Molecular Analysis of Fragile X Syndrome
UNIT 9.5
Monica J. Basehore1 and Michael J. Friez1 1
Greenwood Genetic Center, Greenwood, South Carolina
ABSTRACT The gene responsible for Fragile X syndrome, fragile X mental retardation-1 (FMR1), contains an unstable sequence of CGG trinucleotide repeats in its promoter region. Expansions of >200 trinucleotide repeats are considered full mutations and typically lead to abnormal methylation of the region, resulting in loss of FMR1 expression. Males with loss of FMR1 protein are expected to be affected by Fragile X syndrome, while females may or may not clinically manifest features of the condition. The protocols in this unit outline the complementary use of polymerase chain reaction (PCR) and methylation-sensitive Southern blot hybridization to accurately measure trinucleotide repeat size and methylation status. These protocols are also used to evaluate CGG repeat size in two adult-onset conditions known for their association with FMR1 premutation alleles, Fragile X Tremor/Ataxia (FXTAS) syndrome and Premature Ovarian Failure C 2014 by John Wiley & Sons, Inc. (POF). Curr. Protoc. Hum. Genet. 80:9.5.1-9.5.19. Keywords: Fragile X r molecular r diagnostic r clinical r testing
INTRODUCTION Fragile X syndrome is the most common form of inherited mental retardation, and virtually all clinical testing for this condition revolves around the determination of the length of the CGG repeat tract in the 5-prime untranslated region of the fragile X mental retardation-1 (FMR1) gene (see Fig. 9.5.1). This is one of the most common genetic tests ordered by clinicians for individuals with intellectual disability and/or autism, and CGG repeat size ranges from a relatively small number of repeats in normal individuals to a much greater number of repeats in affected and carrier individuals. FMR1 mutations other than expansion of the CGG trinucleotide tract are known, but reports of these alterations are scarce. Since point mutations and large gene deletions collectively account for 5.8 kb
full mutation EcoRI
EcoRI
(Eagl)
Figure 9.5.1 The fragile X region with normal, premutation, and full mutation CGG repeats. The CGG repeat region is represented by a jagged line. Restriction sites are indicated by solid arrows for EcoRI and a dashed arrow for methylation-sensitive EagI. Full mutation alleles are typically methylated and are resistant to digestion at the EagI site.
StB12.3 Ox1.9 Ox0.55 pE5.1
Eco RI
PstI
XhoI
PstI
PstI
Eco RI
EagI
Figure 9.5.2 Restriction map of the fragile X region. Probes used in Southern analysis of the region are shown.
but this seems to be readily available in most well-equipped molecular laboratories. The PCR method described in Basic Protocol 2 is an earlier version of the procedure, and is based on the separation of PCR products with polyacrylamide gel electrophoresis and hybridization with a labeled CGG-repeat oligonucleotide. For the sake of completeness, and because the method is still in use in some laboratories, we have retained the original PCR method as Basic Protocol 2, while the newer fluorescent PCR method is provided in Basic Protocol 1.
Molecular Analysis of Fragile X Syndrome
Basic Protocol 3 describes Southern analysis of genomic DNA digested with a pair of restriction enzymes, one of which is sensitive to DNA methylation (Fig. 9.5.2). PCR analysis of the CGG repeat region is much faster than Southern analysis and accurately determines the size of normal, intermediate, and most premutation-sized alleles (Fig. 9.5.3). PCR analysis also detects small changes in repeat number from one
9.5.2 Supplement 80
Current Protocols in Human Genetics
90
A
150
130
110
170
28000 20000 12000 4000
B
148
18000 14000 10000 6000 2000
C
148
130
20000 16000 16000 12000 4000
145 148 300
260
D
360
340
380
400
240 200 160 120 80 40 282
E
1
2
3
4
5
6
7
8
9
10
11
12
13 CGG repeats 155
82
60
28
Figure 9.5.3 Top: Fluorescent PCR (Basic Protocol 1) electropherogram traces for (A) a normal male with 31 repeats, (B) a normal female with 25 and 31 repeats, (C) a normal female with 30 and 31 repeats, and (D) a male with a premutation-sized allele of 75 repeats. (E) PCR analysis (Basic Protocol 2) of the FMR1 CGG repeat in the general population and in families with Fragile X. Lane 1: premutation male with 115 repeats. Lane 2: normal male with 29 repeats. Lane 3: normal male with 30 repeats. Lanes 4 to 6: family with Fragile X including premutation mother with 30 and 95 repeats (lane 4); full mutation female fetus with 31 and >200 repeats (lane 5); and normal father with 31 repeats (lane 6). Lanes 7 to 9: family with Fragile X: normal father with 30 repeats (lane 7); prenatal sample of normal female fetus with 27 and 30 repeats (lane 8); and premutation mother with 27 and 145 repeats (lane 9). Lane 10: normal male with 33 repeats. Lane 11: full mutation male with >200 repeats. Lane 12: negative control with no DNA. Lane 13: size standard (pBR322 digested with MspI) with corresponding CGG repeat numbers shown.
