ _-___
-10 -1 Leu Leu Val Leu Cys Val Ala Leu Am Glu Leu Lys Ala CTC CTT GTG CTC TGT GTT GCA CTA AAC GAA CTG AAA 'XT .. . ... -__ __- -__ ___ ___ ___ ___ _-- -.. .__ ---
N-propeptide Thr Ser Ile Ala Ser Asp Thr ACA TCC ATT GCA AGT GAG ACC --_ ___ _-- --_ __d-
B
10 IAPP 20 Gly His Gln Val Gly Lys Arg Lys Cys Am Thr Ala Thr Cys Ala Thr Gln Arg Leu Thr GGC CAT CAG GTG GGC AA.4 CGA AAG TGC AAC ACT GCC ACG TGT GCG ACA CAA CCC CTG ACA 87 bp deletion
A B
30 40 Am Phe Leu Val Arg Ser Ser His Am Leu Gly Ala Ala Leu Leu Pro Thr Asp Val Gly AAT TTT TTG GTT CGT TCC AGC CAC AAC CTT GGC GCT GCT CTC CTG CCT ACT CAT GTG GGA _ _.. _.. _.. .._ __. ___ ___ .. . ___
A B
50 C-propeptide 60 Ser Am Thr Tyr Gly Lys Arg Asn Ala Pro Gln Ile Ser Asp Arg Glu Leu Leu His Tyr TCC UT ACA TAT GGC AAG AGG AAC GCA CCT CAG ATT TCA GAG AGA GAA CTC CTA CAT TAT _.. __. ._. __. ___ .._ ___ .__ _.. .._ ___ __. _.. ._. _.. .__
A B
70 Leu Pro Leu End CTA CCC CTA TAG AGGTCCACATCCCTTTATAGCTCTCATTTCATGTATTCGCTGATGATTTCCTGTACACATC~ . .. ... ._. ____....____....______________.._...___________.____..~.~~......
A B
CAGTGCCTCTTTCATTTGTAGTGTG ... . ......_......____.___
A
Fig. 5. The nucleotide sequences ofguinea pig IAPP PCR products A and B. The region corresponding to oligonucleotide primers used for PCR are underlined. Dashes indicate same nucleotides as fragments A. The 87 bp deletion of fragment B is indicated by horizontal arrows.
amount of processed products (proIAPP) were increasing according to the amount of added canine pancreatic membrane. ProIAPP purified by HPLC was microsequenced by Edman de-
gradation. The radioactivity of the degraded amino acids of each cycle revealed that the 3rd and the 1 lth amino acids from the signal peptide cleavage site are valine (Fig. 7). This result, thereWil-Val
dpm
- 12.5K Prepro Pro
IAPPl lAPP’-
-
6 5K
-
3.4K
&?
II .
..I
,.“...L
11121314151817181920 2122232425 RNA
Memb
-
+
+
+
+
0
0
0.5
1 0
1.5
+
20
Fig. 6. In vitro translation and processing of rat IAPP precursor mRNA. Prepro- or proIAPP are indicated. The sizes of molecular weight markers (30 K-3.4 K) are indicated.
Cycles Fig. 7. The microsequencing of purified ProIAPP. ProIAPP labeled by [3H]Val is purified by HPLC and microsequenced by Edman degradation. The radioactivity of degraded amino acids of each of the cycles is counted.
43 fore, indicates that the signal peptide cleavage site of rat IAPP precursor is located between the 23rd residue alanine and the 24th residue threonine.
Discussion The cloning of mammalian IAPP cDNAs indicated that IAPP was derived from 84-93 amino acid precursors by proteolytic processing and that its C-terminal was amidated. The amino acid conservation among mammalian IAPPs suggests some of its physiological functions. There have been several reports about the actions of IAPP [ 1 l-151, although at present its real physiological functions are still unknown. Among various IAPP molecules, N- and C-terminal regions are well conserved, although the middle part of IAPP has considerable species variations. It is interesting that the 25-28 amino acid residues of IAPP of the amyloid-forming species (human and cat) are Ala-Ile-Leu-Ser and that those of the non-amyloid-forming species (rat, mouse, and guinea pig) are not. This fact suggests that the 25-28 amino acid residues of IAPP may influence its amyloidogeneity and explain the species difference of islet amyloid deposition. The presence of a signal peptide-like hydrophobic amino acid sequence in its N-terminal end implies that IAPP is a secreted peptide, and the secretion of IAPP has already been demonstrated [ 161. The cleavage of this hydrophobic sequence by canine microsomal membrane also demonstrated that it was really a signal peptide and the determination of the signal peptide cleavage site showed us the exact N-terminal end of the proIAPP. IAPP is structurally related to CGRP. Since the calcitonin/CGRP-1 gene produces 2 products by alternative splicing and the CGRP-2 gene also contains a calcitonin-like sequence in its intron, the IAPP gene might thus possibly produce products other than IAPP by alternative splicing. PCR analysis of mammalian IAPP gene transcripts found a guinea pig IAPP gene alternative splicing product. If this transcript is translated, N-terminal mutated IAPP may be produced. In
the case of CGRP, the N-terminal deleted one (CGRP8-37) acts as an antagonist [ 171. Therefore, this alternative splicing product of guinea pig IAPP gene may also act as an IAPP antagonist, and play a role in regulating IAPP actions. The PCR-direct sequencing analysis of the protein coding region of IAPP genes of 25 patients with NIDDM found no mutations, and this suggests that the structural abnormality of IAPP or its precursor is unlikely to play a significant role in the formation of amyloid deposition. Whether IAPP or islet amyloid deposition is a significant factor in the pathogenesis of NIDDM is an important question. RFLP analysis of the IAPP gene showed no significant correlation with NIDDM, and the PCR-direct sequencing analysis of human IAPP genes of 25 patients with NIDDM also detected no mutations. These results do not support the views that IAPP is a significant factor in the pathogenesis of NIDDM and that structurally abnormal IAPP or its precursor may lead to amyloid depositions, although further work about IAPP gene expression, its processing and its physiological roles will be necessary.
