Mitochondrion 17 (2014) 101–105
Contents lists available at ScienceDirect
Mitochondrion journal homepage: www.elsevier.com/locate/mito
Mitochondrial encephalomyopathy with cytochrome c oxidase deficiency caused by a novel mutation in the MTCO1 gene François-Guillaume Debray a,⁎, Sara Seneca b, Michel Gonce c, Kim Vancampenhaut b, Elettra Bianchi d, François Boemer a, Laurent Weekers a, Joél Smet e, Rudy Van Coster e a
Metabolic Unit, Department of Medical Genetics, Sart-Tilman University Hospital, Domaine Sart-Tilman Bât B35, 4000 Liège, Belgium Center of Medical Genetics, UZ Brussel and Reproduction and Genetics (REGE), Vrije Universiteit Brussel (VUB), 101 Laarbeeklaan, 1090 Brussels, Belgium Department of Neurology, CHR Citadelle, 1 Boulevard XIIème de Ligne, 4000 Liège, Belgium d Department of Neuropathology, Sart-Tilman University Hospital, Domaine Sart-Tilman Bât B35, 4000 Liège, Belgium e Division of Pediatric Neurology and Metabolism, Department of Pediatrics, Ghent University Hospital, 185 De Pintelaan, 9000 Ghent, Belgium b c
a r t i c l e
i n f o
Article history: Received 31 January 2014 received in revised form 25 May 2014 accepted 13 June 2014 Available online 20 June 2014 Keywords: Encephalomyopathy Mitochondrial DNA Cytochrome c oxidase MTCO1
a b s t r a c t Cytochrome c oxidase (COX) deficiency is one of the most common respiratory chain deficiencies. A woman was presented at the age of 18 y with acute loss of consciousness, non-convulsive status epilepticus, slow neurological deterioration, transient cortical blindness, exercise intolerance, muscle weakness, hearing loss, cataract and cognitive decline. Muscle biopsy revealed ragged-red fibers, COX negative fibers and a significant decreased activity of complex IV in a homogenate. Using next generation massive parallel sequencing of the mtDNA, a novel heteroplasmic mutation was identified in MTCO1, m.7402delC, causing frameshift and a premature termination codon. Single fiber PCR showed co-segregation of high mutant load in COX negative fibers. Mutation in mitochondrially encoded complex IV subunits should be considered in mitochondrial encephalomyopathies and COX negative fibers after the common mtDNA mutations have been excluded. © 2014 Elsevier B.V. and Mitochondria Research Society. All rights reserved.
1. Introduction Mitochondrial encephalomyopathies represent a heterogeneous group of neurodegenerative disorders caused by a large array of biochemical defects affecting the functioning of the oxidative phosphorylation system. Mitochondrial encephalomyopathies can be caused by mutations in either nuclear or mitochondrial genes, coding for structural proteins of the respiratory chain complexes, or other key components implicated in the biogenesis or activity of the respiratory chain (DiMauro, 2013). Since 1988, hundreds of pathogenic mitochondrial DNA (mtDNA) mutations have been identified which were associated with various phenotypes (http://www.mitomap.org). The more commonly detected mtDNA mutations are associated with recognizable syndromes, including for example mitochondrial encephalomyopathy, lactic acidosis and stroke-like episodes (MELAS), mitochondrial epilepsy with ragged red fibers (MERRF) and neurogenic weakness, ataxia, retinitis pigmentosa (NARP). However, many patients escape this classification and new mtDNA variants still continue to be identified in patients presenting with various combinations of neurological symptoms and overlapping phenotypes. The pathogenicity of these nucleotide ⁎ Corresponding author at: Metabolic Unit, Department of Medical Genetics, Sart-Tilman University Hospital, Bât B35 DomaineSart-Tilman. B-4000 Liège, Belgium. Tel.: + 32.43668145; fax: + 32.43668146. E-mail address: [email protected] (F.-G. Debray).
http://dx.doi.org/10.1016/j.mito.2014.06.003 1567-7249/© 2014 Elsevier B.V. and Mitochondria Research Society. All rights reserved.