Clinical Molecular Genetics
9.5.3 Current Protocols in Human Genetics
Supplement 80
generation to another. Substitution of 7-deaza-2 -dGTP for dGTP in PCR reactions allows for the potential amplification of some full mutations, which is typically unsuccessful with standard PCR protocols. Both PCR and Southern analyses are routinely utilized to provide complementary information that reliably determines the length of the FMR1 trinucleotide repeat. Basic Protocol 4 describes the use of triplet repeat-primed PCR (TRP-PCR) to screen for the presence or absence of an expansion mutation. The triplet repeat-primed FMR1 PCR assay described here makes use of a fluorescently labeled primer and capillary gel electrophoresis, thereby increasing the ease and certainty with which results can be interpreted (Lyon et al., 2010; Fig. 9.5.5). The commercial FMR1 TRP-PCR assays that are currently available include the Abbott Molecular FMR1 PCR assay and the Asuragen AmplideX FMR1 mPCR kit. Basic Protocol 4 specifically describes the use of Abbott Molecular’s TRP-PCR assay. NOTE: Experiments involving PCR require extremely careful technique to prevent contamination (see APPENDIX 2D). BASIC PROTOCOL 1
FMR1 TRINUCLEOTIDE FLUORESCENT PCR AMPLIFICATION USING CAPILLARY GEL ELECTROPHORESIS The use of fluorescently labeled amplicons and capillary electrophoresis for determining the FMR1 trinucleotide repeat length has become the PCR method of choice for most laboratories.
Materials No-template control (NTC) Positive control with a known CGG repeat length 6 M betaine (Sigma) 10× PCR Gold Buffer (Applied Biosystems) 25 mM MgCl2 (Applied Biosystems) Deoxynucleotides (dNTPs; 3 mM each dATP and dTTP, 0.75 mM each dCTP and dGTP) 7-deaza-2 -deoxyguanosine 5 -triphosphate (5 mM) Forward primer: (100 ng/μl) 5 GACGGAGGCGCCGCTGCCAGG Reverse primer: (100 ng/μl) 5 GTGGGCTGCGGGCGCTCGAGG (FAM-labeled) Dimethyl sulfoxide (DMSO; Sigma) 5 U/μl AmpliTaq Gold DNA polymerase (Applied Biosystems) Purified DNA sample (APPENDIX 3B) in 10 mM Tris·Cl, pH 7.5 (APPENDIX 3D)/1 mM EDTA Hi-Di Formamide (Applied Biosystems) LIZ fluorescent size standard (Applied Biosystems) 1.5-ml sterile microcentrifuge tube Sterile PCR tubes/plate Thermal cycler Applied Biosystems 3100/3130 or 3730 Genetic Analyzer or other appropriate capillary gel electrophoresis system
Molecular Analysis of Fragile X Syndrome
Amplify the CGG repeat region (25 μl total reaction volume) 1. Prior to setting up, be sure to include reactions for proper controls as deemed necessary. At minimum, these should include a no-template control (NTC) and at least one positive control with a known CGG repeat length.
9.5.4 Supplement 80
Current Protocols in Human Genetics
Including a control with a premutation-sized allele and a female with two distinct alleles is highly recommended.
2. Prepare PCR cocktail mix in a 1.5-ml microcentrifuge tube by combining the following for each reaction: 13.5 μl 2.5 μl 2 μl 1.7 μl 0.8 μl 1.0 μl 1.0 μl 1.0 μl 0.5 μl
6 M Betaine 10× PCR Gold Buffer 25 mM MgCl2 dNTPs (3 mM dATP/dTTP, 0.75 mM dCTP/dGTP) 7-deaza-2 -Deoxyguanosine Forward primer (100 ng/μl) Reverse primer (100 ng/μl) DMSO AmpliTaq Gold DNA polymerase (5 U/μl).
For 55 CGG repeats) male expanded allele
expanded allele (> 55 CGG repeats)
ladder motif
Figure 9.5.5 Triplet repeat-primed FMR1 PCR screening test for FMR1 CGG alleles (Basic Protocol 4). The forward PCR primer is located upstream of the FMR1 CGG region while the fluorescently labeled reverse primer randomly binds inside the FMR1 CGG repeat region. These PCR primers generate different sized amplicons depending on the size of the CGG repeat region present. The presence or absence of a trinucleotide “ladder” that extends beyond a threshold of 55 CGG repeats can be easily recognized and is typically used to identify expanded FMR1 alleles. Example 1 shows the trace for a female with two normal alleles, neither of which results in the characteristic ladder motif present for expanded alleles. Example 2 illustrates the typical pattern for a female with one normal allele and one expanded allele while Example 3 illustrates the typical pattern for a male with an expansion at the FMR1 locus.
Thermal cycler 96-well plates Applied Biosystems 3730 Genetic Analyzer or other appropriate capillary gel electrophoresis system Amplify the CGG repeat region 1. Prior to setting up, be sure to include reactions for proper controls as deemed necessary. At minimum, these should include a no-template control (NTC), a normal control, a control with a premutation-sized allele, and a control with a full mutation. 2. Prepare a PCR cocktail mix in a 1.5-ml microcentrifuge tube by combining the following for each reaction: 7.8 μl High GC PCR Buffer 0.5 μl FMR1 Primers-2 0.7 μl TR PCR Enzyme Mix 1.2 μl DNase/RNase free water. For 99% of these mutations are expansions of a CGG trinucleotide repeat in the 5-prime noncoding region of the gene. These expansions lead to abnormal methylation of the FMR1 promoter region that results in transcriptional silencing of the gene (Rousseau et al., 1991). This syndrome is also associated with a folatesensitive fragile site at Xq27.3 in a variable proportion of cells. Prior to the delineation of the causative FMR1 trinucleotide expansions, cytogenetic testing for the presence of such fragile sites at the tip of the long arm of the X chromosome was originally used as a diagnostic tool for evaluating patients. Since some affected individuals show fragile-site expression in >70% of their cells while others demonstrate this expression in 5.8 kb. Occasionally, a full mutation will be partially methylated, yielding unmethylated fragments between 3.4 kb and 5.1 kb, in addition to the standard methylated fragments >5.8 kb. Analysis of a Fragile X family by hybridization with StB12.3 is illustrated in Figure 9.5.4. Triplet