Comparative Biochemistry and Physiology, Part B 177–178 (2014) 10–20

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part B journal homepage: www.elsevier.com/locate/cbpb

Molecular and acute temperature stress response characterizations of caspase-8 gene in two mussels, Mytilus coruscus and Mytilus galloprovincialis Duo Zhang, Hong-Wei Wang, Cui-Luan Yao ⁎ Key Laboratory of Healthy Mariculture for East China Sea, Ministry of Agriculture of the P.R.C, Fisheries College, Jimei University, Xiamen 361021, China

a r t i c l e

i n f o

Article history: Received 7 May 2014 Received in revised form 4 August 2014 Accepted 11 August 2014 Available online 20 August 2014 Keywords: Caspase-8 Mytilus Temperature stress

a b s t r a c t The caspase family represents aspartate-specific cysteine proteases that play key roles in initiation of apoptosis in various cells response to environmental stress. In this study, two caspase-8 cDNA sequences were cloned from two Mytilus mussels, Mytilus coruscus (Mccaspase-8) and Mytilus galloprovincialis (Mgcaspase-8), respectively. The full-length cDNA of Mccaspase-8 was 1884 bp, including a 5′-terminal untranslated region (UTR) of 140 bp, a 3′-terminal UTR of 238 bp and an open reading frame (ORF) of 1506 bp encoding a polypeptide of 501 amino acids. The 1775 bp full-length Mg caspase-8 cDNA sequence contained an ORF of 1488 bp encoding a polypeptide of 495 amino acid residues, a 5′-UTR of 51 bp and a 3′-UTR of 236 bp. Both the Mccaspase-8 and Mgcaspase-8 amino acid sequences contained two highly conservative death effector domains (DEDs) at N-terminal, the caspase family domains P20 and P10 and the caspase family cysteine active site ‘KPKLFFIQACQG’. Phylogenetic analysis revealed that Mccaspase-8 and Mgcaspase-8 were clustered with the caspase-8 from other organisms, with the close relationship with caspase-8 from mollusk. Quantitative real-time reverse transcription PCR (qRT-PCR) analysis indicated that the predominant transcripts of Mccaspase-8 were in mantle and gonad tissue of M. coruscus and the high expression levels of Mgcaspase-8 were in digestive gland and gill tissue of M. galloprovincialis, respectively. The impacts of temperature stress on Mccaspase-8 and Mgcaspase-8 expressions were tested in gill tissue and hemocytes of both species. Our results showed that both Mccaspase-8 and Mgcaspase-8 transcripts and caspase-8 activity in gill tissue and hemocytes could be induced significantly after cold and heat stress (p b 0.05) and that these responses different between tissues and species. These results suggested that caspase-8 might play an important role in response to temperature stress and in determining cellular thermal tolerance limits in M. coruscus and M. galloprovincialis. © 2014 Elsevier Inc. All rights reserved.

1. Introduction Caspases are a family of cysteinyl-dependent aspartate-directed proteases that can cleave their substrates following an Asp residue, and play crucial roles in cell apoptosis (Thornberry and Lazebnik, 1998; Grütter, 2000; Boatright and Salvesen, 2003). In mammals, more than ten caspase genes have been identified and well characterized, which are essential for maintaining homeostasis in various physiological processes through regulating cell survive and cell death (Danial and Korsmeyer, 2004; Elmore, 2007). According to their known roles in apoptosis, caspase family proteases can be classified into initiator caspases (including caspase-2, -8, -9 and -10) and executioner caspases (including caspase-3, caspase-6 and caspase-7) (Lawen, 2003). After detecting death-inducing signal, initiator caspases are activated and then transmit the apoptotic signal to downstream executioner caspases (Cohen, 1997; Philchenkov, 2004). ⁎ Corresponding author. E-mail address: [email protected] (C.-L. Yao).

http://dx.doi.org/10.1016/j.cbpb.2014.08.002 1096-4959/© 2014 Elsevier Inc. All rights reserved.

Caspase-8 is a well-known initiator caspase that plays crucial roles in various apoptotic pathways (Crowder and El-Deiry, 2012). Generally, the typical caspase-8 contains several main conservative structures including two death effector domains (DEDs) at N-terminal (Fan et al., 2005), P20 large subunit that contains the caspase family cysteine active site and P10 small subunit (Boldin et al., 1996; Muzio et al., 1996; Nakajima et al., 2000; Elmore, 2007). Till to the present study, caspase-8-like genes have been identified from several mollusk species, including disk abalone Haliotis discus discus (Lee et al., 2011), Mediterranean mussel Mytilus galloprovincialis (Romero et al., 2011) and Hong Kong oyster Crassostrea hongkongensis (Xiang et al., 2013). The typical mammalian caspase domains including P20 subunit, P10 subunit, and cysteine active sites were identified in most molluscan caspase-8 (Huang et al., 2010; Lee et al., 2011; Romero et al., 2011; Dickens et al., 2012). However, another conservative structural feature of caspase-8, two N-terminal DEDs essential for recruitment and activation in mammalian caspase-8, was identified in caspase-8 from disk abalone (Lee et al., 2011) but lacked in caspase-8 from M. galloprovincialis and another initiator caspase from abalone

D. Zhang et al. / Comparative Biochemistry and Physiology, Part B 177–178 (2014) 10–20

Haliotis diversicolor (Huang et al., 2010; Romero et al., 2011). Also, most molluscan caspase-8 showed low identity with other invertebrate and vertebrate caspase-8 (Lee et al., 2011; Romero et al., 2011; Xiang et al., 2013). Therefore, the molecular characterizations of caspase-8 in mollusk need to be better understood. Some previous studies demonstrated that molluscan caspase-8 could be triggered by pathogenic infection (Lee et al., 2011; Romero et al., 2011; Xiang et al., 2013), UV light stress, and chemical exposure (Romero et al., 2011), indicating that caspase-8 might play important roles in many important biological events. Also, severe DNA damage, the well known executioner caspase-3 expression levels and apoptosis were induced after thermal stress and heavy metal ion stress (Kefaloyianni et al., 2005; Lockwood et al., 2010; Yao and Somero, 2012), which demonstrated that DNA damage and apoptotic related factors played a crucial role in stress response. Temperature plays an important role in setting limits to the geographic distributions of marine mussels and inducing many physiological responses (Somero, 2010; Yao and Somero, 2014). Due to ecological dominant in the intertidal zone as well as their sessile life, marine mussels of the genus Mytilus have been excellent research animal for many experimental studies. M. galloprovincialis had successfully invaded many coastal marine habitats in Africa, North America, and Asia from their original habitat Mediterranean Sea (Seed, 1992). Previous comparative physiological studies in Mytilus species have shown the invasive species M. galloprovincialis to be more heat tolerant than the native blue mussel, Mytilus trossulus in California (Seed, 1992; Braby and Somero, 2006; Lockwood et al., 2010; Somero, 2010; Tomanek and Zuzow, 2010; Somero, 2011). Mytilus coruscus is a native dominant mussel species and widely distributed in west margins of Pacific Ocean, including the coast of China, Japan and Korea (Wang, 1997). In China, Both M. galloprovincialis and M. coruscus are maricultured species (Chang and Wu, 2007; Qi et al., 2014). Generally, M. galloprovincialis is mainly cultured in some seashore from Bohai Sea to Yellow sea (35°00′–41°00′N, 117°35′–123°00′E, average temperature, 11–19 °C, monthly sea surface temperature, 0–26 °C, salinity 28–32‰) (Tang et al., 1989). Whereas M. coruscus is mainly cultured in some sea shore of East Sea (23°30′N–33°04′N, 117°00′–131°00′E, average temperature 22–24 °C, monthly sea surface temperature, 8–30 °C, salinity 26–34‰) (Wu et al., 2011; Ye et al., 2012). However, in recent years, some researchers have tried to culture M. galloprovincialis at the coast of East China Sea, which shares the same habitat with the M. coruscus. Our data showed that DNA damage, cell death, and many apoptotic related factors may be important during the two mussel species response to temperature stress (unpublished data). However, as one of the crucial initiator caspases, the knowledge on caspase-8 and its role in response to temperature stress in M. coruscus and M. galloprovincialis are poorly understood. In the present study, the full-length cDNA sequences of caspase-8 were cloned from M. coruscus and M. galloprovincialis, the temporal mRNA expression levels and the enzyme activities of caspase-8 after high and low temperature stress were examined and compared in order to better understand the potential role of caspase-8 in the response of mussels to temperature stress.