variants is sometimes difficult to establish. We report the identification of a novel MTCO1 mutation in a young woman with severe progressive encephalomyopathy and discuss its pathogenicity. We review the phenotypic spectrum associated with MTCO1 mutations and discuss genotype–phenotype correlations. 2. Methods 2.1. Clinical case A young previously healthy woman, aged 18 y, was admitted with an acute deterioration of consciousness associated with a non convulsive status epilepticus. At that time, she was a high grade college student. Meningoencephalitis was ruled out and she was treated by phenobarbital and diphenylhydantoin. She progressively recovered over three weeks and was discharged. Neurological examination was normal, however, after recovery, she was unable to continue her studies because of severe chronic fatigue and lack of concentration. Four years later, she presented an acute episode of sudden cortical blindness with headache, followed by prolonged seizures and coma requiring admission to the intensive care unit. She partially recovered, and a few weeks later she was discharged, but follow-up showed persistent gait disturbances, muscle weakness and mild cerebellar ataxia. In the following years, she deteriorated slowly with progressive muscle weakness and atrophy, weight loss, neurosensorial hearing loss, early onset
102
F.-G. Debray et al. / Mitochondrion 17 (2014) 101–105
cataract and slow cognitive decline. Neurological examination revealed quadricipital amyotrophy, tremor and dysarthria. Occulomotricity was normal. Aged 36 y, she started complaining of exercise intolerance, muscle cramps, weakness, urinary incontinence and intermittent swallowing disturbances. Cerebral MRI had shown cortical atrophy and basal ganglia lesions (Fig. 1). Echocardiography and electrocardiogram were normal. Metabolic screening was performed at age 36 y. Fasting blood lactate was at the upper limit of the normal range (1.9 mmol/L, controls 0.6–2.0 mmol/L) and alanine was moderately increased (629 μmol/L, controls b440). Acylcarnitine profile was normal and urinary organic acid chromatography showed a mild ethymalonic aciduria, which was considered as a possible non-specific marker of mitochondrial dysfunction. The family history revealed that the patient's mother was affected by hereditary neuropathy with liability to pressure palsies (MIM#162500) caused by the common 17p11.2 deletion. This deletion was also detected in the proposita. A young sister aged 34 y has no neurological symptom. A recent clinical examination of the patient showed non-familial small stature (152 cm), thin habitus (33.6 kg), generalized amyotrophy, abolished osteotendinous reflexes in the lower limbs, slurred and mildly dysarthric speech, parkinsonism, tremor, and ataxic gait. 2.2. Skeletal muscle studies After obtaining informed consent, an open muscle biopsy was performed at the age of 36 y in the vastus lateralis under local anesthesia. Standard stainings were performed, including modified Gomori trichrome and histoenzymological studies. Respiratory chain analyses were performed on frozen muscle by spectrophotometry, and blue native polyacrylamide gel electrophoresis (BN-PAGE) with in gel activity staining, as previously described (Van Coster et al., 2001; Zecic et al., 2009). 2.3. Molecular analysis The presence of common point mutations in the tRNA leucine (MTTL1) and tRNA lysine (MTTK) genes was investigated by DGGEPCR. In a second approach, the complete mitochondrial genome of muscle tissue was sequenced and analyzed with the Ion Torrent PGM massive parallel sequencing system. The mtDNA was amplified from 50 ng of gDNA, using the Roche Expand Long Template kit (Roche Applied Science, Vilvoorde, Belgium), in three overlapping long-range
(LR)-PCR amplicons according to the manual's instructions. The potential co-amplification of nuclear pseudogenes of mitochondrial origin (NUMTs) and thereby contamination of the sequence data had been excluded. An average coverage of 5649 was obtained for this sample. Heteroplasmy levels of the 7402 deletion were deciphered from the NGS data and confirmed with the PCR-RFLP assay used for single muscle fiber analysis. For further details on the NGS methodology and data analysis, see Seneca et al. (2014). In order to quantify the proportion of the cytosine deletion at position m.7402, last fluorescent cycle polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) analysis was used for single muscle fiber analysis. Total DNA was extracted from isolated single muscle fibers as described by Vandewoestyne et al.(2012). A labeled forward primer (nucleotides 7219–7240) and a reverse mismatch primer 5′ GGTTCTTCGAATGTGTGGTCCGGTGGGGG 3′(nucleotides 7398–7426, with mismatch nucleotides underlined) are used to generate a 208 bp fragment. The wild type fragment was cut by the restriction enzyme BslI (New England Biolabs, Bioke, Leiden, the Netherlands) into a 179 bp fragment, while the presence of the single nucleotide deletion destroys this restriction site. After digestion, fluorescent DNA products were analyzed with capillary electrophoresis on a 3130XL Genetic Analyzer (Life Technologies, Merelbeke, Belgium). The level of heteroplasmy was determined by comparing the cleaved and uncleaved peak areas. The percentage of mutant mtDNA was determined as the peak area of the non-digested DNA divided by the sum of the digested (wild type mtDNA) and the non-digested peak areas (mutant mtDNA). 3. Results Histological studies revealed scattered ragged red fibers and a high proportion (20–30%) of fibers lacking cytochrome-c oxidase (COX) histoenzymologic staining (Fig. 2). In several fibers an increase of subsarcolemmal succinate dehydrogenase staining was seen. Respiratory chain enzyme activities measured by spectrophotometric assays in muscle homogenate showed low complex IV activity, especially regarding the high citrate synthase activity which probably indicates mitochondrial proliferation. The ratio of complex IV activity over citrate synthase and complex II after logarithmic transformation was decreased (z-score at −2.96 and −3.71, respectively) (Table 1). Blue native polyacrylamide gel electrophoresis of respiratory chain complexes showed a decrease of the fully assembled complex IV (Fig. 3). Western
Fig. 1. Cerebral MRI of the patient at age 33. Axial T2-weighted images showing symmetrical hyperintensities in the lenticular nuclei, and lateral ventricle enlargement.
F.-G. Debray et al. / Mitochondrion 17 (2014) 101–105
103
Fig. 2. Histochemical and histoenzymological analyses of muscle biopsy: hematoxylin & eosin (A), Gomori trichrome (B) and COX staining (C), showing ragged-red fibers and COX negative fibers.