repeat-primed PCR for expansion screening The triplet repeat-primed PCR assay described here is able to identify all sizes of CGG repeats in the FMR1 gene. Briefly, a pair of PCR primers generates different-sized amplicons depending on the size of the CGG repeat region. The forward PCR primer is located upstream of the FMR1 CGG region while the fluorescently labeled reverse primer binds within the CGG region. A threshold set at 55 CGG repeats is typically used to distinguish between normal and expanded FMR1 alleles. The size in basepairs of the threshold is calculated using the following formula: #CGG repeats = (peak size in basepairs-134)/3, which is based on the primer binding sites and the number of basepairs in the amplicon excluding CGG repeats. The sample is considered normal if the largest amplicon in the CGG repeat ladder visualized by the electropherogram does not pass the threshold (200 repeats. Using either PCR protocol, normal-sized alleles can be resolved within 1 repeat unit and premutations can be sized to within 2 to 5 repeat units. While some full mutations in males may be amplified by PCR, the number of full mutation repeats must be estimated by Southern analysis. As previously mentioned, the interpretation of PCR analysis for females can be complex. First, a female may have either the same number of repeats or two different-sized repeats on each X chromosome. Second, preferential amplification of smaller repeats may occur, and this is commonly observed for females
Clinical Molecular Genetics
9.5.17 Current Protocols in Human Genetics
Supplement 80
Table 9.5.1 Expected Sizes of Bands in Southern Analysis of FMR1 Genotypes
Normal male Normal female Premutation malea Premutation femalea Full mutation male Full mutation female Mosaic pre/full mutation male Mosaic pre/full mutation femalea
2.8 kb √
2.9-3.4 kb
√
5.2 kb
5.3-5.8 kb
>5.8 kb
√ √
√
√
√
√ √
√
√
√
√ √
√
√ √
√
√
a The
ability to readily distinguish bands of 5.2 kb from others that are only slightly larger may be difficult, and is often dependent on the length of time and the size of gel used to separate the fragments. Additionally, it should be noted that the expected size pattern listed here for females is based on having a random X-inactivation pattern. Should a female have a skewed pattern of X-inactivation, the banding pattern on the Southern blot may be altered slightly from that listed above. Perhaps the most noticeable variation is the intensity of the premutation banding pattern in females with skewed X-inactivation. Skewed X-inactivation can often be inferred in females when the intensity of the methylated (5.35.8 kb) and unmethylated (2.9-3.4 kb) premutation bands differs significantly. Those interpreting FMR1 Southern blots must be cognizant of subtle variations in pattern given the possibilities of FMR1 deletions, unmethylated full mutations, and skewed X-inactivation in females.
with alleles of significantly different repeat sizes. Third, when denaturing polyacrylamide gels are used (as in Basic Protocol 2), a heteroduplex of two different repeats sometimes appears as a third, larger repeat in the intermediate or premutation range. In any case of questionable allele sizing, Southern analysis should be performed to confirm the correct FMR1 genotype. For Southern analysis using an EcoRI/EagI double digestion, the expected size of bands is shown in Table 9.5.1. It should also be noted that the high degree of repeat instability occurring in Fragile X might result in unusual or complex molecular patterns in both PCR and Southern analyses. For example, there have been reported cases of males with full mutations who also carry a normal or intermediate-sized repeat in some proportion of their cells (Nolin et al., 1996; Orrico et al., 1998). In addition, although some of the newer PCR protocols have the potential to amplify large full mutations, the size heterogeneity of these expansions interfere with making a definitive diagnosis without confirming by Southern analysis. Until PCR is able to accurately identify large expansions without compromising the ability to determine size and methylation mosaicism, Southern blot analysis will continue to be a standard procedure in the diagnosis of Fragile X syndrome. Molecular Analysis of Fragile X Syndrome
Time Considerations For Basic Protocol 1, the PCR amplification takes 3 hr for assay set up and time in
the thermal cycler. Capillary run times typically range from 30 to 90 min depending on the platform, length of capillary, and polymer used. The PCR amplification procedure in Basic Protocol 2 takes 3 hr; electrophoresis, transfer, and hybridization take 7 hr; and chemiluminescent film exposure times range from 30 min to overnight. Southern blot hybridization analysis with the probe StB12.3 takes 5 to 14 days. The greatest variables are the times used for restriction digestion, electrophoresis, DNA transfer to membrane, and exposure to film. Southern blot analysis can be accelerated to 3 to 5 days when certain procedures are not required to run overnight. For Basic Protocol 4, the PCR amplification takes 3 hr for assay set up and time in the thermal cycler. Capillary run times typically range from 30 to 90 min, depending on the platform, length of capillary, and polymer used.
Literature Cited Allingham-Hawkins, D.J., Babul-Hirji, R., Chitayat, D., Holden, J.J., Yang, K.T., Lee, C., Hudson, R., Gorwill, H., Nolin, S.L., Glicksman, A., Jenkins, E.C., Brown, W.T., HowardPeebles, P.N., Becchi, C., Cummings, E., Fallon, L., Seitz, S., Black, S.H., Vianna-Morgante, A.M., Costa, S.S., Otto, P.A., Mingroni-Netto, R.C., Murray, A., Webb, J., MacSwinney, F., Dennis, N., Jacobs, P.A., Syrrou, M., Georgiou, I., Patsalis, P.C., Giovannucci Uzielli, M.L., Guarducci, S., Lapi, E., Cecconi, A., Ricci, U., Ricotti, G., Biondi, C., Scarselli, B., and Vieri, F.
