Copyright 0 1992 by the Genetics Society of America

Molecular Analysis of Ac Transposition and DNA Replication Jychian Chen*” IrwinM. Greenblattt and Stephen L. Dellaporta*94 *Department of Biology, Yale University, New Haven, Connecticut 0651 1-7444, and tMolecular and Cell Biology Department, University of Connecticut, Storrs, Conneciticut 06269-2131

Manuscript receivedMay 22, 1991 Accepted for publication November 28, 199I ABSTRACT Molecular events associated with transposition of the mobile element Activator (Ac) from the P locus in daughter lineagesof twinned sectors. Genetic and molecular analyses of maize have been examined indicate that the donor Ac has excised from only one of the two daughter chromosomes in these lineages. Cloning and sequence analyses of target sites on daughter chromosomes indicate that Ac insertion can occur either before or after the completionof DNA replication. Transpositions froma replicated donor siteto both unreplicated and replicated target sites imply that most transpositions of Ac occur duringor shortly after theS phase of the cell cycle.

T

HE maize controllingelement Activator (Ac) (MCCLINTOCK 1948)is capable of transposition and transactivation of nonautonomous Dissociation (Ds)elements. Most information on the transposition mechanism of Ac is from genetic studiesat theP locus. T h e P-RR allele of the P locus conditions red pigmentation of the cob and pericarp. An unstable P allele, P-W:Emerson(P-W:E), conditionsvariegatedpericarp and cob (EMERSON19 14). The allele has two components: the P-RR gene and an inserted Ac element, previously referred toasModuZator ( M p )(BRINK and NILAN1952;BARCLAY and BRINK1954).The Ac inserted in the P - W : E allele suppresses P function causing a colorless pericarp phenotype. Ac excision restores P-RR gene action and somatic red sectors of different sizes arise, causing avariegatedpericarp phenotype known as medium variegated. Pericarp is maternally derived tissue that shares a common lineage with the underlying female megaspore. Hence, somatic events, such as transpositions in this lineage, canbe visualizedin the pericarp and subsequently recovered in the underlying kernel offspring for genetic and molecular analysis. Ac elements interact so that when more than oneAc is in the same nucleus, there is a delay in transposition (MCCLINTOCK 1948, 1949). A second active Ac element in addition to the P - W : E allele causes a reduction in pericarp striping to a phenotype of few red stripes known as light variegated pericarp (BRINKand NILAN1952).On medium variegated ears,early transpositions of Ac result in large sectors overlaying multiple kernels of red and light variegated pericarp.Most frequently, red and light variegated sectors are contiguous and referred to as twin mutations (GREEN-

’ Present

Address: Institute of Molecular Biology, Academica Sinica, i, Taiwan. G o whom correspondence should be addressed.

Tai

Genetics 1 3 0 665-676 (March, 1992)

BLATT 1974) (Figure 1A). Genetic and molecular analysis of twin mutations has shown that cotwin sectors are derived from a single transposition event of Ac (GREENBLATT and BRINK 1962; CHEN,GREENBLATT and DELLAPORTA 1987). Twinmutations are of two types based onthe presence or absence of Ac activity in the red sector (Figure 1, B and C ) . In the majority of twincases, approximately 2/3 to 3/4 of all twins, the red sector contains Ac (GREENBLATT and BRINK1962; GREENBLATT 1984).These events, referred toas type I twins, may be derived by excision of one copy of Ac after replication of the P - W : E complex and its insertion into an unreplicated target site. The transposed Ac (tr-Ac) replicates at the targetsite and segregates into both red and light variegated lineages (GREENBLATT and BRINK1962). In the remaining casesof twins, there is no detectable Ac activity in the red sector. These twins, referred to as type 11, may be derived by transposition of Ac into a regionof the DNA where it does not replicate a second time in the same mitotic cycle, such as a replicated target site (GREENBLATT and BRINK1962).Alternatively, selective inactivation of the tr-Ac mayoccur in the redlineage (GREENBLATT

1984). T o investigate the relationship between Ac transposition and the DNA replication process, we have examined Ac donor and target sites before and after Ac insertion at thelevel of Southern analysis, genomic cloning and sequencing. In type I twins, we show that Ac is excised from one chromatid after DNA replication and the transposed element is present in both daughter chromosomes at identical sites. Our results also demonstrate thatAc is absent fromthe red cotwin sector of type I1 twins. Furthermore,there is no molecular indication that was Once present but selectively lost in a type I1 red cotwin sector. These

J. Chen, I. M. Greenblatt and S . L. Dellaporta

666

I

FIGURE 1.-Type I and type I1 twin sectors. (A) Twin mutation. Medium variegated ear derived from female plants (P-VV/P-WR r-g/r-g) pollinated with male homozygous P-WR r-sc:m3 tester. The large red sector is contiguous with the light variegated cotwin. The variegated aleurone response (purple spotted aleurone) in kernel offspring indicatesthe presence of Ac activity. (B) Type I red sector kernels. Kernels from a type I red pericarp sector show an r-sc:m3 response (spotted aleurone) in half of the kernel progeny indicating the presence of a heterozygous tr-Ac in the red lineage. (C) Type I1 red sector kernels. Kernels from a type I1 red pericarp sector show no r-sc:m3 response (colorless aleurone) in all kernel offspring indicatingno tr-Ac activity is presentin the red cotwin.

TABLE 1

List of alleles used in this study Allele

P-W P-WW P-WR r-sc:m3 r-r

r-g

Phenotype

Variegated pericarp and cob pericarp White and cob pericarp, White red cob Colorless aleurone without Ac Ac Variegated aleurone with Colorless seed, plant red (anthers and coleoptile) Colorless seed and plant

Inbred

4Co63 4Co63 w22 w22 4Co63 w22

results havegeneral implications concerningthe transposition process a n d its coupling to DNA replication. MATERIALS AND METHODS