blot with antibodies against protein subunits of each of the respiratory complexes confirmed a lower amount of the holocomplex IV (Fig. 4). MtDNA deletion and common point mutations (including the A3243G MELAS and A8344G MERRF mutations) were absent in skeletal muscle DNA. Given the results of histoenzymological and BN-PAGE analysis, the entire mtDNA was sequenced with special focus on the three mitochondrial genes encoding the COX subunits (MTCO1, MTCO2 and MTCO3). Indeed, the mosaic pattern of muscle fiber abnormalities strongly suggests a phenomenon of heteroplasmy. Except for multiple mtDNA deletions caused by mutations in nuclear genes coding for proteins implicated in mtDNA replication or maintenance, heteroplasmy is usually associated with mtDNA mutation. Mitochondrial genome sequencing revealed a heteroplasmic m.7402delC mutation (p.Pro500Hisfs*12) in the MTCO1gene. The allele frequency of the pathogenic single nucleotide deletion was determined at 76%, 27 and 7% in the mtDNA of the patient muscle homogenate, urine epithelial cells and leukocytes, respectively. Finally, single fiber PCR analysis showed a strong correlation between the level of heteroplasmy and the COX negative phenotype: in the patient's muscle, the percentage of mutant DNA in COX negative fibers was 94.1 ± 5.6% whereas in COX positive fibers only 15.6 ± 19.8% of DNA harbored the mutation (P = 2.79E-14)(Fig. 5). In a muscle biopsy of the patient's mother, aged 60 y, no histoenzymological abnormalities were observed. Single fibers from the patient's mother carried the variant with a 2–5% minor allele frequency (Fig. 5). The mutation was absent from the blood and urinary mtDNA from the mother and the young sister. 4. Discussion We report a young woman who presented signs of severe encephalomyopathy, characterized by recurrent acute neurological episodes leading to stepwise deterioration and progressive multisystemic involvement. Although clinical history and results of histoenzymological studies suggested a MELAS-like phenotype, no mutation was detected in the tRNA gene usually associated with this condition. As the microscopic finding and the histoenzymological results were highly suggestive of
heteroplasmy, and an isolated complex IV deficiency was detected in skeletal muscle, mitochondrial genes encoding complex IV subunits were considered as excellent candidate genes. In order to study these three genes together in the same time, we used next generation massive parallel sequencing of the complete mitochondrial genome. This strategy has ultimately led to the detection of a new mutation in MTCO1. Several lines of evidence argue for pathogenicity of this variant. First, it was heteroplasmic, with variable tissue distribution. Second, this frameshift mutation introduces a premature termination codon, truncating the C terminal portion of the protein, most probably leading to instability of the COX1 subunit and secondary decrease of the fully assembled complex IV. In addition, the biochemical phenotype was consistent with a reduced amount of the COX I protein and with a secondary decrease of the holocomplex IV as seen in the blue native PAGE. Finally, single fiber PCR analysis showed a strong correlation between the percentage of mutant mtDNA and the absence of COX staining. Cytochrome c oxidase is the terminal complex of the electron transport chain, transferring reducing equivalents form cytochrome c to molecular oxygen. It is composed of 13 subunits, of which subunits I, II and III are encoded by the mtDNA and form the catalytic core of the complex. All other subunits are encoded by the nuclear genome. Thus, COX deficiency can result from mutations in both nuclear and mitochondrial genes. However, in most cases, it is caused by mutations in autosomal genes coding for assembly factors implicated in complex IV biogenesis. Mutations in mitochondrially or nuclear encoded structural subunits have been detected in affected patients less frequently (DiMauro et al., 2012). The phenotypic spectrum associated with mutation in the MTCO1 gene is broad and can be classified in three main categories. First, patients presenting with acquired sideroblastic anemia without neurological symptoms. In these patients, heteroplasmic MTCO1 mutations are restricted to blood cells (Gattermann et al., 1997). In a second group, patients presenting with isolated myopathy, ranging from mild exercise intolerance to chronic muscle weakness, myoglobinuria and episodic rhabdomyolysis (Karadimas et al., 2000; Kollberg et al., 2005; Herrero-Martin et al., 2008; Valente et al., 2009; Massie et al., 2012). In these cases, mutations were frequently detected
Table 1 OXPHOS activities in skeletal muscle homogenate measured by spectrophotometric analysis. OXPHOS complex
Specific activity patient (controls)*
Ratio/CS
z score
Ratio/complex II
z score
Complex I Complex II Complex II+III Complex III Complex IV Mitochondrial matrix enzyme Citrate synthase
45 (15–52) 54 (18–58) 37 (18–50) 147 (50–145) 83 (82–266)
0.71 0.74 0.67 0.93 0.82
1.15 1.55 −0.22 0.56 −2.96
0.96 – 1.01 1.32 1.48
0.06 – −1.76 −0.52 −3.71
215 (92–273)
–
–
1.49
−1.58
*Specific activity is expressed as nanomoles of substrate per minute per milligram of protein. Control range (n = 30) is given as (P5–P95). The ratios are expressed as the logarithm of OXPHOS activity divided by the logarithm of citrate synthase and complex II activity respectively. The z score, is calculated as the activity ratio for the patient sample minus the mean activity ratio for the control samples divided by the SD for the control samples. When the z score is lower than −1.96 or higher than +1.96, the result for the patient sample is significantly different (P b 0.05) from the result for the control samples. Results with z scores of less than −1.96, are indicative of significantly decreased OXPHOS activity in the patient skeletal muscle sample (in bold).