2. Materials and methods 2.1. Animal collection M. coruscus and M. galloprovincialis were collected from Ningde, Fujian province, China (26°59′N, 120°40′E) and Qingdao, China (36°03′N, 120°18′E), respectively. Mussels (averaging 6 ± 1 cm) were shipped to Jimei University (Xiamen) for one month acclimation at 15 °C and a salinity of 32 ppt in circulating seawater tanks and fed a phytoplankton diet every day before experiment.

11

Hemolymph (1.2 mL per mussel) was collected from the posterior adductor muscle with a 20-gauge needle and 2 mL disposable syringe and containing 0.4 mL of anti-coagulant modified Alsever’s solution (27 mM sodium citrate, 115 mM glucose, 336 mM NaCl, 18 mM EDTA, pH 7.0) (Li et al., 2009) according to our previous research (Yao and Somero, 2012). Hemolymph from 6 mussels were pooled and mixed together. The hemocytes were collected by 5 min centrifugation at 1500 g, 4 °C and then re-suspended and washed by using 50 mM PBS and collected at the same condition. Then the hemocytes were frozen in liquid nitrogen immediately and stored at −80 °C. Other tissues including gill, mantle, gonad, digestive gland and muscle were dissected out, then frozen and stored at the same condition for RNA extraction. 2.2. Temperature stress Cold stress was carried out by ramp decreasing the temperature from 15 °C to 6 °C or 2 °C in 5 h. Heat stress was performed by ramp increasing the seawater temperature from 15 °C to 28 °C or 32 °C in 5 h as above. Mussels were maintained at the corresponding low temperature of 2 °C, 6 °C or high temperature 28 °C or 32 °C for 2 h, respectively. And then the temperature was returned from the stress temperature to 15 °C and the animals were kept at 15 °C for a 24 h recovery. Control animals were simultaneously transferred to a separate tank that remained at 15 °C. Hemocytes and gill tissues from the treatment animals were collected at 2 h after temperature stress and 24 h recovery at 15 °C, respectively. Control animals were sampled at the same time point with the treatment groups. Only the survived mussels were used in the experiment. A total of eighteen mussels were used at a time-point (3 independent groups, n = 3 measurements per pooled sample from 6 animals) as our previously report (Yao and Somero, 2012). 2.3. RNA extraction and cDNA synthesis Total RNA was extracted from hemocytes, gill, mantle, gonad, digestive gland and muscle tissues with Trizol reagent (Invitrogen, USA) following the manufacturer's introduction. Total RNA was incubated with RNase-free DNase I (Roche, USA) to remove the contaminating genomic DNA. First strand cDNA was synthesized from 2 μg of total RNA by revertAid™ M-MuLV reverse transcriptase (Fermentas, Canada) following the manufacturer's protocol with oligo d(T)18. 2.4. Determination of Mccaspase-8 and Mgcaspase-8 cDNA sequence To obtain M. coruscus caspase-8 (Mccaspase-8) and M. galloprovincialis caspase-8 (Mgcaspase-8) cDNA, two primers casp-8 F1 and casp-8 R1 (Table 1) were designed based on the highly conserved nucleotide sequence of caspase-8 from Mytilus californianus to clone the homologous fragment of Mccaspase-8 and Mgcaspase-8, and cDNA synthesized using RNA extracted from gill tissues of M. coruscus or M. galloprovincialis as template, respectively. For Mccaspase-8, polymerase chain reaction (PCR) was performed using primers casp-8 F1 and casp-8 R1 with annealing temperature at 50 °C. Based on the obtained sequence, the 3′ ends were obtained by RACE PCR approaches with gene-specific primers Mccasp-8 3-F1 and Mccasp-8 3-F2 and adaptor primers AOLP and AP (Table 1). For the 5′ end, the cDNA was prepared using the SMART race Amplification kit (Clontech). PCR amplification was carried out with gene-specific primer Mccasp-8 5-R1, Mccasp-8 5-R2 and Mccasp-8 5-R3 and adapter primer AAP and AP with the same annealing temperature of 52 °C. For Mgcaspase-8, the homologous fragment was obtained by a nested PCR. The first round PCR was performed using casp-8 F1 and casp-8 R1 as described above, and then the nested PCR was then performed using primers casp-8 F2 and casp-8 R2 under the same conditions. Similarly, the 3′ end RACE PCR of Mgcaspase-8 was performed using Mgcasp 3-F1 and Mgcasp 3-R1 with annealing temperature of

12

D. Zhang et al. / Comparative Biochemistry and Physiology, Part B 177–178 (2014) 10–20

Table 1 Sequence and experimental conditions for primers used in the present study. Primers

Sequences(5′-3′)

Annealing temperature (°C)

casp-8 F1 casp-8 R1 casp-8 F2 casp-8 R2 Mccasp-8 5-R1 Mccasp-8 5-R2 Mccasp-8 5-R3 Mccasp-8 3-F1 Mccasp-8 3-F2 Mgcasp-8 5-R1 Mgcasp-8 5-R2 Mgcasp-8 3-F1 Mgcasp-8 3-F2 Mgcasp-8 5-F1 Mgcasp-8 3-R1 18S real F

AATGAGAGCGAGAGAAGG GAGTTGTTTCCGCAGTGT CGACTGGTTCAAGGAGAT CGGGAATCACTTTCTGGT CCATCATTACACCAGCCA CCCTTCTCTCGCTCTCAT AAGTCTCCTCTGTTCTCG CAGACTTTCTTCTTGGCTAT TGAATCACGATGTCTCAGAG CAAGCCTGAATGAAGAAT ATCGGAATAGGTTTGTCATC AGATGTTGCCCTCCTGTC GCGTCAGATAACCAGAAAG ATATGATGGCTTTAACCTGC GAGAGGGATGATACACTT CATTAGTCAAGAACGAAA GTCAGAG GCCTGCCGAGTCATTGAAG GGGACGACTGGTTCACGG CCGCGTCCGTCTCTTCTG AAGACAACTGGTTCACGG CTGCGTCCTTCTCTTCTG GGCCACGCGTCGACTAGT ACT(16) GGCCACGCGTCGACTAGT ACG(16) GGCCACGCGTCGACTAGTAC

53 53 53 53 53 55 53 53 55 49 53 55 54 53 51 60

18S real R Mccasp-8 real F Mccasp-8 real R Mgcasp-8 real F Mgcasp-8 real R AOLP AAP AP

60 60 60 60 60

Amplification efficiency

The protein domain features were predicted by PROSITE (http:// prosite.expasy.org/) and SMART (http://smart.embl-heidelberg.de/). A phylogenetic tree of caspase-8 was constructed by MEGA5.1 using the neighbor-joining method (http://www.megasoftware.net). The putative amino acid sequences of caspase-8 from invertebrates and vertebrates were used for analysis (Table 2). 2.6. Quantitative real-time PCR analysis of Mccaspase-8 and Mgcaspase-8