9.5.18 Supplement 80
Current Protocols in Human Genetics
1999. Fragile X premutation is a significant risk factor for premature ovarian failure: The International Collaborative POF in Fragile X studypreliminary data. Am. J. Med. Genet. 83:322325. Brown, T. 1999. Southern blotting. Curr. Protoc. Mol. Biol. 68:2.9.1-2.9.20. Brown, W.T., Houck, G.E. Jr., Jeziorowska, A., Levinson, F.N., Ding, X., Dobkin, C., Zhong, N., Henderson, J., Brooks, S., and Jenkins, E.C. 1993. Rapid fragile X carrier screening and prenatal diagnosis using a nonradioactive PCR test. J. Am. Med. Assoc. 270:1569-1575. Crawford, D.C., Acu˜na, J.M., and Sherman, S.L. 2001. FMR1 and the fragile X syndrome: Human genome epidemiology review. Genet. Med. 3:359-371. Cummins, J.H. 1997. The unique alteration of electrophoretic mobility of fragile-X-expanded fragments in the presence of ethidium bromide. Elsevier Trends Journals Technical Tips Online T01054, May 14, 1997. Fu, Y.H., Kuhl, D.P.A., Pizzuti, A., Pieretti, M., Sutcliffe, J.S., Richards, R., Verkerk, A., Holden, J.J.A., Fenwick, R.G. Jr., Warren, S.T., Oostra, B.A., Nelson, D.L., and Caskey, C.T. 1991. Variation of the CGG repeat at the fragile X site results in genetic instability: Resolution of the Sherman paradox. Cell 67:10471058. Hagerman, R.J., Leehey, M., Heinrichs, W., Tassone, F., Wilson, R., Hills, J., Grigsby, J., Gage, B., and Hagerman, P.J. 2001. Intention tremor, parkinsonism, and generalized brain atrophy in male carriers of fragile X. Neurology 57:127130. Houdayer, C., Lourdaux, J., Billette de Villemeur, T., Royer-Legrain, G., Bahuau, M., Bonnefont, J.P., Feldman, D., and Courderc, R. 2002. Simple fluorescent PCR assay for discriminating FRAXA fully mutated females from normal homozygotes. Genet. Test. 6:135-139. Kramer, M.F. and Coen, D.M. 2001. Enzymatic amplification of DNA by PCR: Standard procedures and optimization. Curr. Protoc. Mol. Biol. 56:15.1.1-15.1.14. Lyon, E., Laver, T., Yu, P., Jama, M., Young, K., Zoccoli, M., and Marlowe, N. 2010. A simple, high-throughput assay for Fragile X expanded alleles using triple repeat primed PCR and capillary electrophoresis. J. Mol. Diagn. 12:505511. Nolin, S.L., Lewis, F.A., Ye, L.L., Houck, G.E. Jr., Glicksman, A.E., Limprasert, P., Li, S.Y., Zhong, N., Ashley, A.E., Feingold, E., Sherman, S.L., and Brown, W.T. 1996. Familial transmis-
sion of the FMR1 CGG repeat. Am. J. Hum. Genet. 59:1252-1261. Nolin, S.L., Brown, W.T., Glicksman, A., Houck, G.E. Jr., Gargano, A.D., Sullivan, A., Biancalana, V., Brondum-Nielsen, K., Hjalgrim, H., Holinski-Feder, E., Kooy, F., Longshore, J., Macpherson, J., Mandel, J.L., von Koskull, H., and Sherman, S.L. 2003. Expansion of the fragile X CGG repeat in females with premutation or intermediate alleles. Am. J. Hum. Genet. 72:454464. Orrico, A., Galli, L., Plewnia, K., Dotti, M.T., Censini, S., and Federico, A. 1998. Mosaicism for full mutation and normal sized allele of the FMR1 gene: A new case report. Am. J. Med. Genet. 78:431-434. Pergolizzi, R.G., Erster, S.H., Goonewardena, P., and Brown, W.T. 1992. Detection of full fragile X mutations by polymerase chain reaction. Lancet 339:271-272. Perry-O’Keefe, H. and Kissinger, C.M. 1994. Chemiluminescent detection of nonisotopic probes. Curr. Protoc. Mol. Biol. 26:3.19.13.19.8. Rousseau, F., Heitz, D., Biancalana, V., Blumenfeld, S., Kretz, C., Bou, J., Tommerup, N., Van Der Hagen, C., DeLozier-Blanchet, C., Croquette, M.-F., Gilgenkrantz, S., Jalbert, P., Voelckel, M.-A., Oberl, I., and Mandel, J.-L. 1991. Direct diagnosis by DNA analysis of the fragile X syndrome of mental retardation. New Engl. J. Med. 325:1673-1681. Sherman, S., Pletcher, B.A., and Driscoll, D.A. 2005. Fragile X syndrome: Diagnostic and carrier testing. Genet. Med. 7:584-587. Spector, E.B. and Kronquist, K.E. 2005. ACMG standards and guidelines for clinical genetics laboratories, 2005. Available at http://www.acmg.net. Tassone, F., Pan, R., Amiri, K., Taylor, A.K., and Hagerman, P.J. 2008. A rapid polymerase chain reaction-based screening method for identification of all expanded alleles of the fragile X (FMR1) gene in newborn and high-risk populations. J. Mol. Diagn. 10:43-49. Verkerk, A.J.M.H., Pieretti, M., Sutcliffe, J.S., Fu, Y.H., Kuhl, D.P.A., Pizzuti, A., Reiner, O., Richards, S., Victoria, M.F., Zhang, F., Eussen, B.E., van Ommen, G.J.B., Blonden, L.A.J., Riggins, G.J., Chastain, J.L., Kunst, C.B., Galjaard, H., Caskey, C.T., Nelson, D.L., Oostra, B.A., and Warren, S.T. 1991. Identification of a gene (FMR1) containing a CGG repeat coincident with a breakpoint cluster region exhibiting length variation in fragile X syndrome. Cell 65:905-914.