104
F.-G. Debray et al. / Mitochondrion 17 (2014) 101–105
Fig. 3. Blue native polyacrylamide gel electrophoresis (BN-PAGE) of the five respiratory chain complexes showing reduced amount and in gel activity of the complex IV. BN-PAGE followed by in-gel activity staining as described previously (Van Coster et al., 2001) was used for electrophoretic separation of the five OXPHOS complexes in the mitochondria isolated from skeletal muscle in their native state. A patient and a representative control sample were loaded in duplicate using an equal amount of mitochondrial protein (appr. 50 μg/lane). In the left panel of the figure (transmission scan), the proteins in the OXPHOS complexes can be visualized due to their binding to Serva Blue G. As the catalytic properties of the complexes are retained, the different complex activities can be tested by adding specific staining solutions. In the first set of lanes, the activity staining of complex I, III and IV was performed; in the second the activity staining of complex V and II. C, control; OXPHOS complexes, I, II, III, IV and V; P, patient.
in skeletal muscle tissue only, or at low level of heteroplasmy in other tissues. Finally, a third group of patients (Comi et al., 1998; Bruno et al., 1999; Varlamov et al., 2002; Lucioli et al., 2006; Tam et al., 2008; Lamperti et al., 2012) can be defined clinically, characterized by encephalomyopathy and progressive multisystemic neurological involvement, including seizures, stroke-like episodes, basal ganglia lesions, deafness, regression and cognitive impairment, partially overlapping with MELAS-like and Leigh-like syndromes. Obviously, the patient presented here belongs to the last category. The reason why some patients present myopathy only and others have multisystemic neurological involvement is unclear. The nature of the mutation seems not to affect the phenotype as nonsense mutations have been reported in myopathic patients (Karadimas et al., 2000; Kollberg et al., 2005; Valente et al., 2009) and missense mutations in encephalopathic forms (Varlamov et al., 2002; Lucioli et al., 2006; Tam et al., 2008; Lamperti et al., 2012). As illustrated in Table 2, a high percentage of heteroplasmy correlates imperfectly with the severity of the phenotype but tissue distribution of the mutation seems to be the better predictive factor for central
nervous system involvement: in 3/5 of the patients with isolated myopathy, the mutation was found in muscle mtDNA only (Karadimas et al., 2000; Kollberg et al., 2005; Massie et al., 2012), whereas in 4/4 of the patients with encephalopathy (Bruno et al., 1999; Varlamov et al., 2002; Tam et al., 2008; Lamperti et al., 2012) (where information available), the mutation was also detectable in other tissues, including blood cells, fibroblast or urinary sediment. In the proband, we detected the mutation at lower allele frequency in urine epithelial cells and leukocytes. In conclusion, mitochondrial encephalomyopathies are associated with an extreme genetic heterogeneity. Mutations in mitochondrially encoded complex IV subunits should be considered in patients presenting with COX negative fibers, in whom mtDNA deletion and common pathogenic tRNA mutations have been excluded. Next generation sequencing is a rapid and powerful method for whole mitochondrial genome analysis, much cheaper and less laborious than complete mtDNA analysis with Sanger sequencing, and allows to identify and quantify new and private mutations in the mtDNA sequence.
110
mutation load
90
70
50
30
10
-10 Fig. 4. Western blot of several OXPHOS proteins showing reduction of the COX2 subunit, which indicates reduction of the fully assembled complex IV.
Fig. 5. Graphical representation of the mutation load (in %) of COX+ (●) and COX− (Δ) muscle fibers of the patient and her mother.
F.-G. Debray et al. / Mitochondrion 17 (2014) 101–105
105
Table 2 Clinical and molecular findings in patients with MTCO1 mutation. Pt
Clinical features
Mutation
Muscle heteroplasmy
Other tissues
Transm.
Ref
1
Rhabdomyolysis
61%
9
Rhabdomyolysis
De novo
10
3
De novo
11
4
Mental retardation Muscle weakness Exercise intolerance Rhabdomyolysis
70%
Blood: 0% Fibro: 0% Blood: 0% Fibro: 0% Blood: heteropl. Fibro: heteropl. Urine: heteropl. Urine: 15%
De novo
2
m.5920G N A p.Trp6* m.6708G N A p.Gly269* m.6955G N A p.Gly351Asp
De novo
12
5
Muscle weakness
24–37%
Blood: 0%
De novo
13
6
Multisystemic and motor neuron disease Multisystemic Myoclonic seizure Hearing loss Multisystemic Epilepsia partialis Continua Cardioencephalopathy Myopathy Stroke-like episodes Multisystemic Seizure Stroke-like episode Multisystemic Stroke-like episode Hearing loss
47–68%
Non available
De novo
14
75%
Blood: 27%
De novo
15
m.6489C N A p.Leu196Ile
90%
Blood: 29%
Inherited
16
m.6328C N T p.Ser142Phe
100%
Non available
Unknown
17
m.7023G N A p.Val374Met
96%
Blood: 70% Fibro: 10–50%
De novo
18
m.6597C N A p.Gln232Lys
95%
Blood: 30% Fibro: 40% Urine: 70%