Genetic methods:The alleles used in thisstudy are listed in Table 1. T o recover new twin mutations, medium variegated ears were generated from two crosses:(1)P-W/P-WW r-r/r-r females X P-WW/P-WW r-rlr-r males in the inbred genetic background 4Co63. These earswere scored for twin mutations of contiguous light variegated and red pericarp sectors. Only twin sectors covering at least 10 kernels were used for this analysis.Twin mutations were classified as type I or type I1 by growing 10 kernels from the red cotwin sector and testcrossing these plants as females to P-WR/PW R r-sc:m3/r-sc:m3 males. A variegated aleurone response in any kernel progeny of these crosses indicates the presence of a tr-Ac in the red cotwin lineage (type I twin). The twin mutation was classified as type I1 if none of the red cotwin

progeny exhibited tr-Ac activity by this test. (2)P-W/P-WR r-g/r-g females (4Co63/W23 hybrid) were crossedto P-WR/ P-WR r-sc:m3/r-sc:m3 males(W22 inbred). The resultant medium variegated ears were examined for twin mutations. An example of these crosses is shownin Figure 1A. T o classify the twin, the red sector was examined for r-sc:m3 response. Type I twins were detected by segregation of the tr-Ac resulting in variegated aleurones in kernels underlying the red sector (Figure 1B). Type I1 twins showedno r-sc:m3 response in the underlying kernels (Figure 1C). DNA extraction and Southernhybridizations: Total genomic DNA was extracted in urea buffer (UB: 7 M urea, 0.3 M NaCI, 0.05 M Tris-HC1, pH 8.0, 0.02 M EDTA, and 1%N-lauryl sarcosyl)(SHURE,WESSLER and FED~ROFT 1983) from 1 g of leaf tissue of 2-week-old seedlings as follows: after freezing withliquid nitrogen, the leaftissue was ground to a fine powder in amortar andpestle. The frozen powder was transferred to 6 ml of UB, vigorously shaken, and incubated at 60" for 5 min.An equal volumeof pheno1:chloroform (1:1) was added, the mixture was vigorously shaken then centrifuged at 6000 X g for 5 min. The aqueous supernatant was filtered through Miracloth (Calbiochem) and theDNA was precipitated with an equal volume of isopropyl alcohol.The DNA fibers were removed with a sterile glass hook into a microfuge tube andrinsed with one ml of 80% ethanol, air dried, and redissolved in 500 pl of 10 mM Tris, pH 8, 1 m~ EDTA (TE). Then 50 pl of 3 M sodium acetate were addedandthe DNA solution was precipitated with an equal volumeofisopropylalcohol, briefly spun to pellet the DNA, rinsed with 80% ethanol, air dried andredissolved in 200pl of TE. The final concentration ofDNA was approximately 0.5 pg/pl.Approximately 3 pg (6pl) of total genomic DNA were digested with a threefold excess of restriction enzyme according to man-

Ac Transposition and DNA Replication

ufacturer's instructions.Agarose gel electrophoresis and Southern blot hybridizations were performed essentially as previously described (CHOMET, WESSLER and DELLAPORTA 1987). Probe DNAwas radioactivelylabeledwith ["PI dATP using the random oligonucleotide priming method (FEINBERG and VOCEUTEIN 1984). The Ac probe used for Southern analysiscorresponds to the 1.6-kbinternal Hind111 WESSLER and SHURE1983). fragment of Ac9 (FEDOROFF, Genomic cloning and DNA sequencing: The appropriate restriction fragment of genomic DNA was isolated from genomic libraries constructed in the X vector, XDash 11 (Stratagene, Inc.), asfollows: 2 r g of restriction enzymedigested genomic DNAwas ligated to 2 r g of restriction enzyme-digested X DNA according to standard protocols (SAMBROOK, FRITSCH and MANIATIS1989) and the ligation mixture was in vitro packaged according to published procedures (HOHN1979). The phage was plated on Escherichia coli strain K803 and the libraries were screened with the appropriate radioactively labeled probes essentially as describedelsewhere (SAMBROOK, FRITSCHand MANIATIS 1989). DNAwas isolated from plaque-purified X clones according to standard protocols (SAMBROOK, FRITSCH and MANIATIS1989). Restriction fragments were subclonedinto the plasmid vector pBS+ (Stratagene). Polymerasechain reaction (PCR)amplification of genomic or cloned DNA was done in a 5O-pl reaction volume containing 67 mM Tris, pH 8.8, 3 mM MgC12, 16.6 mM (NH4)nS04,50 pmolof each primer, and 1 r g template DNA. The reaction cycle conditions were94" 2 min, 45" 1 min, 65" 2 min, then 40 cyclesof 94" 1 min, 45" 1 min, 65" 2 min, and last cycle at 94" 1 min, 45" 1 min and 65" for 7 min. The PCR products were separated by electrophoresis on 5% polyacrylamide gels and fragments were isolated by electroelution (DREZTEN et al. 1981) for either cloning or direct sequencing.Double stranded DNAsequencing was performed by dideoxy-chain termination methods (SANGER, MIKLENand COULSON1977) withSequenase (U.S. Biochemical)according to the manufacturer's instructions. T o obtain the sequence of the target site in the parental chromosome and red cotwin of type I1 twin JC191, PCR amplificationusing two P oligonucleotide primers that flanked the target site, P677 (5"CGACACATGGATGGCAAGACAAAGT-3') andP678 (5"CATCAGCATCAGGCTTCCAGTCGAA-3'),were used to amplify a 300bp fragment. This fragment was sequenced after gel purification. The DNA sequence of the target site from the light variegated cotwin sector that contained the tr-Ac element was obtained by using the cloned 7.5-kb Sal1 fragment as a DNA sequencing template with Ac-specificprimers, SPl (5'GGATCGTATCGGTTTTCGATTACC3')and SP 17 (5'CGATAACGGTCGGTACGGGATTTTCC-3'). The light variegated cotwin donor site was sequenced by using the previouslycloned7.8-kb Sal1 fragment of P - W (CHEN, GREENBLATT and DELLAWRTA 1987) as sequencing template with the Ac primers SP1 and SP17. RESULTS

DNA sequence analysis of target sites in a type I twin: T h e majority of twin mutations contain transposed Ac (tr-Ac) activity in both red and light variegated daughter lineages (type I twins). Previous analyses of type I twin mutations have shown tr-Ac elements present in both cotwin lineages in the same genomic fragment (CHEN, GREENBLATT and DELLA-