Clinical Molecular Genetics
9.5.19 Current Protocols in Human Genetics
Supplement 80
UNIT 9.5
Monica J. Basehore1 and Michael J. Friez1 1
Greenwood Genetic Center, Greenwood, South Carolina
ABSTRACT The gene responsible for Fragile X syndrome, fragile X mental retardation-1 (FMR1), contains an unstable sequence of CGG trinucleotide repeats in its promoter region. Expansions of >200 trinucleotide repeats are considered full mutations and typically lead to abnormal methylation of the region, resulting in loss of FMR1 expression. Males with loss of FMR1 protein are expected to be affected by Fragile X syndrome, while females may or may not clinically manifest features of the condition. The protocols in this unit outline the complementary use of polymerase chain reaction (PCR) and methylation-sensitive Southern blot hybridization to accurately measure trinucleotide repeat size and methylation status. These protocols are also used to evaluate CGG repeat size in two adult-onset conditions known for their association with FMR1 premutation alleles, Fragile X Tremor/Ataxia (FXTAS) syndrome and Premature Ovarian Failure C 2014 by John Wiley & Sons, Inc. (POF). Curr. Protoc. Hum. Genet. 80:9.5.1-9.5.19. Keywords: Fragile X r molecular r diagnostic r clinical r testing
INTRODUCTION Fragile X syndrome is the most common form of inherited mental retardation, and virtually all clinical testing for this condition revolves around the determination of the length of the CGG repeat tract in the 5-prime untranslated region of the fragile X mental retardation-1 (FMR1) gene (see Fig. 9.5.1). This is one of the most common genetic tests ordered by clinicians for individuals with intellectual disability and/or autism, and CGG repeat size ranges from a relatively small number of repeats in normal individuals to a much greater number of repeats in affected and carrier individuals. FMR1 mutations other than expansion of the CGG trinucleotide tract are known, but reports of these alterations are scarce. Since point mutations and large gene deletions collectively account for 5.8 kb
full mutation EcoRI
EcoRI
(Eagl)
Figure 9.5.1 The fragile X region with normal, premutation, and full mutation CGG repeats. The CGG repeat region is represented by a jagged line. Restriction sites are indicated by solid arrows for EcoRI and a dashed arrow for methylation-sensitive EagI. Full mutation alleles are typically methylated and are resistant to digestion at the EagI site.
StB12.3 Ox1.9 Ox0.55 pE5.1
Eco RI
PstI
XhoI
PstI
PstI
Eco RI
EagI
Figure 9.5.2 Restriction map of the fragile X region. Probes used in Southern analysis of the region are shown.
but this seems to be readily available in most well-equipped molecular laboratories. The PCR method described in Basic Protocol 2 is an earlier version of the procedure, and is based on the separation of PCR products with polyacrylamide gel electrophoresis and hybridization with a labeled CGG-repeat oligonucleotide. For the sake of completeness, and because the method is still in use in some laboratories, we have retained the original PCR method as Basic Protocol 2, while the newer fluorescent PCR method is provided in Basic Protocol 1.
Molecular Analysis of Fragile X Syndrome
Basic Protocol 3 describes Southern analysis of genomic DNA digested with a pair of restriction enzymes, one of which is sensitive to DNA methylation (Fig. 9.5.2). PCR analysis of the CGG repeat region is much faster than Southern analysis and accurately determines the size of normal, intermediate, and most premutation-sized alleles (Fig. 9.5.3). PCR analysis also detects small changes in repeat number from one
9.5.2 Supplement 80
Current Protocols in Human Genetics
90
A
150
130
110
170
28000 20000 12000 4000
B
148
18000 14000 10000 6000 2000
C
148
130
20000 16000 16000 12000 4000
145 148 300
260
D
360
340
380
400
240 200 160 120 80 40 282
E
1
2
3
4
5
6
7
8
9
10
11
12
13 CGG repeats 155
82
60
28
Figure 9.5.3 Top: Fluorescent PCR (Basic Protocol 1) electropherogram traces for (A) a normal male with 31 repeats, (B) a normal female with 25 and 31 repeats, (C) a normal female with 30 and 31 repeats, and (D) a male with a premutation-sized allele of 75 repeats. (E) PCR analysis (Basic Protocol 2) of the FMR1 CGG repeat in the general population and in families with Fragile X. Lane 1: premutation male with 115 repeats. Lane 2: normal male with 29 repeats. Lane 3: normal male with 30 repeats. Lanes 4 to 6: family with Fragile X including premutation mother with 30 and 95 repeats (lane 4); full mutation female fetus with 31 and >200 repeats (lane 5); and normal father with 31 repeats (lane 6). Lanes 7 to 9: family with Fragile X: normal father with 30 repeats (lane 7); prenatal sample of normal female fetus with 27 and 30 repeats (lane 8); and premutation mother with 27 and 145 repeats (lane 9). Lane 10: normal male with 33 repeats. Lane 11: full mutation male with >200 repeats. Lane 12: negative control with no DNA. Lane 13: size standard (pBR322 digested with MspI) with corresponding CGG repeat numbers shown.