De novo
19
7
8
9
10
11
m.6698delA p.Lys265Lysfs6* m.7222A N G p.Tyr440Cys m.6015_6019del p.Glu40Glyfs3* m.6930G N A p.Gly343*
81–89% 100%
Acknowledgments The authors are grateful for the contribution of the late Manuel Deprez, from the Department of Neuropathology, CHU of Liège, who interpreted the muscle biopsy of the patient and her mother. References Bruno, C., Martinuzzi, A., Tang, Y., Andreu, A.L., Pallotti, F., Bonilla, E., Shanske, S., Fu, J., Sue, C.M., Angelini, C., DiMauro, S., Manfredi, G., 1999. A stop-codon mutation in the human mtDNA cytochrome c oxidase gene disrupts the functional structure of complex IV. Am. J. Hum. Genet. 65, 611–620. Comi, G.P., Bordoni, A., Salani, S., Franceschina, L., Sciacco, M., Prelle, A., Fortunato, F., Zeviani, M., Napoli, L., Bresolin, N., Moggio, M., Ausenda, C.D., Taanman, J.W., Scarlato, G., 1998. Cytochrome c oxidase subunit I microdeletion in a patient with motor neuron disease. Ann. Neurol. 43, 110–116. DiMauro, S., 2013. Mitochondrial encephalomyopathies. Fifty years on: the Robert Wartenberg lecture. Neurology 81, 281–291. DiMauro, S., Tanji, K., Schon, E.A., 2012. The many clinical faces of cytochrome c oxidase deficiency. Adv. Exp. Med. Biol. 748, 341–357. Gattermann, N., Retzlaff, S., Wang, Y.L., Hofhaus, G., Heinisch, J., Aul, C., Schneider, W., 1997. Heteroplasmic point mutations of mitochondrial DNA affecting subunit I of cytochrome c oxidase in two patients with acquired idiopathic sideroblasticanémia. Blood 90, 4961–4972. Herrero-Martín, M.D., Pineda, M., Briones, P., López-Gallardo, E., Carreras, M., Benac, M., Angel Idoate, M., Vilaseca, M.A., Artuch, R., López-Pérez, M.J., Ruiz-Pesini, E., Montoya, J., 2008. A new pathologic mitochondrial DNA mutation in the cytochrome oxidase subunit I (MT-CO1). Hum. Mutat. 29, E112–E122. http://www.mitomap.org (updated November 15th 2013). Karadimas, C.L., Greenstein, P., Sue, C.M., et al., 2000. Recurrent myoglobinuria due to a nonsense mutation in the COX I gene of mitochondrial DNA. Neurology 55, 644–649. Kollberg, G., Moslemi, A.R., Lindberg, C., Holme, E., Oldfors, A., 2005. Mitochondrial myopathy and rhabdomyolysisassociatedwith a novel nonsense mutation in the geneencoding cytochrome c oxidasesubunit I. J. Neuropathol. Exp. Neurol. 64, 123–128. Lamperti, C., Diodato, D., Lamantea, E., Carrara, F., Ghezzi, D., Mereghetti, P., Rizzi, R., Zeviani, M., 2012. MELAS-like encephalomyopathy caused by a new pathogenic
mutation in the mitochondrial DNA encoded cytochrome c oxidase subunit I. Neuromuscul. Disord. 22, 990–994. Lucioli, S., Hoffmeier, K., Carrozzo, R., Tessa, A., Ludwig, B., Santorelli, F.M., 2006. Introducing a novel human mtDNA mutation into Paracoccusdenitrificans COX I gene explains functional deficits in a patient. Neurogenetics 7, 51–57. Massie, R., Wang, J., Chen, L.C., Zhang, V.W., Collins, M.P., Wong, L.J., Milone, M., 2012. Mitochondrial myopathy due to novel missense mutation in the cytochrome c oxidase 1 gene. J. Neurol. Sci. 319, 158–163. Seneca, S., Vancampenhout, K., Van Coster, R., Smet, J., Lissens, W., Vanlander, A., De Paepe, B., Jonckheere, A., Stouffs, K., De Meirleir, L., 2014. Analysis of the whole mitochondrial genome: translation of the ion torrent personal genome machine system to the diagnostic bench? Eur. J. Hum. Genet. http://dx.doi.org/10.1038/ejhg.2014.49. Tam, E.W., Feigenbaum, A., Addis, J.B., Blaser, S., Mackay, N., Al-Dosary, M., Taylor, R.W., Ackerley, C., Cameron, J.M., Robinson, B.H., 2008. A novel mitochondrial DNA mutation in COX I leads to strokes, seizures, and lactic acidosis. Neuropediatrics 39, 328–334. Valente, L., Piga, D., Lamantea, E., Carrara, F., Uziel, G., Cudia, P., Zani, A., Farina, L., Morandi, L., Mora, M., Spinazzola, A., Zeviani, M., Tiranti, V., 2009. Identification of novel mutations in five patients with mitochondrial encephalomyopathy. Biochim. Biophys. Acta 1787, 491–501. Van Coster, R., Smet, J., George, E., De Meirleir, L., Seneca, S., Van Hove, J., Sebire, G., Verhelst, H., De Bleecker, J., Van Vlem, B., Verloo, P., Leroy, J., 2001. Blue native polyacrylamide gel electrophoresis: a powerful tool in diagnosis of oxidative phosphorylation defects. Pediatr. Res. 50 (5), 658–665. Vandewoestyne, M., Van Nieuwerburgh, F., Van Hoofstat, D., Deforce, D., 2012. Evaluation of three DNA extraction protocols for forensic STR typing after laser capture microdissection. Forensic Sci. Int. Genet 6 (2), 258–262. Varlamov, D.A., Kudin, A.P., Vielhaber, S., Schröder, R., Sassen, R., Becker, A., Kunz, D., Haug, K., Rebstock, J., Heils, A., Elger, C.E., Kunz, W.S., 2002. Metabolic consequences of a novel missense mutation of the mtDNA CO I gene. Hum. Mol. Genet. 11, 1797–1805. Zecic, A., Smet, J.E., De Praeter, C.M., Vanhaesebrouck, P., Viscomi, C., Van Den Broecke, C., De Paepe, B., Lohse, P., Martin, J.J., Jackson, J.G., 2009. Lactic acidosis in a newborn with adrenal calcifications. Pediatr. Res. 66, 317–322.