98.5%

97.8% 97.2%

50 °C, and then a semi-nested PCR was performed with Mgcasp 3-F2 and Mgcasp 3-R1 as above. The 5′ end amplification was performed using Mgcasp 5-F1 and Mgcasp 5-R1 with an annealing temperature of 46 °C. And then semi-nested PCR was conducted with Mgcasp 5-F1 and Mgcasp 5-R2 as above. The open reading frame (ORF) of Mccaspase-8 and Mgcaspase-8 was testified by using primers Mgcasp8 5-F1 and Mgcasp-8 3-R1 with an annealing temperature of 50 °C. All PCR products were gel-purified, cloned into pMD19-T vector (Takara, Dalian) and sequenced in Meiji Corp (Shanghai, China). The sequences of all primers are shown in Table 1. 2.5. Sequence analysis and construction of a phylogenetic tree The full-length cDNA sequences of Mccaspase-8 and Mgcaspase-8 were assembled using DNASTAR (DNASTAR Inc., Madison, WI, USA). Multiple alignments of Mccaspase-8 and Mgcaspase-8 amino acid sequences with other species were performed by the ClustalW (http:// www.ebi.ac.uk/clustalw/). The structure characterizations, isoelectric point (PI) and molecular weight (Mw) were analyzed and calculated by Expert Protein Analysis System (EXPASY) (http://www.expasy.org).

The constitutive expression levels of caspase-8 were evaluated in the gill, digestive gland, hemocytes, mantle, gonad and muscle tissues. Moreover changes in gene expression in gills and hemocytes were evaluated after temperature stress by qPCR; the samples were collected as described in 2.2. The reference gene 18S rRNA was used as internal control and the primers 18S real F and 18S real R were shown in Table 1 (Cubero-Leon et al., 2012). Total RNA was extracted from the various samples and the first-strand cDNA was synthesized using the same method as above. Real-time RT-PCR was carried out in an ABI 7500 Real-time Detection System (Applied Biosystems, USA) as our previous report (Yao and Somero, 2013). The amplification was performed in a total volume of 20 μL, containing 9 μL RealMasterMix SYBR Green (TIAN-GEN, Beijing), 1 μL of the diluted cDNA, 0.5 μL of each primer and 9 μL ddH2O. The qRT-PCR program was carried at 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s, 60 °C for 20 s, 68 °C for 35 s. Dissociation analysis of amplification products was performed at the end of each PCR to confirm that only one PCR product was amplified and detected. Only a single, sharply defined melting curve with a narrow peak was used for analysis. After the PCR program, data were analyzed with ABI 7500 SDS software (Applied Biosystems, USA). The comparative CT method (2−ΔΔCT method) was used to analyze the expression level of Mccaspase-8 and Mgcaspase-8 (Livak and Schmittgen, 2001). 2.7. Caspase-8 activity assay of M. coruscus and M. galloprovincialis Caspase-8 activity was detected in gill tissue and hemocytes using a Caspase-8 Activity Assay Kit (Beyotime, China, #C1151) according to the manufacturer's instruction. Caspase-8 activity was measured spectrophotometrically by detecting the formation of chromophore p-nitroaniline (pNA) from Ac-IETD-pNA. The total protein was extracted from gill tissue and hemocytes with lysis buffer at 4 °C for 15 min and centrifuged at 18,000 g at 4 °C for another 15 min. Then, the supernatant was incubated for 12 h at 37 °C with caspase assay buffer and the caspase-8 substrate, Ac-IETD-pNA (10 mM). Then reaction buffer was detected at 405 nm and one enzyme unit was defined as the amount of enzyme that cleaved 1.0 nmol of the colorimetric substrate Ac-IETD-pNA per hour at 37 °C under saturated

Table 2 Amino acid sequence similarity of Mccaspase-8 and Mgcaspase-8 with other invertebrates and vertebrates. 1 and 2 representing caspase-8 from M. galloprovincialis were obtained in this study and reported by Romero et al. (2011), respectively. Species

Gene

Genbank accession no.

M.co

M.ga1

M.ca

G.ga

H.sa

C.ho

M.mu

O.la

D.me

H.dis

H.div

M.ga2

M.coruscus M.galloprovincialis1 M.californianus G.gallus H.sapiens C.hongkongensis M.musculus O.latipes D.melanogaster H.discus discus H.diversicolor Mngalloprovinciali2

Caspase-8 Caspase-8 Caspase-8 Caspase-8 Caspase-8 Caspase-8 like Caspase-8 Caspase-8 DREDDδ Caspase-8 Caspase Caspase-8

KJ689446 KJ689445 ADB80147.1 NP_989923.1 AAD24962.1 AHB50667.1 AAH06737.1 NP_001098258.1 AAC33117.1 ADR78296.1 ABY87390.3 ADZ24779.1