Acknowledgements This work was supported by National Institutes of Health Grants DK13914 and DK20595, Howard Hughes Medical Institute, and Grant-in Aid for Scientific Research (No. 01480294) from the Ministry of Education, Science and Culture of Japan.
References Opie, E. (1901) The relation ofdiabetes mellitus to lesions of the pancreas: hyaline degeneration of the islands of Langerhans. J. Exp. Med. 5, 527-540. Westermark, P., Wernstedt, C., Wilander, E. and Sletten, K. (1986) A novel peptide in the calcitonin gene related peptide family as an amyloid fibril protein in the endocrine pancreas. Biochem. Biophys. Res. Commun. 140, 827-831.
44 3 Clark, A., Lewis, C.E., Willis, AC. et al. (1987) Islet amyloid formed from diabetes-associated peptide may be pathogenic in type-2 diabetes. Lancet ii, 231-234. 4 Sanke, T., Bell, G.I., Sample, C., Rubenstein, AC. and Steiner, D.F. (1988) An islet amyloid peptide is derived from an 89-amino acid precursor by proteolytic processing. J. Biol. Chem. 262, 17243-17246. 5 Nishi, M., Sanke, T., Seino, S. et al. (1989) Human islet amyloid polypeptide gene: complete nucleotide sequence, chromosomal localization, and evolutionary history. Mol. Endocrinol. 3, 1775-1781. 6 Pepys, M.B. (1988) Amyloidosis: some recent developments. Q.J. Med. 76, 283-298. 7 Hellman, U., Wernstedt, C., Westermark, P., O’Brien, T.D., Rathbun, W.B. and Johnson, K.H. (1990) Amino acid sequence from degu islet amyloid-derived insulin shows unique sequence characteristics. Biochem. Biophys. Res. Commun. 169, 571-577. 8 Kadowaki, T., Kadowaki, H. and Taylor, S.I. (1990) A nonsense mutation causing decreased levels of insulin receptor mRNA: detection by a simplified technique for direct sequencing of genomic DNA amplified by the polymerase chain reaction. Proc. Natl. Acad. Sci. U.S.A. 87, 658-662. 9 Frohman, M.A., Dush, M.K. and Martin, G.R. (1988) Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc. Natl. Acad. Sci. U.S.A. 85, 8998-9002. 10 Krieg, P.A. and Melton, D.A. (1984) Functional messen-
11
12
13
14
15
16
17
ger RNAs are produced by SP6 in vitro transcription of cloned cDNAs. Nucleic Acids Res. 12, 7057-7070. Cooper, G.J.S., Leighton, B., Dimitriadis, G.D. et al. (1988) Amylin found in amyloid deposits in human type 2 diabetes mellitus may be a hormone that regulates glycogen metabolism in skeletal muscle. Proc. Natl. Acad. Sci. U.S.A. 85, 7763-7766. Datta, H.K., Zaidi, M., Wimalawansa, S.J. et al. (1989) In vivo and in vitro effects of amylin and amylin-amide on calcium metabolism in the rat and rabbit. Biochem. Biophys. Res. Commun. 162, 876-881. Brain, S.D., Wimalawansa, S., MacIntyre, I. and Williams, T.J. (1990) The demonstration of vasodilator activity of pancreatic amylin amide in the rabbit. Am. J. Pathol. 136, 487-490. Ohsawa, H., Kanatsuka, A., Yamaguchi, T., Makino, H. and Yoshida, S. (1989) Islet amyloid polypeptide inhibits glucose-stimulated insulin secretion from isolated rat pancreatic islets. Biochem. Biophys. Res. Commun. 160, 961-967. Sowa, R., Sanke, T., Hirayama, J. et al. (1990) Islet amyloid polypeptide amide causes peripheral insulin resistance in vivo. Diabetologia 33, 118-120. Kanatsuka, A., Makino, H., Ohsawa, H. et al. (1989) Secretion of islet amyloid polypeptide in response to glucose. FEBS Lett. 259, 199-201. Chiba, T., Yamaguchi, A., Yamatani, T. et al. (1989) Calcitonin gene-related peptide receptor antagonist human CGRP-[8-371. Am. J. Physiol. 256, E331-E335.