Contents lists available at ScienceDirect
Mitochondrion journal homepage: www.elsevier.com/locate/mito
Mitochondrial encephalomyopathy with cytochrome c oxidase deficiency caused by a novel mutation in the MTCO1 gene François-Guillaume Debray a,⁎, Sara Seneca b, Michel Gonce c, Kim Vancampenhaut b, Elettra Bianchi d, François Boemer a, Laurent Weekers a, Joél Smet e, Rudy Van Coster e a
Metabolic Unit, Department of Medical Genetics, Sart-Tilman University Hospital, Domaine Sart-Tilman Bât B35, 4000 Liège, Belgium Center of Medical Genetics, UZ Brussel and Reproduction and Genetics (REGE), Vrije Universiteit Brussel (VUB), 101 Laarbeeklaan, 1090 Brussels, Belgium Department of Neurology, CHR Citadelle, 1 Boulevard XIIème de Ligne, 4000 Liège, Belgium d Department of Neuropathology, Sart-Tilman University Hospital, Domaine Sart-Tilman Bât B35, 4000 Liège, Belgium e Division of Pediatric Neurology and Metabolism, Department of Pediatrics, Ghent University Hospital, 185 De Pintelaan, 9000 Ghent, Belgium b c
a r t i c l e
i n f o
Article history: Received 31 January 2014 received in revised form 25 May 2014 accepted 13 June 2014 Available online 20 June 2014 Keywords: Encephalomyopathy Mitochondrial DNA Cytochrome c oxidase MTCO1
a b s t r a c t Cytochrome c oxidase (COX) deficiency is one of the most common respiratory chain deficiencies. A woman was presented at the age of 18 y with acute loss of consciousness, non-convulsive status epilepticus, slow neurological deterioration, transient cortical blindness, exercise intolerance, muscle weakness, hearing loss, cataract and cognitive decline. Muscle biopsy revealed ragged-red fibers, COX negative fibers and a significant decreased activity of complex IV in a homogenate. Using next generation massive parallel sequencing of the mtDNA, a novel heteroplasmic mutation was identified in MTCO1, m.7402delC, causing frameshift and a premature termination codon. Single fiber PCR showed co-segregation of high mutant load in COX negative fibers. Mutation in mitochondrially encoded complex IV subunits should be considered in mitochondrial encephalomyopathies and COX negative fibers after the common mtDNA mutations have been excluded. © 2014 Elsevier B.V. and Mitochondria Research Society. All rights reserved.
1. Introduction Mitochondrial encephalomyopathies represent a heterogeneous group of neurodegenerative disorders caused by a large array of biochemical defects affecting the functioning of the oxidative phosphorylation system. Mitochondrial encephalomyopathies can be caused by mutations in either nuclear or mitochondrial genes, coding for structural proteins of the respiratory chain complexes, or other key components implicated in the biogenesis or activity of the respiratory chain (DiMauro, 2013). Since 1988, hundreds of pathogenic mitochondrial DNA (mtDNA) mutations have been identified which were associated with various phenotypes (http://www.mitomap.org). The more commonly detected mtDNA mutations are associated with recognizable syndromes, including for example mitochondrial encephalomyopathy, lactic acidosis and stroke-like episodes (MELAS), mitochondrial epilepsy with ragged red fibers (MERRF) and neurogenic weakness, ataxia, retinitis pigmentosa (NARP). However, many patients escape this classification and new mtDNA variants still continue to be identified in patients presenting with various combinations of neurological symptoms and overlapping phenotypes. The pathogenicity of these nucleotide ⁎ Corresponding author at: Metabolic Unit, Department of Medical Genetics, Sart-Tilman University Hospital, Bât B35 DomaineSart-Tilman. B-4000 Liège, Belgium. Tel.: + 32.43668145; fax: + 32.43668146. E-mail address: [email protected] (F.-G. Debray).
http://dx.doi.org/10.1016/j.mito.2014.06.003 1567-7249/© 2014 Elsevier B.V. and Mitochondria Research Society. All rights reserved.