100 89.5 87.8 45.9 45.6 44.7 44.5 43.3 37.6 37.0 35.7 33.3

100 81.7 44.6 45.5 44.6 44.7 44.8 37.4 35.9 31.8 32.4

100 45.9 45.9 47.5 44.6 44.2 36.1 40.3 28.8 34.4

100 71.9 45.2 69.0 50.8 37.0 39.8 33.7 36.0

100 46.3 77.9 51.9 39.5 41.2 34.1 35.8

100 45.6 46.2 35.4 42.6 28.4 30.9

100 53.0 38.8 39.6 33.9 36.3

100 36.5 40.6 34.2 38.7

100 29.1 25.8 30.1

100 22.9 27.4

100 34.4

100

D. Zhang et al. / Comparative Biochemistry and Physiology, Part B 177–178 (2014) 10–20

substrate concentrations. The caspase-8 activity was expressed as relative caspase-8 activity compared to control group. 2.8. Statistical analysis The data were analyzed by one-way ANOVA using SPSS 15.0 for Windows (SPSS Inc.). A multiple comparison (Duncan) test was performed to examine the significant differences between stress and control group. For statistically significant differences, it was required that p b 0.05. Results are presented as means ± S.D for three independent experiments. Different letters represent statistically significant differences between experimental treatments (high and low temperature stress for varying times) and the control (15 °C specimens) (n = 3). 3. Results 3.1. Characterization of the full-length Mccaspase-8 and Mgcaspase-8 cDNAs For Mccaspase-8, an 811-bp homologous cDNA fragment was obtained and had 95% identity with the caspase-8 from M. californianus. And a 243-bp fragment and two fragments of 277-bp and 675-bp were amplified by 3'-RACE PCR and 5'-RACE PCR, respectively. As a result, an 1884-bp nucleotide sequence representing the complete cDNA of Mccaspase-8 was obtained, which contained an initial start codon for Met and stop codon. Similarly, for Mgcaspase-8 cDNA, a 319-bp homologous fragment, a 535-bp 3'-RACE PCR product and a 941-bp 5'-RACE PCR product were obtained. As a result, a 1775-bp nucleotide sequence representing the full length cDNA of Mccaspase-8 was cloned. The complete cDNA sequence of Mccaspase-8 and Mgcaspase-8 were deposited in GenBank under accession numbers of KJ689446 and KJ689445. The 1884 bp full-length Mccaspase-8 cDNA sequence contains an ORF of 1506 bp encoding a polypeptide of 501 amino acid residues, a 5′-terminal untranslated region (UTR) of 140 bp and a 3′-UTR of 238 bp with a stop codon (TAA) (Fig. 1A). The 1775 bp fulllength Mgcaspase-8 cDNA sequence contains an ORF of 1488 bp encoding a polypeptide of 495 amino acid residues, a 5′-UTR of 51 bp and a 3′-UTR of 236 bp with a stop codon (TGA) (Fig. 1B). Multiple sequence alignments revealed that the putative amino acid sequences of Mccaspase-8 and Mgcaspase-8 shared 87.8% and 81.7% sequence similarity with caspase-8 from M. californianus (GenBank accession number: ADB80147.1), respectively. And Mccaspase-8 and Mgcaspase-8 shared 89.5% similarity with each other. Mccaspase-8 and Mgcaspase-8 shared approximately 40% similarity with caspase-8 from other vertebrates and invertebrates (Table 2). The theoretical molecular weight of Mccaspase-8 and Mgcaspase-8 was 56.18 kDa and 55.82 kDa, respectively. And the calculated PI of both Mccaspase-8 and Mgcaspase-8 was 5.50. Prediction of protein domains by PROSITE revealed that Mccaspase-8 has two highly conserved DEDs at amino acid positions between 7–85 and 103–184, respectively. In addition, the typical caspase domain P20 large subunit and P10 small subunit were identified at amino acid residues 211–361 and 406–497, respectively (Fig. 2A). In Mgcaspase-8, two DEDs were also identified at positions of 7–85 and 103–184 respectively. Also, P20 large subunit and P10 small subunit were predicted at amino acid residues 205–358 and 403–491 respectively (Fig. 2A). The conservative catalytic sites His317, Gly318 and Cys360 in P20 large subunit of mammalian caspase-8 were identified in P20 subunit at positions His286, Gly287, Cys357 in Mccaspase-8 and His280, Gly281, Cys354 in Mgcaspase-8, respectively (Fig. 2B). Also, the conservative caspase family cysteine active site (KPKLFFIQACQG) was predicted at 348–359 and 345–356 amino acid residues in Mccaspase-8 and Mgcaspase-8, respectively (Fig. 2B). Furthermore, the four crucial residues involved in forming a binding pocket with the specific peptide sequences P4-P3-P2-P1-P1′ in subtracts were also identified at positions Arg229 , Gln355 , Arg 430 ,

13

Ser436 and Arg223, Gln352, Arg427, Ser433 in Mccaspase8 and Mgcaspase8, respectively, with Ser replaced Thr419 in human caspase-8 (Fig. 2B).

3.2. Phylogenetic analysis of Mccaspase-8 and Mgcaspase-8 The phylogenetic relationship analysis results revealed that the putative amino acid sequences of caspase-8 from M. coruscus and M. galloprovincialis were clustered into the same subgroup with caspase-8 from other mollusks. And the closest phylogenetic relationship of Mccaspase-8 and Mgcaspase-8 were shown with caspase-8 from M. californianus. In addition, caspase-8 was clustered into the same subgroup with another initiator caspase-10. And executioner caspase family including caspase-6, -7, and -3 were clustered into another sub-group. However, Mccaspase-8 and Mgcaspase-8 showed very low phylogenetic relationship with DED-absent caspase from H. diversicolor (Fig. 3). 3.3. Tissue expression of Mccaspase-8 and Mgcaspase-8 The constitutive expression levels of Mccaspase-8 and Mgcaspase-8 in tissues were confirmed by qRT-PCR. Both them were broadly expressed in most tested tissues. The most predominant expression of Mccaspase-8 was detected in the mantle tissue, followed by gonad tissue and hemocytes. However, the strongest expression of Mgcaspase-8 was found in the digestive gland, followed by gill tissue and hemocytes (Fig. 4). 3.4. Expression profiles of Mccaspase-8 and Mgcaspase-8 in gill and hemocytes after temperature stress Expression profiles of Mccaspase-8 and Mgcaspase-8 in gill after different temperature stresses are shown in Fig. 5A and B, respectively. In M. coruscus, no significant difference of Mccaspase-8 expression levels was detected after low temperature stress at both 2 °C and 6 °C and 24 h recovery at 15 °C (Fig. 5A). At 28 °C, Mccaspase-8 transcripts showed a moderate increase after stress, and then it decreased after 24 h recovery; no significant different transcripts were found between stress and control group. At 32 °C, Mccaspase-8 transcripts increased significantly after 2 h stress (p b 0.05), with a peak value 2 times of the control group, then it returned to the control level after recovery. In M. galloprovincialis, Mgcaspase-8 transcripts did not change significantly after stress both at 2 °C and 6 °C. However, significant upregulation of Mgcaspase-8 transcripts was detected at 24 h recovery in 6 °C stressed group (p b 0.05). At 28 °C, Mgcaspase-8 expression levels did not show significant change after stress and recovery. However, Mgcaspase-8 increased significantly at 2 h (p b 0.05) after 32 °C stress, and the significant high expression levels maintained to 24 h after recovery (p b 0.05). Expression profiles of Mccaspase-8 and Mgcaspase-8 in hemocytes after high and low temperature stress are shown in Fig. 5C and D, respectively. In M. coruscus, Mccaspase-8 transcripts did not show significant change at 2 h stress and 24 h recovery in 2 °C, 6 °C and 28 °C group. However, at 32 °C, Mccaspase-8 expression increased significantly after stress and recovery (p b 0.05), and the peak value was 7.7 fold as much as the control at 24 h recovery (p b 0.05). In M. galloprovincialis, Mgcaspase-8 transcripts did not show significant change after 2 °C stress. However, it increased significantly after 2 h stress at 6 °C (p b 0.05), with the peak value 9.2 fold as much as the control group. And significantly high expression levels of Mgcaspase-8 lasted to 24 h recovery (p b 0.05). Mgcaspase-8 expression did not show significant change after stress at 28 °C; however, it increased significantly after 24 h recovery (p b 0.05). At 32 °C, Mgcaspase-8 transcripts showed a significant increase after stress and recovery (p b 0.05).

14

D. Zhang et al. / Comparative Biochemistry and Physiology, Part B 177–178 (2014) 10–20

Fig. 1. The protein domain features of Mccaspase-8 and Mgcaspase-8 and alignment of amino acid sequences of Mccaspase-8 and Mgcaspase-8. The same amino acids are marked by asterisks; the DED domains are marked in light gray; the P20 large subunit is marked by black; the P10 small subunit is marked by dark gray; and the conservative caspase family cysteine active sites (KPKLFFIQACQG) are boxed.

3.5. Caspase-8 activity profiles in gill and hemocytes after temperature stress Relative caspase-8 activity profiles in gill tissue of M. coruscus and M. galloprovincialis after different temperature stress are shown in Fig. 6A and B, respectively. In M. coruscus, caspase-8 activity increased significantly after stress at 2 °C (p b 0.05), and then it returned to the control level at 24 h recovery. Caspase-8 activity also increased significantly after 6 °C stress (p b 0.05) and significant high activity was maintained to 24 h recovery; the highest activity was 4.2 times greater than that of the control group (p b 0.05). Also, caspase-8 activity increased significantly after stress at 28 °C, with a peak value of 5.7 times of the control group (p b 0.05), then it decreased but the significant high expression levels were maintained to 24 h recovery (p b 0.05). At 32 °C, however, it did not show significant change after 2 h stress and 24 h recovery (Fig. 6A). In M. galloprovincialis, at 2 °C, caspase-8 activity increased significantly after stress and recovery, with the greatest activity 5.4 times as much as the control at 24 h recovery (p b 0.05). At 6 °C, caspase-8 activity also increased significantly after stress, with the peak value 6.6 times greater than that of the control group (p b 0.05), then it recovered to the control level after recovery. Significant increases (p b 0.05) of caspase-8 activity were detected after stress and recovery both at 28 °C and 32 °C (p b 0.05).