667

If insertion preceded DNA replication, then sequences flanking the tr-Ac in both daughter lineages should be identical. To investigate this prediction, we identified tr-Ac elements from type I and type I1 twin mutationsby genetic and Southernanalysis and examined both donor and target sites. A type I twin (JC855) was investigated by Southern blot analysis (Figure 2). The donor Ac element at P , present on a 1l-kb SstI fragment, was detected in the DNA from the light variegated lineage (lane 3) but not in the progeny DNA of the red cotwin (lanes 4). Progeny from both red and light variegated cotwin lineages contained an additional 9.5-kbSstI fragment that hybridized to the Ac probe (lanes 3 and 4).This fragmentcosegregated with tr-Ac activity. Finding thatthis tr-Ac element was onthe samegenomic fragment in both daughter lineages agreed with our previousresults(CHEN,GREENBLATT and DELLAPORTA 1987). To determine target site sequences, the 9.5-kb SstI fragments from bothred and light-variegated cotwin lineages were cloned. Both clones contained the expected 9.5-kb SstI fragments with identical restriction maps and identical DNA sequences at the junctions between Ac and flanking DNA (Figure2B). The target site sequences contained an eightbase pair duplication GGCGAAACflankingthe tr-Ac elements in each clone. A flanking DNA probe (shown in Figure 2B) hybridized to the expected 9.5-kb Sstl fragments in DNA from both cotwins in addition to a sequence of low repetition (data not shown). Recombinant inbred maize lines (BURR et al. 1987) were probed with the flankingDNAfragment to determinethegenetic position of the tr-Ac target site. No recombination between the P locus and tr-Acwas detected by this analysis, indicatingtightlinkagebetweenthe tr-Ac element andthe P locus at chromosomal position1S-

PORTA 1987).

26. Molecular analysisof type I1 twin mutations: Geneticanalysesof twin sectorsindicatea class of twinnedeventsthat lack tr-Ac activity in the red lineage (typeI1 twins) (GREENBLATT and BRINK 1962). Two alternativepossibilities could lead to type I1 twin formation: (1) Ac could be absent in the red lineage; o r (2) Ac could be present but inactive in the red lineage. To distinguish between these alternatives, we first analyzed three type I1 twin mutations by Southern blot analysis using the methylation sensitive restriction enzyme, Pst I (Figure 3). Previously, we have shown that tr-Ac elements in type I twin sectors were found on hypomethylated genomic fragments (CHEN, GREENBLATT and DELLAPORTA 1987). Because of the hybrid nature of this material (see MATERIALS AND METHODS-cross11) methylationsensitiverestriction enyzmes were employed forthis analysis. By digesting genomic DNA with the methylation sensitive enzyme

J. Chen, I. M.Greenblatt and S. L. Dellaporta

668

A.

6. " "

.. . .

GTGCAACGGG GGCGAAAC TAGGGATGAAA, \

\

P-vv

--

-11.0 9.5

-

GGCGAAAC TAGGnGC-n 0

/

0

\

/

\

/

0

flanking probe

kb

tr-Ac

TCATCCCTG

RED sector

LIGHT VARIEGATED sector

..

-.-

-" .--

GTGCAACGGG GGCGAAAC TAGGGATGAAA, \

1

2

3

TCATCCCTG

GGCGAAAC TAGGITGCeT 0

/

\

/ /

4

FIGURE2.-Molecular analysis of a type I twin. (A)Southern blot analysis of a type I twin. A type I twin sector (JC855) was identified as described (MATERIALS AND METHODS). Genomic leaf DNA from the light variegated and redsector progeny containing the tr-Ac was isolated and digested with SstI, Southern blotted and probed with the Ac probe. The tr-Ac fragment contained on the 9.5-kb Sstl fragment is seen in both light variegated and red pericarp lineages (lanes 3 and 4). Only the light variegated lineage and parental P - W line contain the donor Ac at P - W on a 11-kb fragment (lanes 2 and 3). In each lane, multiple cryptic fragments are detected due to cross-hybridizationto the Ac probe. (B)Restriction map and DNA sequence flanking the tr-Ac in light variegated and red lineages from JC855 type I twin. The 1 I-kb SstI fragments from boththe light variegated and redlineages were cloned and restriction mapped with the enzymes shown. The location of the tr-Ac elements (cross-hatched boxes) is based on the position of restriction sites and Southern hybridization experiments (data not shown). A 0.85-kb SstI to KpnI restriction fragment (shaded box) was used as a hybridization probe to confirm that it did indeed detect the 11-kb SslI fragment in genomic DNA (data not shown). The DNA sequence flanking the tr-Ac in each SstI clone was determined using oligonucleotide primers asdescribed in MATERIALS AND METHODS. The sequence of the 11-bp terminal inverted repeats of Ac (shaded arrows) and 8-bp direct repeat of target sequence (black arrows) is shown for both clones. The identical restriction maps and corresponding sequences in each SstI f i g m e n t indicate a-common genetic origin of the two fragments.

PstI, the 15-20 genomic fragments that hybridize to Ac in this material were found in the high molecular weight fraction of DNA that is heavily methylated. In all three type I1 twins, a tr-Ac element was detected in the light variegated lineage on a hypomethylated genomic fragment (Figure 3, A-C, lane 4) but not detected in the red lineage (Figure 3, A-C, lane 3). Because PstI is methylation sensitive, however, it is possible that the tr-Ac fragment may be selectively methylated in the red lineage. This would place the tr-Ac in the high molecular weight fraction of genomic DNA, resulting in loss of a distinct hybridizing band. Even though the hybridization patterns were complex due to the large number of hybridizing genomicfragments, we did not detect the tr-Ac fragment in these red sectors when these DNA samples were analyzed with SstI, a methylation insensitive restriction enzyme (data not shown). We analyzed a fourth type I1 twin uC856) derived the inbred material (see MATERIALS AND METHODScross I) by Southern blot analysis using SstI, a meth-

ylation-insensitive enzymethat does not cut within Ac. Genetic analysis indicated the tr-Ac and the P locus were unlinkedin the light variegated sector of JC856 (data not shown). Southern blot analysis using an Ac probe indicated that progeny from the lightvariegated lineage contained 1 1- and 14.5-kb SstI fragments (Figure 4, lanes1-4). The 11-kb fragment et al. 1989) while represents the Ac at P-W (LECHELT the 14.5-kb SstI fragment cosegregated with the tr-Ac activity. Both Ac fragments were absent from all 10 progeny DNA of the red cotwin (four progeny DNA shown in lanes 5-8). Several fragments common to both red and light variegated progeny hybridized to Ac. These fragments represent the functionally inactive, cryptic Ac -like sequences in the genetic background (4Co63) of the parental lines (CHEN,GREENB L A and ~ DELLAPORTA 1987). Several other type I1 twins were analyzed using SstI and showed no tr-Ac fragment in the red lineage (data not shown).In conclusion, these results indicate the tr-Ac is not selectively methylated but is absent in the red lineage at