variants is sometimes difficult to establish. We report the identification of a novel MTCO1 mutation in a young woman with severe progressive encephalomyopathy and discuss its pathogenicity. We review the phenotypic spectrum associated with MTCO1 mutations and discuss genotype–phenotype correlations. 2. Methods 2.1. Clinical case A young previously healthy woman, aged 18 y, was admitted with an acute deterioration of consciousness associated with a non convulsive status epilepticus. At that time, she was a high grade college student. Meningoencephalitis was ruled out and she was treated by phenobarbital and diphenylhydantoin. She progressively recovered over three weeks and was discharged. Neurological examination was normal, however, after recovery, she was unable to continue her studies because of severe chronic fatigue and lack of concentration. Four years later, she presented an acute episode of sudden cortical blindness with headache, followed by prolonged seizures and coma requiring admission to the intensive care unit. She partially recovered, and a few weeks later she was discharged, but follow-up showed persistent gait disturbances, muscle weakness and mild cerebellar ataxia. In the following years, she deteriorated slowly with progressive muscle weakness and atrophy, weight loss, neurosensorial hearing loss, early onset
102
F.-G. Debray et al. / Mitochondrion 17 (2014) 101–105
cataract and slow cognitive decline. Neurological examination revealed quadricipital amyotrophy, tremor and dysarthria. Occulomotricity was normal. Aged 36 y, she started complaining of exercise intolerance, muscle cramps, weakness, urinary incontinence and intermittent swallowing disturbances. Cerebral MRI had shown cortical atrophy and basal ganglia lesions (Fig. 1). Echocardiography and electrocardiogram were normal. Metabolic screening was performed at age 36 y. Fasting blood lactate was at the upper limit of the normal range (1.9 mmol/L, controls 0.6–2.0 mmol/L) and alanine was moderately increased (629 μmol/L, controls b440). Acylcarnitine profile was normal and urinary organic acid chromatography showed a mild ethymalonic aciduria, which was considered as a possible non-specific marker of mitochondrial dysfunction. The family history revealed that the patient's mother was affected by hereditary neuropathy with liability to pressure palsies (MIM#162500) caused by the common 17p11.2 deletion. This deletion was also detected in the proposita. A young sister aged 34 y has no neurological symptom. A recent clinical examination of the patient showed non-familial small stature (152 cm), thin habitus (33.6 kg), generalized amyotrophy, abolished osteotendinous reflexes in the lower limbs, slurred and mildly dysarthric speech, parkinsonism, tremor, and ataxic gait. 2.2. Skeletal muscle studies After obtaining informed consent, an open muscle biopsy was performed at the age of 36 y in the vastus lateralis under local anesthesia. Standard stainings were performed, including modified Gomori trichrome and histoenzymological studies. Respiratory chain analyses were performed on frozen muscle by spectrophotometry, and blue native polyacrylamide gel electrophoresis (BN-PAGE) with in gel activity staining, as previously described (Van Coster et al., 2001; Zecic et al., 2009). 2.3. Molecular analysis The presence of common point mutations in the tRNA leucine (MTTL1) and tRNA lysine (MTTK) genes was investigated by DGGEPCR. In a second approach, the complete mitochondrial genome of muscle tissue was sequenced and analyzed with the Ion Torrent PGM massive parallel sequencing system. The mtDNA was amplified from 50 ng of gDNA, using the Roche Expand Long Template kit (Roche Applied Science, Vilvoorde, Belgium), in three overlapping long-range
(LR)-PCR amplicons according to the manual's instructions. The potential co-amplification of nuclear pseudogenes of mitochondrial origin (NUMTs) and thereby contamination of the sequence data had been excluded. An average coverage of 5649 was obtained for this sample. Heteroplasmy levels of the 7402 deletion were deciphered from the NGS data and confirmed with the PCR-RFLP assay used for single muscle fiber analysis. For further details on the NGS methodology and data analysis, see Seneca et al. (2014). In order to quantify the proportion of the cytosine deletion at position m.7402, last fluorescent cycle polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) analysis was used for single muscle fiber analysis. Total DNA was extracted from isolated single muscle fibers as described by Vandewoestyne et al.(2012). A labeled forward primer (nucleotides 7219–7240) and a reverse mismatch primer 5′ GGTTCTTCGAATGTGTGGTCCGGTGGGGG 3′(nucleotides 7398–7426, with mismatch nucleotides underlined) are used to generate a 208 bp fragment. The wild type fragment was cut by the restriction enzyme BslI (New England Biolabs, Bioke, Leiden, the Netherlands) into a 179 bp fragment, while the presence of the single nucleotide deletion destroys this restriction site. After digestion, fluorescent DNA products were analyzed with capillary electrophoresis on a 3130XL Genetic Analyzer (Life Technologies, Merelbeke, Belgium). The level of heteroplasmy was determined by comparing the cleaved and uncleaved peak areas. The percentage of mutant mtDNA was determined as the peak area of the non-digested DNA divided by the sum of the digested (wild type mtDNA) and the non-digested peak areas (mutant mtDNA). 3. Results Histological studies revealed scattered ragged red fibers and a high proportion (20–30%) of fibers lacking cytochrome-c oxidase (COX) histoenzymologic staining (Fig. 2). In several fibers an increase of subsarcolemmal succinate dehydrogenase staining was seen. Respiratory chain enzyme activities measured by spectrophotometric assays in muscle homogenate showed low complex IV activity, especially regarding the high citrate synthase activity which probably indicates mitochondrial proliferation. The ratio of complex IV activity over citrate synthase and complex II after logarithmic transformation was decreased (z-score at −2.96 and −3.71, respectively) (Table 1). Blue native polyacrylamide gel electrophoresis of respiratory chain complexes showed a decrease of the fully assembled complex IV (Fig. 3). Western
Fig. 1. Cerebral MRI of the patient at age 33. Axial T2-weighted images showing symmetrical hyperintensities in the lenticular nuclei, and lateral ventricle enlargement.