Relative caspase-8 activity profiles in hemocytes of M. coruscus and M. galloprovincialis after temperature stresses are shown in Fig. 6C and D, respectively. In M. coruscus, at 2 °C, caspase-8 activity showed a significant increase after 24 h recovery (p b 0.05), with a peak value 3 times as much as that of the control group. However, caspase-8 activity did not show significant change after 6 °C stress. Also, no significant differences of caspase-8 activity were detected after high temperature stress at 28 °C and 32 °C (Fig. 6C). In M. galloprovincialis, caspase-8 activity did not show significant change after stress at 2 °C. At 6 °C, caspase-8 activity increased significantly after 2 h stress, with a peak value 5 times of the control (p b 0.05), and the significantly high activity maintained to 24 h recovery (p b 0.05). Caspase-8 activity did not show significant change after stress at 28 °C. Also, no significant change of caspase-8 activity was detected at 2 h after exposure at 32 °C; however, significantly high caspase-8 activity was found at 24 h recovery (p b 0.05) (Fig. 6D). 4. Discussion It was reported that the executioner caspase-3 expression could be induced in mussels after thermal stress (Kefaloyianni et al., 2005; Yao and Somero, 2012). However, as the most important initiator, the information of caspase-8 is little known in mussel's response

D. Zhang et al. / Comparative Biochemistry and Physiology, Part B 177–178 (2014) 10–20

temperature stress. One possible reason is due to the very low homology of molluscan caspase-8 sequences. In this study, a 501-aa Mccaspase-8 and a 495-aa Mgcaspase-8 were obtained from M. coruscus and M. galloprovincialis, which showed greatest similarity with caspase-8 from another mussel, M. californianus. Two highly conserved DEDs in initiator caspase (Fan et al., 2005), which functionally mediates the recruitment to the death-inducing signaling complex (DISC) and involves in induction of the apoptosis signal (Kischkel et al., 1995), were predicted at the N-terminal in Mccaspase-8 and Mgcaspase-8. Structure analysis indicated that both Mccaspase-8 and Mgcaspase-8 contained the typical P20 and P10 subunits, which played a crucial role in caspase activation and carrying out catalytic function (Riedl and Shi, 2004). The conservative activesite pentapeptide QACXG in the cysteine active site of caspase family (Cohen, 1997) was also predicted in both Mccaspase-8 and Mgcaspase-8, with the same sequences as QACQG (Fig. 2). Generally, conservative caspase family recognizes a peptide sequence in their substrates as P4-P3-P2-P1-P1′, wherein the critical amino acid residues Arg179, Gln283, Arg341, and Thr419 in mammalian caspase-8 are involved in forming a binding pocket for the P1-P1′ (Walker et al., 1994; Wilson et al., 1994). Similarly, the four key amino acids were identified at positions Arg229 , Gln355, Arg430 , Ser436 and Arg 223 , Gln352, Arg427, Ser433 in Mccaspase-8 and Mgcaspase-8 respectively (Fig. 2). Therefore, the most highly conservative features of initiator caspase have been identified in Mccaspase-8 and Mgcaspase-8, suggesting that it might have the conservative function of caspase-8. However, Mccaspase-8 and Mgcaspase-8 shared very low identity of approximate 40% with caspase8 from vertebrates (Muzio et al., 1996; Sakamaki et al., 1998; Reis et al., 2010) and other bivalves (Huang et al., 2010; Lee et al., 2011; Xiang et al., 2013) (Table 2). More importantly, Huang et al. identified a caspase like gene from H. diversicolor, which lacked DED domain (Huang et al., 2010). In addition, both Mccaspase-8 and Mgcaspase-8 shared 33.3% and 32.4% similarity with another caspase-8 from M. galloprovincialis (Romero et al., 2011) (Table. 2), indicating that there might be more than one type of caspase-8 existed in marine mollusk, and they might play different roles in apoptosis induction. Mccaspase-8 and Mgcaspase-8 were clustered into the same subgroup with other DED-containing invertebrate and vertebrate caspase-8, and a closer relationship was found in the genus Mytilus

15

(Fig. 3), suggesting that the evolution of caspase-8 corresponds to the taxonomic positions of the species. However, caspase from H. diversicolor was clustered into the outgroup of caspase-8 and caspase-10 (Huang et al., 2010), indicating that the newly identified Mccaspase-8 and Mgcaspase-8 belonged to the DED-containing caspase-8 family. Tissue expression analysis demonstrated that both Mccaspase-8 and Mgcaspase-8 transcripts expressed in most examined tissues. Similarly, caspase-8 gene showed a ubiquitous tissue distribution in many molluscan species including M. galloprovincialis (Romero et al., 2011), H. discus discus (Lee et al., 2011) and C. hongkongensis (Xiang et al., 2013). Previous studies showed that caspase-8 played important roles in maintaining the homeostasis of apoptosis in many biological events, including pathogenic infection (Huang et al., 2010; Lee et al., 2011; Romero et al., 2011; Xiang et al., 2013), UV stress and chemical pollutants (Romero et al., 2011). The ubiquitous distribution of caspase-8 in the two species indicating that caspase-8 might play important roles in various tissues of mussels. The predominant expression of Mccaspase-8 was detected in mantle tissue. Similarly, Kefaloyianni et al. demonstrated that thermal and heavy metal stress possible induced apoptotic death via the caspase-3 activation in the mantle tissue of M. galloprovincialis (Kefaloyianni et al., 2005). Our results of the most predominant expression of Mccaspase-8 in mantle tissue suggested that mantle tissue might be sensitive to stress and high expression levels of caspase-8 might have a close relationship with the apoptosis induction. The high transcripts of caspase-8 were also found in gonad tissue of M. coruscus, similar with the previous reports that the strong expression levels of caspase-8 were in gonad tissues in oyster, C. hongkongensis (Xiang et al., 2013). However, the most predominant expression of Mgcaspase-8 was detected in digestive gland of M. galloprovincialis, which was different from M. coruscus. It was demonstrated that the predominant of caspase-8 expression was in the digestive gland of M. galloprovincialis (Romero et al., 2011) and C. hongkongensis (Xiang et al., 2013), indicating that the caspase-8 mediated apoptosis process might be tissue specific in different animals. Also, it was reported that mantle and gill tissues differentially responded to the same environmental stress in M. galloprovincialis (Kefaloyianni et al., 2005). Previous studies showed that caspases-3 from gill tissue and hemocytes played an important role in mussels' response to temperature

A

P10

P10 Fig. 2. Structural features of Mccaspase-8 and Mgcaspase-8 genes. (A) Schematic representation of Mccaspase-8 and Mgcaspase-8 domains predicted by SMART programs. The two DEDs were located in the N-terminal region, followed by a putative P20 large subunit, and a predicted P10 small subunit at the C-terminal end. (B) Alignment of amino acid sequences of Mccaspase-8 and Mgcaspase-8 in DEDs, P20 and P10 domains with other invertebrates and vertebrates. The same amino acids were marked by black; the conservative catalytic sites His, Gly and Cys in P20 large subunit were marked by light gray; the four key amino acids involved in forming a binding pocket for P1-P1′ were marked by dark gray; and the conservative caspase family cysteine active site (KPKLFFIQACQG) was boxed.

16

D. Zhang et al. / Comparative Biochemistry and Physiology, Part B 177–178 (2014) 10–20

B

DED1 domain: from 7 to 85 amino acid residues in Mccaspase-8 and Mgcaspase-8         

  







    

       

DED2 domain: from 103 to 184 amino acid residues in Mccaspase-8 and Mgcaspase-8









P20 subunit: from 211 to 361 amino acid residues in Mccaspase-8 and from 205 to 358 amino acid residues in Mgcaspase-8

    

  

         

        

                

         



         







        

               



  

P10 subunit: from 406 to 497 amino acid residues in Mccaspase-8 and from 403 to 491 amino acid residues in Mgcaspase-8



         



        

    

  7   7  7            

Fig. 2 (continued).