Ac Transposition and DNA Replication

A

669

B

C

“L im

P-w

-

P-vv

-

P-vv

-

WQ

tr-Ac

1

2

3

4

1

2

PSt I

3

Pst I

4

1

2

3

4

PSt I

FIGURE3.-Southern blot analysis of type I1 twin sectors. Genomic DNA was isolated from progeny of red and light variegated cotwin sectors of type I1 twins, digested with PstI, and analyzed by Southern hybridization using the Ac probe. (A), (B) and (C) represent independent type I1 twins. Lane 1 contains DNA from the male r-sc:m3 parent and lane 2 contains DNA from the P-W/P-WR female parent. The 17-kb Psfl fragment contains the donor Ac element at the P locus. A tr-Ac element is detected on a hypomethylated genomic fragment in the light variegated cotwin lineage from each twin (lane 4) but not in DNA from the red cotwin lineage (lane 3). High molecular weight DNA hybridizing to the Ac probe represents cryptic Ac-likesequences that are heavily methylated (CHEN,G R E E N B L and A ~ DELLAPORTA 1987).

both the donor site, P, and the target site. The tr-Ac element and flanking DNA present on the 14.5-kb SstI fragment was cloned and mapped using restriction enzyme digests (data summarized in Figure 4B). A 0.3-kb XbaI to Sal1 fragment was subcloned from the 14.5-kb SstI fragment and used as a flanking DNA probe to thesame genomic DNA as in Figure 4A. Figure 4C shows thisresult. The flanking probe detected the 14.5-kb SstI fragment in light variegated progeny containing the tr-Ac (lanes 1 and 2). Only the IO-kb SstI fragment was detected in all other progeny. The IO-kb SstI fragment represents the 14.5-kb fragment without the insertion of Ac. The absence of the 14.5-kb fragment and presence of the IO-kb fragment indicated the absenceof the tr-Ac element in the red lineage. We alsomapped the tr-Ac at position 8L-0 by Southern blot analysis using the flanking probe and recombinant inbred lines. In conclusion, only the empty target fragment is found in the red lineage. Apparently, Ac has integrated into one sister chromatid (after replication) or selective loss of Ac has occurred in the red lineage after integration. Type I1 twin formation by a short-range transposition event at P: T o test whether selective loss of a tr-Ac had occurred, we investigated red and light variegated lineages from a fifth type I1 twin uC191) by cloning and DNA sequence analysis.Genetic analysis of the tr-Ac in the light variegated sector indicated complete linkage of the tr-Ac and the P locus and Southern blot analysis using the Ac probe detected

cosegregation of 7.5-and 7.8-kb SalI fragments with the light variegated phenotype (Figure 5A). The 7.8kb SalI fragment represents the donor Ac element at P - W inserted into the 3.2-kb SalI fragment of the Pand DELLAPORTA R R allele (CHEN, GREENBLATT 1987). The 7.5-kb SalI fragment from the light variegated lineage was cloned and mapped with restriction enzymes, and shown to contain a tr-Ac element (data summarized in Figure 5B). A 0.25-kb PstI-SstI fragment was subcloned from the 3-kb flanking the Ac element and was hybridized to Southern blots of DNA from offspring of red and light variegated cotwins (Figure 5C). The flanking probe hybridized to several fragments in progeny containing either P-RR or P - W alleles. The hybridization pattern was identical to that obtained using a previouslyisolated Pspecific probe (CHEN,GREENBLATT and DELLAPORTA 1987). The DNA sequence of the 0.25-kb flanking probe was identical to a sequence within the 3.0-kb SalI fragment of the P - W allele (data not shown). This sequence contains a 250-bp sequence motif repeated at three locations (the 1.2-,3.0- and 3.2-kb SalI fragments) within the P-RR DNA (CHEN,GREENBLATT and DELLAPORTA 1987; LECHELT et al. 1989) (see location in Figure 6). Because of this motif, the flanking probe detected SalI fragments of 7.8, 7.5 and 1.2 kb in the light variegated lineage(Figure 5C, lane3). This resultindicated the presenceof the donor Ac in the 3.2-kb SalI fragment and the likely insertion of Ac (4.5-kb increase) in the 3.0-kb.SalI fragment of P. Based on the physical map of the P-

J. Chen, I. M.Greenblatt and S. L. Dellaporta

670

A. Red

C.

variegated

Light

I " " I

p-tr-Ac

P-w

T

~

kb

-

-

-

14'5 11.0

kb

tr..Ac target

-".----." 1

2

3

4

,'

5

-

-1 4.5

-

10.0

c1

6

7

1

8

2

3

4

5

6

7

8

flanking probe

Ac probe

tr-Ac element

flanking probe

FIGURE4.-Molecular analysis the Ac donor andtarget sites of a type 11 twin. (A)Southern blot analysis of a type 11 twin. Genomic DNA from red and light variegated cotwin progeny of a type 11 twin sector was digested with Ssf1, Southern blotted,and probed with an Ac probe (A).T w o Ac-containing fragments of 14.5 kb (tr-Ac) and 11 kb ( P - W ) were detected in the light variegated cotwin. Neither the tr-Ac nor the P - W fragment are detected in the red cotwin lineage. The segregation of the 14.5- and 1 1-kb Ac-containing fragments indicates incomplete linkage or independent assortment of the P - W allele and thetr-Ac element. (B)Restriction map of the 14.5-kb Ssf1 fragment. The 14.5-kb Ssf1 fragment containing the tr-Ac element was cloned and mapped with the restriction enzymes shown. The location of the tr-Ac element (cross-hatched box) was determined by the position of restriction sites and Southern hybridization data (not shown). A 0.3-kb Xbal to Sal1 fragment (shaded box) was used as a hybridization probe in C. (C)Southern analysis usingthe flanking DNA probe. Results of hybridization with the 0.3-kb Xbal to Sol1 flanking DNA probe using the same DNA shown in A. The 14.5-kb Ssfl fragment is detected only in the light variegated progeny containing the tr-Ac element (lanes 1 and 2). The IO-kb Ssf1 fragment detected in all DNA samples represents the empty target site fragment.