Clinical Molecular Genetics
9.5.3 Current Protocols in Human Genetics
Supplement 80
generation to another. Substitution of 7-deaza-2 -dGTP for dGTP in PCR reactions allows for the potential amplification of some full mutations, which is typically unsuccessful with standard PCR protocols. Both PCR and Southern analyses are routinely utilized to provide complementary information that reliably determines the length of the FMR1 trinucleotide repeat. Basic Protocol 4 describes the use of triplet repeat-primed PCR (TRP-PCR) to screen for the presence or absence of an expansion mutation. The triplet repeat-primed FMR1 PCR assay described here makes use of a fluorescently labeled primer and capillary gel electrophoresis, thereby increasing the ease and certainty with which results can be interpreted (Lyon et al., 2010; Fig. 9.5.5). The commercial FMR1 TRP-PCR assays that are currently available include the Abbott Molecular FMR1 PCR assay and the Asuragen AmplideX FMR1 mPCR kit. Basic Protocol 4 specifically describes the use of Abbott Molecular’s TRP-PCR assay. NOTE: Experiments involving PCR require extremely careful technique to prevent contamination (see APPENDIX 2D). BASIC PROTOCOL 1
FMR1 TRINUCLEOTIDE FLUORESCENT PCR AMPLIFICATION USING CAPILLARY GEL ELECTROPHORESIS The use of fluorescently labeled amplicons and capillary electrophoresis for determining the FMR1 trinucleotide repeat length has become the PCR method of choice for most laboratories.
Materials No-template control (NTC) Positive control with a known CGG repeat length 6 M betaine (Sigma) 10× PCR Gold Buffer (Applied Biosystems) 25 mM MgCl2 (Applied Biosystems) Deoxynucleotides (dNTPs; 3 mM each dATP and dTTP, 0.75 mM each dCTP and dGTP) 7-deaza-2 -deoxyguanosine 5 -triphosphate (5 mM) Forward primer: (100 ng/μl) 5 GACGGAGGCGCCGCTGCCAGG Reverse primer: (100 ng/μl) 5 GTGGGCTGCGGGCGCTCGAGG (FAM-labeled) Dimethyl sulfoxide (DMSO; Sigma) 5 U/μl AmpliTaq Gold DNA polymerase (Applied Biosystems) Purified DNA sample (APPENDIX 3B) in 10 mM Tris·Cl, pH 7.5 (APPENDIX 3D)/1 mM EDTA Hi-Di Formamide (Applied Biosystems) LIZ fluorescent size standard (Applied Biosystems) 1.5-ml sterile microcentrifuge tube Sterile PCR tubes/plate Thermal cycler Applied Biosystems 3100/3130 or 3730 Genetic Analyzer or other appropriate capillary gel electrophoresis system
Molecular Analysis of Fragile X Syndrome
Amplify the CGG repeat region (25 μl total reaction volume) 1. Prior to setting up, be sure to include reactions for proper controls as deemed necessary. At minimum, these should include a no-template control (NTC) and at least one positive control with a known CGG repeat length.
9.5.4 Supplement 80
Current Protocols in Human Genetics
Including a control with a premutation-sized allele and a female with two distinct alleles is highly recommended.
2. Prepare PCR cocktail mix in a 1.5-ml microcentrifuge tube by combining the following for each reaction: 13.5 μl 2.5 μl 2 μl 1.7 μl 0.8 μl 1.0 μl 1.0 μl 1.0 μl 0.5 μl
6 M Betaine 10× PCR Gold Buffer 25 mM MgCl2 dNTPs (3 mM dATP/dTTP, 0.75 mM dCTP/dGTP) 7-deaza-2 -Deoxyguanosine Forward primer (100 ng/μl) Reverse primer (100 ng/μl) DMSO AmpliTaq Gold DNA polymerase (5 U/μl).
For 55 CGG repeats) male expanded allele
expanded allele (> 55 CGG repeats)
ladder motif
Figure 9.5.5 Triplet repeat-primed FMR1 PCR screening test for FMR1 CGG alleles (Basic Protocol 4). The forward PCR primer is located upstream of the FMR1 CGG region while the fluorescently labeled reverse primer randomly binds inside the FMR1 CGG repeat region. These PCR primers generate different sized amplicons depending on the size of the CGG repeat region present. The presence or absence of a trinucleotide “ladder” that extends beyond a threshold of 55 CGG repeats can be easily recognized and is typically used to identify expanded FMR1 alleles. Example 1 shows the trace for a female with two normal alleles, neither of which results in the characteristic ladder motif present for expanded alleles. Example 2 illustrates the typical pattern for a female with one normal allele and one expanded allele while Example 3 illustrates the typical pattern for a male with an expansion at the FMR1 locus.
Thermal cycler 96-well plates Applied Biosystems 3730 Genetic Analyzer or other appropriate capillary gel electrophoresis system Amplify the CGG repeat region 1. Prior to setting up, be sure to include reactions for proper controls as deemed necessary. At minimum, these should include a no-template control (NTC), a normal control, a control with a premutation-sized allele, and a control with a full mutation. 2. Prepare a PCR cocktail mix in a 1.5-ml microcentrifuge tube by combining the following for each reaction: 7.8 μl High GC PCR Buffer 0.5 μl FMR1 Primers-2 0.7 μl TR PCR Enzyme Mix 1.2 μl DNase/RNase free water. For 99% of these mutations are expansions of a CGG trinucleotide repeat in the 5-prime noncoding region of the gene. These expansions lead to abnormal methylation of the FMR1 promoter region that results in transcriptional silencing of the gene (Rousseau et al., 1991). This syndrome is also associated with a folatesensitive fragile site at Xq27.3 in a variable proportion of cells. Prior to the delineation of the causative FMR1 trinucleotide expansions, cytogenetic testing for the presence of such fragile sites at the tip of the long arm of the X chromosome was originally used as a diagnostic tool for evaluating patients. Since some affected individuals show fragile-site expression in >70% of their cells while others demonstrate this expression in 5.8 kb. Occasionally, a full mutation will be partially methylated, yielding unmethylated fragments between 3.4 kb and 5.1 kb, in addition to the standard methylated fragments >5.8 kb. Analysis of a Fragile X family by hybridization with StB12.3 is illustrated in Figure 9.5.4. Triplet