D. Zhang et al. / Comparative Biochemistry and Physiology, Part B 177–178 (2014) 10–20

17

Sus scrofa casp-10 (BAH57972.1)

94 58

Equus caballus casp-10 (XP_001498125.2)

100

Homo sapiens casp-10 (CAD32372.1)

75

Oryctolagus cuniculus casp-10 (ABP93400.1) Xenopus laevis casp-10 (NP_001081410.1)

51

Gallus gallus casp-8 (NP_989923.1) Homo sapiens casp-8 (AAD24962.1)

100

26

Mus musculus casp-8 (AAH06737.1)

94

Rattus norvegicus casp-8 (NP_071613.1)

100

Danio rerio casp-8 (NP_571585.2)

64

Initiator caspase

Dicentrarchus labrax casp-8 (ACO53630.1)

66

Tubifex tubifex casp-8 (ACP41139.1) Haliotis discus discus casp-8 (ADR78296.1)

62

Crassostrea hongk ongensis casp-8 lik e (AHB50667.1)

68

Mytilus galloprovincialis casp-8 (KJ689445)

90 100 85

Mytilus californianus casp-8 (ADB80147.1) Mytilus coruscus casp-8 (KJ689446) Haliotis diversicolor casp (ABY87390.3)

Rattus norvegicus casp-6 (NP_113963.2)

100

Homo sapiens casp-6 (NP_001217.2) Xenopus laevis casp-7 (NP_001091272.1)

100

Salmo salar casp-7 (AAY28975.1)

96 99 100

100

Tanichthys albonubes casp-3 (ACV31395.1) Danio rerio casp-3 (BAB32409.1) Dicentrarchus labrax casp-3 (ABC70996.1) Gallus gallus casp-3 (NP_990056.1)

95 82 96

Executioner caspase

Equus caballus casp-3 (NP_001157433.1) Homo sapiens casp-3 (CAC88866.1)

100 72

Rattus norvegicus casp-3 (NP_037054.1) Mus musculus casp-3 (CAA73528.1)

0.1

6

M.coruscus and M.galloprovincialis

Relative mRNA Expressiuon of Caspase-8 in

Fig. 3. Phylogenetic analysis of caspase-8 and other caspase family members based on amino acid sequences using MEGA 5.1. The tree was constructed by the neighbor-joining method. Numbers at the nodes represented bootstrap values based on 1000 replicates. The scale represents Nei's genetic distance. The caspase-8 gene of M. coruscus and M. galloprovincialis was shown in box.

M.coruscus M.galloprovincialis 5

4

3

2

1

0

l Gil

e ntl Ma

d na Go

e tiv es Dig

nd gla

es cyt mo e H

e scl Mu

Tissues Fig. 4. Relative expression levels of caspase-8 in different tissues of M. coruscus and M. galloprovincialis including digestive gland, gill, muscle, mantle, gonad and hemocytes, respectively. Date is presented as the mean relative expression ± S.D. for three real-time PCR reactions from three pooled tissues of six individual mussels (n = 3).

stress (Kefaloyianni et al., 2005; Yao and Somero, 2012). Caspase-8 is known as an apoptotic initiator which activates executioner caspases including caspases-3, -6, and -7 (Salvesen and Dixit, 1997) and induces other caspase gene expression in cells undergoing apoptosis (Chiang et al., 2001). Like all caspases, caspase-8 is synthesized as an inactive zymogen procaspase and is activated by proteolytic cleavage (Kruidering and Evan, 2000). Caspase-8 activities were induced in gill of both M. coruscus and M. galloprovincialis after cold stress at 2 °C and 6 °C (Fig. 6A and B), suggesting that caspase-8 activation might play an important role in response to cold stress. Fransen et al. demonstrated that cold-shock could induce apoptosis in murine 32Dcl3 cells (Fransen et al., 2011). After 24 h recovery, caspase-8 activity in gill of M. coruscus increased significantly in 6 °C stressed group (p b 0.05) whereas it returned to the control level in the 2 °C stressed group (Fig. 6A). However, significant high caspase-8 activity maintained to 24 h in the 2 °C stressed group, whereas it returned to the control level in the 6 °C stressed group in M. galloprovincialis (Fig. 6B). These results indicate that caspase-8 might lose response ability in gill tissue of M. coruscus after 2 °C stress whereas M. galloprovincialis could adapt to 6 °C stress and response to the stress at 2 °C. The differences between transcripts and enzyme activities might be due to the different expression levels (Figs. 5A, B and 6A, B). A significant increase of caspase-8 activities and transcripts was detected in gill tissue of both M. coruscus and M. galloprovincialis after heat stress (Figs. 5A, B and 6A, B), suggesting that caspase-8 plays an

18

D. Zhang et al. / Comparative Biochemistry and Physiology, Part B 177–178 (2014) 10–20

Fig. 5. Analysis of Mccaspase-8 and Mgcaspase-8 transcriptional levels in gill and hemocytes after cold temperature stress at 2 °C and 6 °C and heat stress at 28 °C and 32 °C. A. relative expression levels of Mccaspase-8 in gill tissue after temperature stress; B. relative expression levels of Mgcaspase-8 in gill tissue after temperature stress; C. relative expression levels of Mccaspase-8 in hemocytes after temperature stress; and D. relative expression levels of Mgcaspase-8 in hemocytes after temperature stress. The values were shown as means ± S.D. (n = 3). Statistical significance was determined by one-way ANOVA with stress time as factor. Different letters denote statistically significant differences (p b 0.05) between experimental treatments (high- and low temperature stress for varying times) and the control (15 °C specimens) and each other. Two hour and R24h represent after 2 h stress and 24 h after recovery at 15 °C, respectively (15 °C as control temperature and without thermal stress, and is represented in black color).

important role in response to heat stress. Our results agreed to some previous studies, which demonstrated that caspase-3 transcripts and active caspase-3 could be induced in gill tissue of M. galloprovincialis and M. trossulus after acute thermal stress (Kefaloyianni et al., 2005; Lockwood et al., 2010). Compared with M. galloprovincialis, higher caspase-8 transcripts and activity were induced in gill tissue after stress at 28 °C in M. coruscus, suggesting that caspase-8 mediated stress response might be stronger in M. coruscus than that in M. galloprovincialis at 28 °C. In addition, no significant increasing of caspase-8 activity was found after stress at 32 °C in M. coruscus, which might be due to it lost response ability when temperature beyond their thermal limitation and the cell response stress in a different way. Mussel hemocytes perform a variety of functions, including immune response, wound repair, oxygen, nutrients, metabolite transportation, and digestion (Cajaraville and Pal, 1995; Yao and Somero, 2012). In hemocytes, a significant increase of caspase-8 transcripts and activities was detected in M. coruscus and M. galloprovincialis after heat and cold stress (Figs. 5C, D and 6C, D), indicating that caspase-8 played an important role in the response to cold and heat stress in both species. It was demonstrated that the executioner caspase-3 could be triggered by caspase-8 in mammals (Salvesen and Dixit, 1997). Increasing caspase-3 activation was also detected after cold and heat stress in hemocytes of M. californianus and M. galloprovincialis (Yao and Somero,