RR locus (LECHELT et al. 1989), the data presented in Figure 5 indicated that a short range transposition of Ac occurred over a 15-kb interval. In progeny from the red cotwin, however, 3.2-, 3.0- and 1.2-kb SalI fragments of P were detected (lane 2). This result indicated the red cotwin sector contained an empty donor site (the 3.2-kb SalI fragment) and an empty target site (the 3.0-kb SalI fragment). We determinedthe sequenceof thedonorand target sites from the parental P - W chromosome and the corresponding regions in both red and light variegated cotwins. The sequence of donor Ac termini and flanking DNA wereobtained from the previously cloned 7.8-kb SalI fragment of P - W (CHEN,GREENBLATT and DELLAPORTA 1987). These data indicated the donor Ac was found at the insertion site ACAA-

TAATCT-Ac-CCCGTTCGTT in the 7.8-kb SalI fragment of P - W (Figure 6A). No 8-bp duplication flanked the Ac element. The missing duplication for the Ac insertion in the P - W allelehasbeen noted previously (PETERSON 1990).The target region was analyzed by cloning and sequencing the 3.0-kb Sal1 fragment of P - W (data not shown). We then isolated the donorand tr-Ac elements fromthe light variegated sector by genomic cloning ofthe 7.8- and 7.5-kb Sal1 fragments. Figure 6C summarizes data obtained for DNA sequences flanking both donor and transposed Ac elements. Unlike the donor Ac element, an 8-bp target site duplication flankedthe tr-Ac. We also sequenced the empty target site in the red cotwin by amplifying the appropriate genomic regions using PCR and P oligonucleotide primers (data sum-

Ac Transposition and DNA Replication

P-w tr-Ac

7

77.8 7.5

P-vv

2

3

,e

'

-7.8 7.5

tr-Ac

P-RR ' P-RR

.

-3.2 -3.0

.

-

P-RR P-WR 1

67 1

1.2

1

4

2

3

4

flanking probe

Ac probe

I I

tr-Ac element

I

flanking probe

I

1 kb

FIGURE5.--Molecular analysis of Ac donor and target sites in a type I1 twin. (A)Southern blot analysis of JC191. The Ac probe detects the 7.8-kb Sal1 fragment ofP - W in both light variegated (lane 3) and parental P - W (lane 4) lineages but notin the redcotwin lineage (lane 2). A tr-Ac element is detected on a 7.5-kb SalI fragment only in the light variegated cotwin lineage (lane 3) and is absent from the red cotwin. (B)Restriction map and DNA sequence of type I1 twin donor andtarget sites at P. A 7.5-kb SalIfragment containing a tr-Ac element from a light variegated cotwin was cloned and restriction mapped. The position of the tr-Ac element is shown as the cross-hatched box. A flanking DNA SstI-PstI fragment (shaded box) was used as a hybridization probe in C. (C)Southern analysis using the flanking probe: DNA from the progeny of the redcotwin (genotype: P-RR/P-WR) in lane 2, light variegated Sector (genotype:P-W/P-WR + tr-Ac) in lane 3, and parental DNA P-WR (lane 1) and P - W (lane 4) was digested with SalI and probed with the flanking probe. Sequence analysis of the flanking probe indicated that it contained a 250-bp repeated motif which hybridized to the 3.2-, 3.0- and 1.2-kb SalI fragments of P-RR (see text for details). The hybridization pattern in the red cotwin indicated that Ac was absent from both the donor(3.2-kb fragment) and the target site (3.0-kb fragment). The hybridization pattern in the light variegated cotwin indicated insertions in the 3.2- and 3.0-kb Sal1 fragments yielding 7.8- and 7.5-kb Sal1 fragments. This result confirmed that Ac was present at both donor andtarget sites in the light variegated cotwin.

marized in Figure 6B). Identical DNAsequences found at the target sitesin both parental and red lineages indicated the target site in the red cotwin sector was unaltered. Since Ac causes an 8-bp duplication upon insertion and excision is imprecise, a sequence alteration or excision footprint at thetarget site in the red cotwin sector would have been molecular evidence that this lineage had once received but subsequently lostthe tr-Ac. The available data support the conclusion that the red sector never received the tr-Ac element found in the light variegated sector. DISCUSSION

Detectable transposition events of Ac from the P locus result in twin mutations approximately 80% of

the time (GREENBLATT 1974). There aretwo types of these twin mutations-the typeI twin has an active trAc element in the red cotwin while the type I1 twin does not. Both twins have no Ac at the donor P - W site inthe red cotwin. Both twins carryan active Ac at both the donor P - W site and the target site in the light variegated cotwin.Hence, the outcomes at the P locus during type I and type I1 twin formation appear similar. At question 'is whether these two twin types represent consequences of two different transposition mechanisms or different outcomes of a singular mechanism. Moreover, untwinned sectors of red and light variegated pericarp are also observedin medium var1974). Do these untwinned iegated ears (GREENBLATT events represent the same transposition mechanism that yields twin mutations or arethey products of yet

672

A.

J. Chen, I. M. Greenblatt and S. L. Dellaporta __c fTAQCCTAQA QATATATQ CCQCQCQCQ?

"

ACAATMTCT CMQQATQAAA

\

0

\

/

f

\ 0

\

0

\

\

TI'TCATCCCTA

\

/

I'

\

\ \ \

I

.'

' \

CCCQTTCQTT 0 0 0/

/

0

B.

R e d sector

C.