repeat-primed PCR for expansion screening The triplet repeat-primed PCR assay described here is able to identify all sizes of CGG repeats in the FMR1 gene. Briefly, a pair of PCR primers generates different-sized amplicons depending on the size of the CGG repeat region. The forward PCR primer is located upstream of the FMR1 CGG region while the fluorescently labeled reverse primer binds within the CGG region. A threshold set at 55 CGG repeats is typically used to distinguish between normal and expanded FMR1 alleles. The size in basepairs of the threshold is calculated using the following formula: #CGG repeats = (peak size in basepairs-134)/3, which is based on the primer binding sites and the number of basepairs in the amplicon excluding CGG repeats. The sample is considered normal if the largest amplicon in the CGG repeat ladder visualized by the electropherogram does not pass the threshold (200 repeats. Using either PCR protocol, normal-sized alleles can be resolved within 1 repeat unit and premutations can be sized to within 2 to 5 repeat units. While some full mutations in males may be amplified by PCR, the number of full mutation repeats must be estimated by Southern analysis. As previously mentioned, the interpretation of PCR analysis for females can be complex. First, a female may have either the same number of repeats or two different-sized repeats on each X chromosome. Second, preferential amplification of smaller repeats may occur, and this is commonly observed for females
Clinical Molecular Genetics
9.5.17 Current Protocols in Human Genetics
Supplement 80
Table 9.5.1 Expected Sizes of Bands in Southern Analysis of FMR1 Genotypes
Normal male Normal female Premutation malea Premutation femalea Full mutation male Full mutation female Mosaic pre/full mutation male Mosaic pre/full mutation femalea
2.8 kb √
2.9-3.4 kb
√
5.2 kb
5.3-5.8 kb
>5.8 kb
√ √
√
√
√
√ √
√
√
√
√ √
√
√ √
√
√
a The
ability to readily distinguish bands of 5.2 kb from others that are only slightly larger may be difficult, and is often dependent on the length of time and the size of gel used to separate the fragments. Additionally, it should be noted that the expected size pattern listed here for females is based on having a random X-inactivation pattern. Should a female have a skewed pattern of X-inactivation, the banding pattern on the Southern blot may be altered slightly from that listed above. Perhaps the most noticeable variation is the intensity of the premutation banding pattern in females with skewed X-inactivation. Skewed X-inactivation can often be inferred in females when the intensity of the methylated (5.35.8 kb) and unmethylated (2.9-3.4 kb) premutation bands differs significantly. Those interpreting FMR1 Southern blots must be cognizant of subtle variations in pattern given the possibilities of FMR1 deletions, unmethylated full mutations, and skewed X-inactivation in females.
with alleles of significantly different repeat sizes. Third, when denaturing polyacrylamide gels are used (as in Basic Protocol 2), a heteroduplex of two different repeats sometimes appears as a third, larger repeat in the intermediate or premutation range. In any case of questionable allele sizing, Southern analysis should be performed to confirm the correct FMR1 genotype. For Southern analysis using an EcoRI/EagI double digestion, the expected size of bands is shown in Table 9.5.1. It should also be noted that the high degree of repeat instability occurring in Fragile X might result in unusual or complex molecular patterns in both PCR and Southern analyses. For example, there have been reported cases of males with full mutations who also carry a normal or intermediate-sized repeat in some proportion of their cells (Nolin et al., 1996; Orrico et al., 1998). In addition, although some of the newer PCR protocols have the potential to amplify large full mutations, the size heterogeneity of these expansions interfere with making a definitive diagnosis without confirming by Southern analysis. Until PCR is able to accurately identify large expansions without compromising the ability to determine size and methylation mosaicism, Southern blot analysis will continue to be a standard procedure in the diagnosis of Fragile X syndrome. Molecular Analysis of Fragile X Syndrome
Time Considerations For Basic Protocol 1, the PCR amplification takes 3 hr for assay set up and time in
the thermal cycler. Capillary run times typically range from 30 to 90 min depending on the platform, length of capillary, and polymer used. The PCR amplification procedure in Basic Protocol 2 takes 3 hr; electrophoresis, transfer, and hybridization take 7 hr; and chemiluminescent film exposure times range from 30 min to overnight. Southern blot hybridization analysis with the probe StB12.3 takes 5 to 14 days. The greatest variables are the times used for restriction digestion, electrophoresis, DNA transfer to membrane, and exposure to film. Southern blot analysis can be accelerated to 3 to 5 days when certain procedures are not required to run overnight. For Basic Protocol 4, the PCR amplification takes 3 hr for assay set up and time in the thermal cycler. Capillary run times typically range from 30 to 90 min, depending on the platform, length of capillary, and polymer used.
Literature Cited Allingham-Hawkins, D.J., Babul-Hirji, R., Chitayat, D., Holden, J.J., Yang, K.T., Lee, C., Hudson, R., Gorwill, H., Nolin, S.L., Glicksman, A., Jenkins, E.C., Brown, W.T., HowardPeebles, P.N., Becchi, C., Cummings, E., Fallon, L., Seitz, S., Black, S.H., Vianna-Morgante, A.M., Costa, S.S., Otto, P.A., Mingroni-Netto, R.C., Murray, A., Webb, J., MacSwinney, F., Dennis, N., Jacobs, P.A., Syrrou, M., Georgiou, I., Patsalis, P.C., Giovannucci Uzielli, M.L., Guarducci, S., Lapi, E., Cecconi, A., Ricci, U., Ricotti, G., Biondi, C., Scarselli, B., and Vieri, F.