2012). In addition, apoptotic hemocytes ratio and caspase-3 transcripts and activities increased in hemocytes of Litopeaneus vannamei after cold stress (Chang et al., 2009). Our results showed that caspase-8 activity could be induced in M. coruscus after cold stress at 2 °C (Fig. 6C), suggesting that extreme low temperature could induce caspase-8 activation, whereas moderate cold temperature stress and heat stress could not induce caspase-8 activation in hemocytes of M. coruscus, which might be due to the hemocytes of coruscus was not sensitive to heat stress. Mgcaspase-8 activity increased significantly in hemocytes of M. galloprovincialis after cold stress at 6 °C (p b 0.05), whereas no significant change of transcripts and activity was detected after cold stress at 2 °C (Figs. 5D and 6D), suggesting that caspase-8 in hemocytes of M. galloprovincialis could respond to 6 °C stress and might lose positive response ability at lower temperature. A significant increase of caspase-8 transcripts and activity was detected after 24 h recovery in the 32 °C stress group (p b 0.05) but no significant change of them was detected in the 28 °C stress group, suggesting that caspase-8 expression in hemocytes could not be induced at 28 °C, whereas its expression could be induced at higher temperature. The minor different between transcripts and activities might be due to different regulation levels. In mammalian cells, at least three different mechanisms have been found for caspase activation, including recruitment activation, transactivation, and autoactivation (Nicholson, 1999). Therefore, further

D. Zhang et al. / Comparative Biochemistry and Physiology, Part B 177–178 (2014) 10–20

19

Fig. 6. Analysis of relative caspase-8 activity of M. coruscus and M. galloprovincialis in gill and hemocytes after cold temperature stress at 2 °C and 6 °C and heat stress at 28 °C and 32 °C. A. Relative caspase-8 activity of M. coruscus in gill tissue after temperature stress; B. relative caspase-8 activity of M. galloprovincialis in gill tissue after temperature stress; C. relative caspase-8 activity of M. coruscus in hemocytes after temperature stress; D. relative caspase-8 activity of M. galloprovincialis in hemocytes after temperature stress. The values were shown as means ± S.D. (n = 3). Statistical significance was determined by one-way ANOVA with stress time as factor. Different letters denote statistically significant differences (p b 0.05) between experimental treatments (high- and low temperature stress for varying times) and the control (15 °C specimens). Two hour and R24h represent 2 h after stress and 24 h after recovery at 15 °C, respectively. (15 °C as control temperature and without thermal stress, and is represented in black color).

investigation is needed, to clarify the detailed signal of regulation. It was reported that necrotic hemocytes ratio increased after extreme temperature stress (Yao and Somero, 2012, 2013). In conclusion, the full-length cDNA sequences of caspase-8 were obtained from M. coruscus and M. galloprovincialis. Both of them belonged to the conserved initiator caspase family. Tissue expression showed that the most predominant transcripts of Mccaspase-8 were detected in mantle and gonad tissue of M. coruscus and the high transcripts of Mgcaspase-8 were found in digestive gland and gill tissue of M. galloprovincialis. The expression levels of caspase-8 in gill and hemocytes after temperature stress were investigated. Our results showed that caspase-8 transcripts and activities in gill and hemocytes could be induced significantly after cold and heat stress (p b 0.05) in both species. However, these responses are different between tissues and species. Compare with M. coruscus, the induction of caspase-8 expression in M. galloprovincialis might last longer. Our results suggested that caspase-8 might play key roles in determining cellular thermal tolerance limits in M. coruscus and M. galloprovincialis response to temperature stress. Acknowledgments This research was funded by the National Science Foundation of China: Grant 41276178 and 41076076, to CLY.

References Boatright, K.M., Salvesen, G.S., 2003. Mechanisms of caspase activation. Curr. Opin. Struct. Biol. 15 (6), 725–731. Boldin, M.P., Goncharov, T.M., Goltsev, Y.V., Wallach, D., 1996. Involvement of MACH, a novel MORT1/FADD-interacting protease, in Fas/APO-1- and TNF receptor-induced cell death. Cell 85 (6), 803–815. Braby, C.E., Somero, G.N., 2006. Following the heart: temperature and salinity effects on heart rate in native and invasive species of blue mussels (genus Mytilus). J. Exp. Biol. 209 (13), 2554–2566. Cajaraville, M.P., Pal, S.G., 1995. Morphofunctional study of the haemocytes of the bivalve mollusc Mytilus galloprovincialis with emphasis on the endolysosomal compartment. Cell Struct. Funct. 20 (5), 355–367. Chang, K.M., Wu, J.F., 2007. Study on artificial propagation of mussel Mytilus coruscus. South China. Fish. Sci. 3 (3), 26–30 (Chinese). Chang, C.C., Yeh, M.S., Cheng, W., 2009. Cold shock-induced norepinephrine triggers apoptosis of haemocytes via caspase-3 in the white shrimp, Litopenaeus vannamei. Fish Shellfish Immunol. 27 (6), 695–700. Chiang, L.W., Grenier, J.M., Ettwiller, L., Jenkins, L.P., Ficenec, D., Martin, J., Jin, F., DiStefano, P.S., Wood, A., 2001. An orchestrated gene expression component of neuronal programmed cell death revealed by cDNA array analysis. Proc. Natl. Acad. Sci. U. S. A. 98, 2814–2819. Cohen, G.M., 1997. Caspases: the executioners of apoptosis. Biochem. J. 326, 1–16. Crowder, R.N., El-Deiry, W.S., 2012. Caspase-8 regulation of trail-mediated cell death. Exp. Oncol. 34 (3), 160–164. Cubero-Leon, E., Ciocan, C.M., Minier, C., Rotchell, J.M., 2012. Reference gene selection for qPCR in mussel, Mytilus edulis, during gametogenesis and exogenous estrogen exposure. Environ. Sci. Pollut. Res. Int. 19 (7), 2728–2733. Danial, N.N., Korsmeyer, S.J., 2004. Cell death: critical control points. Cell 116 (2), 205–219. Dickens, L.S., Boyd, R.S., Jukes-Jones, R., Hughes, M.A., Robinson, G.L., Fairall, L., Schwabe, J.W., Cain, K., Macfarlane, M., 2012. A death effector domain chain DISC model reveals a