FIGURE6.-Restriction maps and DNA sequence analysis of donor andtarget sites in daughter chromosomes of a t y p e I1 twin. Restriction maps for a region of the parental P - W chromosome (A) and corresponding regions of the chromosomes from both red (B)and light variegated (C) cotwin lineages from the type I1 twin JC191 are shown. The positions of the 250 bp repeated motif of the flanking probe from Figure 5 are shown (shaded boxes). Ac elements are shownas cross-hatched boxes. The position of unmethylated Sal1 sites and methylated (*) sites is shown. The donor Ac inserted into the 3.2-kb fragment of P-RR is present in both parental and light variegated chromosomes and absent from the red cotwin chromosome. The tr-Ac element inserted into the 3.0-kb Sal1 fragment of P-RR is found only in the light variegated chromosome. The position of the donor and tr-Ac elements indicates that a transposition of Ac over a 15-kb interval has occurred, with insertion of the tr-Ac in the same orientation as the donor Ac element. DNA sequences of donor and target sites were determined as described (MATERIALS AND METHODS) for the parental P - W chromosome, red cotwin, and light variegated cotwin chromosomes from the type I1 twin JC191.At the donor site in both parental and light variegated chromosomes the donorAc element was found without the usual flanking 8-bp direct repeat of target sequences. The inverted terminal repeat sequences of Ac and 10 bp of flanking DNA are shown. In the light variegated cotwin, the inverted terminal repeat sequences of the tr-Ac, the 8-bp direct repeat of target sequences and additional 10 bp of flanking DNA to each side are shown. In the red cotwin, the P-RR chromosome carries a DNA footprint at the donor site (not shown), indicating Ac excision. Shown are identical target site sequences in both red and parental chromosomes indicating that no Ac excision event can be detected in the red cotwin.

another mechanism of Ac transposition? The data presented in this report address some of these questions and limit the alternatives to others. Ac transposition andDNA replication: Prior studiesoftwin mutations have addressedthe issue of whether the tr-Ac elements found in cotwin sectors of type I twins are indeed at the same location. Genetic recombination analysis of 13 type I twins demonstrated that 12 contained tr-Ac elements at the same genomic location in cotwin sectors (GREENBLATT and BRINK 1962). Molecular analyses of five twin mutations support these genetic experiments (CHEN, GREENBLATT and DELLAPORTA 1987). Figure2B summarizes additionalevidenceobtained by DNA sequence analysis. Together, these findings show that

the target sequences for the tr-Ac elements in cotwin daughter lineages are identical, supporting the interpretation that unreplicated target sites are used during type I formation. Thus, the formation of type I twins occurs when an Ac at P replicates, excises from one chromatid, and inserts into a target site where it is replicated a second time. Because the donor and target sites are differentially replicated during this process, type I transposition events are limited to the period of DNA synthesis. Do all transpositions occur during the period of DNA synthesis?Analyses oftype I1 events indicate the cotwin lineages are genetically and molecularly nonequivalent with respect to both donor and target sites. The red lineage loses Ac at P , as in type I twin

Ac and Transposition

formation, yetonly the light variegated lineage receives the tr-Ac element. These elements were found on hypomethyated genomic fragments, as were tr-Ac elements in type I twins (CHEN, GREENBLATT and DELLAPORTA 1987). The red cotwin lineage does not haveany detectable Ac activity (GREENBLATT and BRINK1962) and, as we show here, molecularly it is devoid of Ac at the P locus and the target site. This result eliminates the possibility that Ac was selectively inactivated in the red lineage (GREENBLATT 1984). Moreover, thetarget sequence in thered lineage showed no evidenceof integration and subsequent excision of the tr-Ac element such asa DNA footprint at the integration site. The selective loss of the tr-Ac from the red lineage after transposition is very unlikely. A more plausible explanation is that the red lineage never receives the tr-Ac element because the target site has replicated before integration. Integration of Ac after replication or integration during replication without Ac replicating a second time would be compatible with our results. Therefore, type 11 twin formation represents interchromatid transposition of Ac from a replicated donor site to a replicated target site. These events must occur between the period of DNA synthesis and mitotic anaphase. These data do not allowus to distinguish whether transpositions occur during asingle phase ofthe cell cycle or during two different periods. However, it seems most probable that both type I and type I1 twinformation occur entirely during theperiod of DNA replication. Is DNA replication required for transposition?The fact that most early transposition events during ear morphogenesis are twinned suggests that replication of Ac maybe a prerequisite for transposition. This prerequisite may be related to the mechanism oftransposition of some bacterial transposons. Striking similarities between Ac transposition and the conservative transposition mechanisms of certain bacterial transposons are apparent. Conservative transposition of bacterial elements such as TnlO involves the excision of the element from a donor site and integration into a target site (reviewed by DERBYSHIRE and GRINDLEY 1986). Excision of TnlU is coupled to DNA replication in the following manner. Several dum methylation sites exist at the terminal inverted repeats of TnlO (ROBERTSet al. 1985). These sites are normally methylated and transiently hemimethylated after passage of a DNA replication fork. in vivo production of hemimethylated substrates leads to highlevels of transposition (ROBERTSet ul. 1985). Moreover, the preference for hemimethylated binding sites appears to be strand specific-one of the two hemimethylated forms of TnlO appears to be a bettersubstrate in vivo. These observations imply that most transpositions of TnlO occur shortly after the element replicates and

DNA Replication

673

that the two replicated forms of the element may be functionally nonequivalent. Ac transposition may be related to DNA replication via DNA methylation aswell. DNA methylation of Ac has been correlated with the element's activity (SCHWARTZ and DENNIS1986; CHOMET, WESSLER and DELLAPORTA 1987) and methylation appears to correlate with the lossof transposase gene expression (KUNZE, STARLINGER and SCHWARTZ 1988). In vitro studies have shown that the binding of the putative Ac transposase protein is enhanced by hemimethyation of its binding site withinAc, with one hemimethylated form showing greater binding affinity than the other (KUNZE and STARLINCER 1989). These studies suggest that transposition and DNA replication may be coupled through a mechanism similar to that of TnlO. Our results also offer evidence that most, if not all, transpositions occur entirely during or shortly after the period of DNA replication, a result consistentwith a replicated form of Ac being the donor substrate for transposition. Twinned 'us. untwinned pericarp sectors: The diagrams presented in Figure 7 summarize our conclusions. Transposition of Ac occurs in the following sequence according to our results: (1) the donor Ac replicates along with the P locus; (2)one copy of the donor Ac excises from P , the other copy remains; (3) the excised Ac reintegrates into a target sitewhich may or may not have completed replication. As seen in Figure 8A, an untwinned red sector would form if an intrachromatid transpositionoccurs. The sister chromatid would carry an Ac at the P locus ( P - W ) , and none elsewhere, resulting in medium variegated pericarp that is indistinguishable from the parental tissue. Untwinned reds wouldalso form during an interchromosomal transposition when the tr-Ac cosegregates with the P-RR chromosome. The frequency of these events is quite low (less than 5% of all transpositions) which does not contribute substantially to the numbers of untwinned reds (our unpublished data). In both cases, however, the resulting untwinned red sectors, if they occur, would always carry a tr-Ac. Do intrachromatid transpositions represent the mechanism of generating the untwinned red sectors that are observed on medium variegatedears? GREENBLATT (1968, 1974) analyzed untwinned red sectors by different means: (1) by measuring the frequency of untwinned red sectors with and without Ac and finding no increase in Ac presence in untwinned red V S . twinned reds; (2)by direct count of untwinned red and untwinned light variegated sectors on medium variegated ears and finding no significantly detectable differences in their numbers; and (3) by the count of red and light variegatedoffspring from a homozygous P-W:E parent and finding them to be equal. Collectively, thesedata strongly suggest the absolute number