9.5.18 Supplement 80
Current Protocols in Human Genetics
1999. Fragile X premutation is a significant risk factor for premature ovarian failure: The International Collaborative POF in Fragile X studypreliminary data. Am. J. Med. Genet. 83:322325. Brown, T. 1999. Southern blotting. Curr. Protoc. Mol. Biol. 68:2.9.1-2.9.20. Brown, W.T., Houck, G.E. Jr., Jeziorowska, A., Levinson, F.N., Ding, X., Dobkin, C., Zhong, N., Henderson, J., Brooks, S., and Jenkins, E.C. 1993. Rapid fragile X carrier screening and prenatal diagnosis using a nonradioactive PCR test. J. Am. Med. Assoc. 270:1569-1575. Crawford, D.C., Acu˜na, J.M., and Sherman, S.L. 2001. FMR1 and the fragile X syndrome: Human genome epidemiology review. Genet. Med. 3:359-371. Cummins, J.H. 1997. The unique alteration of electrophoretic mobility of fragile-X-expanded fragments in the presence of ethidium bromide. Elsevier Trends Journals Technical Tips Online T01054, May 14, 1997. Fu, Y.H., Kuhl, D.P.A., Pizzuti, A., Pieretti, M., Sutcliffe, J.S., Richards, R., Verkerk, A., Holden, J.J.A., Fenwick, R.G. Jr., Warren, S.T., Oostra, B.A., Nelson, D.L., and Caskey, C.T. 1991. Variation of the CGG repeat at the fragile X site results in genetic instability: Resolution of the Sherman paradox. Cell 67:10471058. Hagerman, R.J., Leehey, M., Heinrichs, W., Tassone, F., Wilson, R., Hills, J., Grigsby, J., Gage, B., and Hagerman, P.J. 2001. Intention tremor, parkinsonism, and generalized brain atrophy in male carriers of fragile X. Neurology 57:127130. Houdayer, C., Lourdaux, J., Billette de Villemeur, T., Royer-Legrain, G., Bahuau, M., Bonnefont, J.P., Feldman, D., and Courderc, R. 2002. Simple fluorescent PCR assay for discriminating FRAXA fully mutated females from normal homozygotes. Genet. Test. 6:135-139. Kramer, M.F. and Coen, D.M. 2001. Enzymatic amplification of DNA by PCR: Standard procedures and optimization. Curr. Protoc. Mol. Biol. 56:15.1.1-15.1.14. Lyon, E., Laver, T., Yu, P., Jama, M., Young, K., Zoccoli, M., and Marlowe, N. 2010. A simple, high-throughput assay for Fragile X expanded alleles using triple repeat primed PCR and capillary electrophoresis. J. Mol. Diagn. 12:505511. Nolin, S.L., Lewis, F.A., Ye, L.L., Houck, G.E. Jr., Glicksman, A.E., Limprasert, P., Li, S.Y., Zhong, N., Ashley, A.E., Feingold, E., Sherman, S.L., and Brown, W.T. 1996. Familial transmis-
sion of the FMR1 CGG repeat. Am. J. Hum. Genet. 59:1252-1261. Nolin, S.L., Brown, W.T., Glicksman, A., Houck, G.E. Jr., Gargano, A.D., Sullivan, A., Biancalana, V., Brondum-Nielsen, K., Hjalgrim, H., Holinski-Feder, E., Kooy, F., Longshore, J., Macpherson, J., Mandel, J.L., von Koskull, H., and Sherman, S.L. 2003. Expansion of the fragile X CGG repeat in females with premutation or intermediate alleles. Am. J. Hum. Genet. 72:454464. Orrico, A., Galli, L., Plewnia, K., Dotti, M.T., Censini, S., and Federico, A. 1998. Mosaicism for full mutation and normal sized allele of the FMR1 gene: A new case report. Am. J. Med. Genet. 78:431-434. Pergolizzi, R.G., Erster, S.H., Goonewardena, P., and Brown, W.T. 1992. Detection of full fragile X mutations by polymerase chain reaction. Lancet 339:271-272. Perry-O’Keefe, H. and Kissinger, C.M. 1994. Chemiluminescent detection of nonisotopic probes. Curr. Protoc. Mol. Biol. 26:3.19.13.19.8. Rousseau, F., Heitz, D., Biancalana, V., Blumenfeld, S., Kretz, C., Bou, J., Tommerup, N., Van Der Hagen, C., DeLozier-Blanchet, C., Croquette, M.-F., Gilgenkrantz, S., Jalbert, P., Voelckel, M.-A., Oberl, I., and Mandel, J.-L. 1991. Direct diagnosis by DNA analysis of the fragile X syndrome of mental retardation. New Engl. J. Med. 325:1673-1681. Sherman, S., Pletcher, B.A., and Driscoll, D.A. 2005. Fragile X syndrome: Diagnostic and carrier testing. Genet. Med. 7:584-587. Spector, E.B. and Kronquist, K.E. 2005. ACMG standards and guidelines for clinical genetics laboratories, 2005. Available at http://www.acmg.net. Tassone, F., Pan, R., Amiri, K., Taylor, A.K., and Hagerman, P.J. 2008. A rapid polymerase chain reaction-based screening method for identification of all expanded alleles of the fragile X (FMR1) gene in newborn and high-risk populations. J. Mol. Diagn. 10:43-49. Verkerk, A.J.M.H., Pieretti, M., Sutcliffe, J.S., Fu, Y.H., Kuhl, D.P.A., Pizzuti, A., Reiner, O., Richards, S., Victoria, M.F., Zhang, F., Eussen, B.E., van Ommen, G.J.B., Blonden, L.A.J., Riggins, G.J., Chastain, J.L., Kunst, C.B., Galjaard, H., Caskey, C.T., Nelson, D.L., Oostra, B.A., and Warren, S.T. 1991. Identification of a gene (FMR1) containing a CGG repeat coincident with a breakpoint cluster region exhibiting length variation in fragile X syndrome. Cell 65:905-914.
Clinical Molecular Genetics
9.5.19 Current Protocols in Human Genetics
Supplement 80