20

D. Zhang et al. / Comparative Biochemistry and Physiology, Part B 177–178 (2014) 10–20

crucial role for caspase-8 chain assembly in mediating apoptotic cell death. Mol. Cell 47 (2), 291–305. Elmore, S., 2007. Apoptosis: a review of programmed cell death. Toxicol. Pathol. 35 (4), 495–516. Fan, T.J., Han, L.H., Cong, R.S., Liang, J., 2005. Caspase family proteases and apoptosis. Acta Biochim. Biophys. Sin. 37 (11), 719–727. Fransen, J.H., Dieker, J.W., Hilbrands, L.B., Berden, J.H., van der Vlag, J., 2011. Synchronized turbo apoptosis induced by cold-shock. Apoptosis 16 (1), 86–93. Grütter, M.G., 2000. Caspases: key players in programmed cell death. Curr. Opin. Struct. Biol. 10 (6), 649–655. Huang, W.B., Ren, H.L., Gopalakrishnan, S., Xu, D.D., Qiao, K., Wang, K.J., 2010. First molecular cloning of a molluscan caspase from variously colored abalone (Haliotis diversicolor) and gene expression analysis with bacterial challenge. Fish Shellfish Immunol. 28 (4), 587–595. Kefaloyianni, E., Gourgou, E., Ferle, V., Kotsakis, E., Gaitanaki, C., Beis, I., 2005. Acute thermal stress and various heavy metals induce tissue-specific pro- or antiapoptotic events via the p38-MAPK signal transduction pathway in Mytilus galloprovincialis (Lam.). J. Exp. Biol. 208 (23), 4427–4436. Kischkel, F.C., Hellbardt, S., Behrmann, I., Germer, M., Pawlita, M., Krammer, P.H., Peter, M. E., 1995. Cytotoxicity-dependent APO-1 (Fas/CD95)-associated proteins form a death-inducing signaling complex (DISC) with the receptor. EMBO J. 14 (22), 5579–5588. Kruidering, M., Evan, G.I., 2000. Caspase-8 in apoptosis: the beginning of “the end”? IUBMB Life 50 (2), 85–90. Lawen, A., 2003. Apoptosis—an introduction. Bioessays 25 (9), 888–896. Lee, Y., De Zoysa, M., Whang, I., Lee, S., Kim, Y., Oh, C., Choi, C.Y., Yeo, S.Y., Lee, J., 2011. Molluscan death effector domain (DED)-containing caspase-8 gene from disk abalone (Haliotis discus discus): molecular characterization and expression analysis. Fish Shellfish Immunol. 30 (2), 480–487. Li, H., Toubiana, M., Monfort, P., Roch, P., 2009. Influence of temperature, salinity and E. coli tissue content on immune gene expression in mussel: results from a 2005–2008 survey. Dev. Comp. Immunol. 33 (9), 974–979. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods 25 (4), 402–408. Lockwood, B.L., Sanders, J.G., Somero, G.N., 2010. Transcriptomic responses to heat stress in invasive and native blue mussels (genus Mytilus): molecular correlates of invasive success. J. Exp. Biol. 213, 3548–3558. Muzio, M., Chinnaiyan, A.M., Kischkel, F.C., O'Rourke, K., Shevchenko, A., Ni, J., Scaffidi, C., Bretz, J.D., Zhang, M., Gentz, R., Mann, M., Krammer, P.H., Peter, M.E., Dixit, V.M., 1996. FLICE, a novel FADD-homologous ICE/CED-3-like protease, is recruited to the CD95 (Fas/APO-1) death-inducing signaling complex. Cell 85 (6), 817–827. Nakajima, K., Takahashi, A., Yaoita, Y., 2000. Structure, expression, and function of the Xenopus laevis caspase family. J. Biol. Chem. 275 (14), 10484–10491. Nicholson, D.W., 1999. Caspase structure, proteolytic substrates, and function during apoptotic cell death. Cell Death Differ. 6 (11), 1028–1042. Philchenkov, A., 2004. Caspases: potential targets for regulating cell death. J. Cell. Mol. Med. 8 (4), 432–444. Qi, M., Li, Q., Kong, L., Yu, H., 2014. Artificial induction of gynogenetic diploids in blue mussel Mytilus galloprovincialis. Trans. Oceanol. Limnol. (1), 42–47 (Chinese). Reis, M.I., Costa-Ramos, C., do Vale, A., dos Santos, N.M., 2010. Molecular cloning of sea bass (Dicentrarchus labrax L.) caspase-8 gene and its involvement in Photobacterium damselae ssp. piscicida triggered apoptosis. Fish Shellfish Immunol. 29 (1), 58–65.

Riedl, S.J., Shi, Y., 2004. Molecular mechanisms of caspase regulation during apoptosis. Nat. Rev. Mol. Cell Biol. 5 (11), 897–907. Romero, A., Estévez-Calvar, N., Dios, S., Figueras, A., Novoa, B., 2011. New insights into the apoptotic process in mollusks: characterization of caspase genes in Mytilus galloprovincialis. PLoS One 6 (2), e17003. Sakamaki, K., Tsukumo, S., Yonehara, S., 1998. Molecular cloning and characterization of mouse caspase-8. Eur. J. Biochem. 253 (2), 399–405. Salvesen, G.S., Dixit, V.M., 1997. Caspases: intracellular signaling by proteolysis. Cell 91 (4), 443–446. Seed, R., 1992. Systematics, evolution and distribution of mussels belonging to the genus Mytilus: an overview. Am. Malacol. Bull. 9 (2), 123–137. Somero, G.N., 2010. The physiology of climate change: how potentials for acclimatization and genetic adaptation will determine ‘winners’ and ‘losers’. J. Exp. Biol. 213 (6), 912–920. Somero, G.N., 2011. Comparative physiology: a “crystal ball” for predicting consequences of global change. Am. J. Physiol. Regul. Integr. Comp. Physiol. 301 (1), R1–R14. Tang, M., Liu, Y., Li, H., Meng, Q., Qu, R., Gao, Z., Sui, P., 1989. Seasonally change and analysis of sea surface temperature in Baohai Sea, Yellow Sea and North of East Sea. Acta Oceanol. Sin. 11 (5), 544–553 (Chinese). Thornberry, N.A., Lazebnik, Y., 1998. Caspases: enemies within. Science 281 (5381), 1312–1316. Tomanek, L., Zuzow, M.J., 2010. The proteomic response of the mussel congeners Mytilus galloprovincialis and M. trossulus to acute heat stress: implications for thermal tolerance limits and metabolic costs of thermal stress. J. Exp. Biol. 213, 3559–3574. Walker, N.P.C., Talanian, R.V., Brady, K.D., Dang, L.C., Bump, N.J., Ferenz, C.R., Franklin, S., Ghayur, T., Hackett, M.C., Hammill, L.D., Herzog, L., Hugunin, M., Houy, W., Mankovich, J.A., McGuiness, L., Orlewicz, E., Paskind, M., Pratt, C.A., Reis, P., Summani, A., Terranova, M., Welch, J.P., Xiong, L., Möller, A., Tracey, D.E., Kamen, R., Wong, W.W., 1994. Crystal structure of the cysteine protease interleukin-1 beta-converting enzyme: a (p20/p10)2 homodimer. Cell 78 (2), 343–352. Wang, Z.R., 1997. Fauna Sinica [M]. Science Press, Beijing. Wilson, K.P., Black, J.A., Thomson, J.A., Kim, E.E., Griffith, J.P., Navia, M.A., Murcko, M.A., Chambers, S.P., Aldape, R.A., Raybuck, S.A., Livingston, D.J., 1994. Structure and mechanism of interleukin-1β converting enzyme. Nature 370, 270–275. Wu, Y., Xu, Z., Fan, W., Cui, X., 2011. Change of sea surface temperature in East China Sea during 1985-2005. Acta Oceanol. Sin. 33 (6), 9–18 (Chinese). Xiang, Z., Qu, F., Qi, L., Zhang, Y., Tong, Y., Yu, Z., 2013. Cloning, characterization and expression analysis of a caspase-8 like gene from the Hong Kong oyster, Crassostrea hongkongensis. Fish Shellfish Immunol. 35 (6), 1797–1803. Yao, C.L., Somero, G.N., 2012. The impact of acute temperature stress on hemocytes of invasive and native mussels (Mytilus galloprovincialis and Mytilus californianus): DNA damage, membrane integrity, apoptosis and signaling pathways. J. Exp. Biol. 215 (24), 4267–4277. Yao, C.L., Somero, G.N., 2013. Thermal stress and cellular signaling processes in hemocytes of native (Mytilus californianus) and invasive (M. galloprovincialis) mussels: cell cycle regulation and DNA repair. Comp. Biochem. Physiol. A 165 (2), 159–168. Yao, C.L., Somero, G.N., 2014. The impact of ocean warming on marine organisms. Chin. Sci. Bull. 59 (5–6), 468–479. Ye, Y.Y., Xu, M.Y., Guo, B.Y., Wu, C.W., 2012. Genetics structure and sequence analysis of four populations of Mytilus coruscus in the coastal waters of Southeast China Sea using 16 s rRNA. Oceanol. Limnol. Sin. 43 (2), 376–381 (Chinese).