674

J. Chen, I. M. Greenblatt and S . L. Dellaporta A.

Typo I Twln Formrtlon

- .2 RedLlneage(+tr-Acj

Lbht Variegated Lineage

Typo II Twln Fonnrtkn

0

Red Llnmge (no tr-Acj Llght Vaflegated Llneage

7I”

FIGURE7.-Twin sector formation. (A) Type I twin formation. The replicated donor Ac (triangle) at the P - W allele and the unreplicated target site (arrow) are shown. During type I twin formation, the donor Ac replicates, excises from one of the two sister chromatids, and integratesintoan unreplicated target site. After DNA replication is completed, the two daughter chromosomes carry the tr-Ac; one chromosome has the donor Ac (light variegated cotwin) and the other lacks the donor Ac (red cotwin). For simplicity, transposition to an intrachromosomal target site is shown. (B)Type I1 twin formation: The replicated donor Ac (triangle) and replicated target site (arrow) are shown. During type I1 twin formation, the donor Ac at P - W excises from one of the two replicating chromatids, as during type I twin formation. The target site is replicated, however, resulting in two nonequivalent target sites, one with the tr-Ac (light variegated) and one without tr-Ac (red cotwin). During type I1 twin formation, transposition must be to sister chromatids (interchromatid) for twins to be formed. For simplicity, the target site is shown within the same replication bubble as the donorsite. This is not necessarily the case, as interchromatid transpositions to other replicated target sites will also result in type I1 twin formation.

of red and light variegated sectors is equal. Thus by three independent means of measurement, the excess of untwinned red sectors that would result directly from the transposition mechanism depicted in Figure 8A is not apparent. The existence of intrachromatid transposition events(untwinned red sectors) is not consistent with the available genetic observations unless some mechanism generates untwinned light variegated sectorsat a rate notmeasurably different from the occurrence of untwinned red sectors. Two alternative explanationsare offered toexplain the occurrenceof untwinned red sectors. One possible mechanism is the loss, at equal frequencies, of the cotwin sector during ear morphogenesis as outlined 1974). This hypothesis states previously (GREENBLATT that all transposition events result in potential twins and untwinned sectors are only apparently untwinned because of two-dimensional resolution of the pericarp. This would imply that Ac replication is required for excision and that intrachromatid transpositions do not occur at detectable frequencies.This hypothesis raises the following question:What mechanism could be responsible for interchromatid specificity? A mechanism togeneratenonequivalentchromatidsafter DNA replication or nonequivalent DNA strands before replication would need to be operational. A sitespecific, DNA strand-specific imprintingevent has

been proposed to explain mating type switching pedigrees in Schizosacchomyces pombe (KLAR1987, 1990). A similar mechanism might be operational in maize. Forinstance,chromatid specificity could be determined by the inheritance of methylation patterns which generate nonequivalent daughter chromatids after DNA replication. An alternative hypothesis is thatuntwinnedred sectors do occurasaresult of Ac intrachromatid transposition from theP locus but a mechanism exists to generate untwinnedlight variegated sectors at comparable frequencies. A recentmodel for Drosophila P element transposition that involves gap repair of the excision site may provide such a mechanism (ENGELS et al. 1990). If during transposition of Ac, excision resulted in agap atthedonor site that could be repaired using the sister chromatid (Figure 8B), the outcome would be the formation of an untwinned light variegated sector. This potential mechanism of generating untwinned light variegated sectors would also require replication of the donor element before transposition. The attractiveness of this model is that a single transposition mechanism for Ac can explain the formation of all twinned and untwinned sectors observed on medium variegated pericarp ears. Twin sectors and untwinned red sectors would be the result of imprecise “gap-ligation” of the excision site, while

675

Ac Transposition andDNA Replication

A.

UntwlnrwdRod Soctor

n B. Light V w b g n t d L h q e

-nn

LigM Varkgaied Lineage

FIGURE%-Genetic models for untwinned sectors. (A) Intrachromatid transposition of Ac. Transposition of Ac (triangle) from a replicating donor site to a target site (arrow) on the same chromatid (intrachromatid transposition) will result in the formation of an untwinned red sector. The cotwin will be medium variegated ( P - W , no tr-Ac ) and indistinguishable from neighboring tissue. For simplicity, the target site is shown within the same replication bubble as the donor site. This is not necessarily the case, as intrachromatid transpositions to other et al. 1990) for untwinned light variegated replicated target sites will also result in untwinned red sectors. (B)Gap repair model (ENGELS sector formation: Transposition of Ac from the donorP - W allele results in a gapped excision site. Gap repair using the sister chromatid as a template results in the formation of an untwinned light variegated sector. Although an unreplicated target site is shown, replicated target sites and interchromatid or intrachromatid transpositions will change only the size of the light variegated sector. The sister lineage will be light variegated or medium variegated depending on the replication status of the target site. Both outcomes will result in a phenotypically untwinned light variegated sector on medium variegated ears. This scheme is based on a recent model for P element transposition (ENGELS et al. 1990).

untwinned light variegated sectors would be formed by “gap repair”of the excision site. We are presently testing whether this gap repair transposition mechanism is operational in maize. Molecular features of twin formation: Analysis of JC191, a type I1 twin, indicated that transposition of Ac occurred over a 15 kb interval. Intragenic transpositions of Ac have been observed at the Waxy locus (CHOMET 1988) and at the P locus (PETERSON 1990). In earlier genetic studies, no transpositions of Ac were observed in the 4 cM region immediately proximal to P , although using these genetic techniques it was not possible to localize very closely linked transpositions (GREENBLATT 1984). Intragenic recombination data between a P-WW and P-WR alleles (J. CHEN,unpublished data) indicate that the 3.0-kb target fragment of JC191 is proximal to the 3.2-kb donor fragment. This places the tr-Ac in JC191 proximal to the donor site. Therefore, our analysis shows that JC191 represents a short-range proximal transposition of Ac when both donor and target sites are replicated. The previous suggestionthat the apparent polarity ofAc transposition may be due to replication patterns may need to be reinterpreted in light of this information. In summary, genetic and molecular analysisindicate

that transposition of Ac can occur to both replicated and unreplicated target sites. Most, if not all, transpositions occur during the period of DNA synthesis or shortly thereafter. We would like to thank LISASHUSTER for technical assistance and TOMBRUTNELL, ALISONDELONG,ELSBETHWALKERand MARIAMORENOfor critical reading of the manuscript. This work was supported by a grant from the National Institute of Health to S.L.D. (R01-GM38148) and from theMcKnight Foundation to the Plant Biology group at Yale University. We also thank the Connecticut Agricultural Experiment Station for the generous use of their field facilities.

LITERATURECITED BARCLAY, P.C., and R. A. BRINK,1954 The relation between Modulator and Activator in maize. Proc. Natl. Acad. Sci. USA 4 0 1118-1126.

BRINK,R. A., and R. A. NILAN,1952 The relation between light variegated and medium variegated pericarp in maize. Genetics 37: 519-544. BURR,B., F. A. BURR,K. H. THOMPSON, M. C. ALBERTSON and C. W. STUBER,1987 Gene mapping with recombinant inbreds in maize. Genetics 118: 519-526. CHEN, J., I. M. GREENBLATTand S. L. DELLAPORTA, 1987 Transposition of Ac fromthe P locus of maize into unreplicated chromosomal sites. Genetics 117: 109-1 16. CHOMET,P. S . , 1988 Characterization of stable and metastable changes of the maize transposable element Activator. Ph.D. thesis, SUNY-Stonybrook, N.Y.

J. Chen, I. M. Greenblatt and S. L. Dellaporta

676

CHOMET, P. S., S . WESSLER R. and S. L. DELLAPORTA, 1987 Inactivation of the maize transposable element Activator (Ac) is associated with its DNA modification. EMBO J. 6 295302.

DERBYSHIRE, K. M., and N.D. F. GRINDLEY, 1986 Replicative and conservative transposition in bacteria. Cell 47: 325-327. DREZTEN,D., M. BELLARD, P. SASSONE-CORSI and P. CHAMBON, 198 1 A reliable method for the recovery of DNA fragments from agarose and acrylamide gels. Anal. Biochem. 112: 295301.

EMERSON, R. A., 1914 The inheritance of arecurring somatic variation in variegated ears of maize. Am. Nat. 48: 87-1 15. ENGELS, W. R.,D. M. JOHNSON-SCHLITZ, W. B. EGGLESTON and J. SVED,1990 High frequency P element loss in Drosophilais homolog dependent. Cell 62: 51 5-525. FEDOROFF,N.,S. WESSLERand M. SHURE,1983 Isolation of the transposable maize controlling elements Ac and Ds. Cell 35: 235-242.

FEINBERG, A. P., and B. VOGELSTEIN, 1984 A technique for radiolabeling DNA restriction fragments to high specific activity: addendum. Anal. Biochem. 137: 266-267. GREENBLATT, I. M., 1968 The mechanism of Modulator transposition in maize. Genetics 58: 585-597. GREENBLAW, I. M., 1974 Movement ofModulator in maize: a test of a hypothesis. Genetics 77: 671-678. GREENBLATT, I. M., 1984 A chromosomal replication pattern deduced from pericarpphenotypes resulting from movements of the transposable element Modulator in maize. Genetics 108: 471-485.

GREENBLAW, I. M., and R. A. BRINK,1962 Twin mutations in medium variegated pericarp in maize. Genetics 47: 489-501. HOHN,B., 1979 In vitro packaging of X and cosmid DNA.Methods Enzymol. 6 8 299-309. KLAR,A. J. S., 1987 Determination of the yeast cell lineage. Cell 49: 433-435.

KLAR,A. J. S., 1990 The developmental fate of fission yeast cells is determined by the pattern of inheritance of parental and grandparental DNA strands. EMBO J. 9 1407-1415. KUNZE,R., and P. STARLINGER, 1989 The putative transposase of the transposable element Ac from Zeamays L. interacts with subterminal sequences of Ac. EMBO J. 8: 3 177-3 185. KUNZE,R.,P. STARLINGER and D. SCHWARTZ, 1988 DNA methylation of the maize transposable element Ac interferes with its transcription. Mol. Gen. Genet. 214: 325-327. LECHELT, C., T. PETERSON, A. LAIRD, J. CHEN,S. L. DELLAPORTA, E. DENNIS, W. J. PEACOCK and P. STARLINGER, 1989 Isolation and molecular analysis of the maize P locus. Mol. Gen. Genet. 219: 225-234. B., 1948 Mutable lociinmaize. Carnegie Inst. MCCLINTOCK, Wash. Year Book 47: 155-169. MCCLINTOCK, B., 1949 Mutable loci in maize. Carnegie Inst. Wash. Year Book 48: 142-154. PETERSON, T., 1990 Intragenic transposition of Ac generates a new allele of the maize P gene. Genetics 126 469-476. ROBERTS, D.,B.C. HOOPES,W.R. MCCLURE and N. KLECKNER, 1985 IS10 transposition is regulated by DNA adenine methylation. Cell 43: 117-130. SAMBROOK, J., E. F. FRITSCHand T. MANIATIS, 1989 Molecular Cloning. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. SANGER, F., S. NICKLEN and A. R. COULSON,1977 DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad.Sci. USA 7 4 5463-5467. SCHWARTZ, D., and E. DENNIS,1986 Transposase activity of the Ac controlling element in maize is regulated by its degree of methylation. Mol. Gen. Genet. 205: 476-482. SHURE,M., S. WESSLER and N. FEWROFF,1983 Molecular identification and isolation of the Waxy locusinmaize.Cell 35 225-233.

Communicating editor: B. BURR