F.-G. Debray et al. / Mitochondrion 17 (2014) 101–105
103
Fig. 2. Histochemical and histoenzymological analyses of muscle biopsy: hematoxylin & eosin (A), Gomori trichrome (B) and COX staining (C), showing ragged-red fibers and COX negative fibers.
blot with antibodies against protein subunits of each of the respiratory complexes confirmed a lower amount of the holocomplex IV (Fig. 4). MtDNA deletion and common point mutations (including the A3243G MELAS and A8344G MERRF mutations) were absent in skeletal muscle DNA. Given the results of histoenzymological and BN-PAGE analysis, the entire mtDNA was sequenced with special focus on the three mitochondrial genes encoding the COX subunits (MTCO1, MTCO2 and MTCO3). Indeed, the mosaic pattern of muscle fiber abnormalities strongly suggests a phenomenon of heteroplasmy. Except for multiple mtDNA deletions caused by mutations in nuclear genes coding for proteins implicated in mtDNA replication or maintenance, heteroplasmy is usually associated with mtDNA mutation. Mitochondrial genome sequencing revealed a heteroplasmic m.7402delC mutation (p.Pro500Hisfs*12) in the MTCO1gene. The allele frequency of the pathogenic single nucleotide deletion was determined at 76%, 27 and 7% in the mtDNA of the patient muscle homogenate, urine epithelial cells and leukocytes, respectively. Finally, single fiber PCR analysis showed a strong correlation between the level of heteroplasmy and the COX negative phenotype: in the patient's muscle, the percentage of mutant DNA in COX negative fibers was 94.1 ± 5.6% whereas in COX positive fibers only 15.6 ± 19.8% of DNA harbored the mutation (P = 2.79E-14)(Fig. 5). In a muscle biopsy of the patient's mother, aged 60 y, no histoenzymological abnormalities were observed. Single fibers from the patient's mother carried the variant with a 2–5% minor allele frequency (Fig. 5). The mutation was absent from the blood and urinary mtDNA from the mother and the young sister. 4. Discussion We report a young woman who presented signs of severe encephalomyopathy, characterized by recurrent acute neurological episodes leading to stepwise deterioration and progressive multisystemic involvement. Although clinical history and results of histoenzymological studies suggested a MELAS-like phenotype, no mutation was detected in the tRNA gene usually associated with this condition. As the microscopic finding and the histoenzymological results were highly suggestive of
heteroplasmy, and an isolated complex IV deficiency was detected in skeletal muscle, mitochondrial genes encoding complex IV subunits were considered as excellent candidate genes. In order to study these three genes together in the same time, we used next generation massive parallel sequencing of the complete mitochondrial genome. This strategy has ultimately led to the detection of a new mutation in MTCO1. Several lines of evidence argue for pathogenicity of this variant. First, it was heteroplasmic, with variable tissue distribution. Second, this frameshift mutation introduces a premature termination codon, truncating the C terminal portion of the protein, most probably leading to instability of the COX1 subunit and secondary decrease of the fully assembled complex IV. In addition, the biochemical phenotype was consistent with a reduced amount of the COX I protein and with a secondary decrease of the holocomplex IV as seen in the blue native PAGE. Finally, single fiber PCR analysis showed a strong correlation between the percentage of mutant mtDNA and the absence of COX staining. Cytochrome c oxidase is the terminal complex of the electron transport chain, transferring reducing equivalents form cytochrome c to molecular oxygen. It is composed of 13 subunits, of which subunits I, II and III are encoded by the mtDNA and form the catalytic core of the complex. All other subunits are encoded by the nuclear genome. Thus, COX deficiency can result from mutations in both nuclear and mitochondrial genes. However, in most cases, it is caused by mutations in autosomal genes coding for assembly factors implicated in complex IV biogenesis. Mutations in mitochondrially or nuclear encoded structural subunits have been detected in affected patients less frequently (DiMauro et al., 2012). The phenotypic spectrum associated with mutation in the MTCO1 gene is broad and can be classified in three main categories. First, patients presenting with acquired sideroblastic anemia without neurological symptoms. In these patients, heteroplasmic MTCO1 mutations are restricted to blood cells (Gattermann et al., 1997). In a second group, patients presenting with isolated myopathy, ranging from mild exercise intolerance to chronic muscle weakness, myoglobinuria and episodic rhabdomyolysis (Karadimas et al., 2000; Kollberg et al., 2005; Herrero-Martin et al., 2008; Valente et al., 2009; Massie et al., 2012). In these cases, mutations were frequently detected
Table 1 OXPHOS activities in skeletal muscle homogenate measured by spectrophotometric analysis. OXPHOS complex
Specific activity patient (controls)*
Ratio/CS
z score
Ratio/complex II
z score
Complex I Complex II Complex II+III Complex III Complex IV Mitochondrial matrix enzyme Citrate synthase
45 (15–52) 54 (18–58) 37 (18–50) 147 (50–145) 83 (82–266)
0.71 0.74 0.67 0.93 0.82
1.15 1.55 −0.22 0.56 −2.96
0.96 – 1.01 1.32 1.48
0.06 – −1.76 −0.52 −3.71
215 (92–273)
–
–
1.49
−1.58
*Specific activity is expressed as nanomoles of substrate per minute per milligram of protein. Control range (n = 30) is given as (P5–P95). The ratios are expressed as the logarithm of OXPHOS activity divided by the logarithm of citrate synthase and complex II activity respectively. The z score, is calculated as the activity ratio for the patient sample minus the mean activity ratio for the control samples divided by the SD for the control samples. When the z score is lower than −1.96 or higher than +1.96, the result for the patient sample is significantly different (P b 0.05) from the result for the control samples. Results with z scores of less than −1.96, are indicative of significantly decreased OXPHOS activity in the patient skeletal muscle sample (in bold).
104
F.-G. Debray et al. / Mitochondrion 17 (2014) 101–105
Fig. 3. Blue native polyacrylamide gel electrophoresis (BN-PAGE) of the five respiratory chain complexes showing reduced amount and in gel activity of the complex IV. BN-PAGE followed by in-gel activity staining as described previously (Van Coster et al., 2001) was used for electrophoretic separation of the five OXPHOS complexes in the mitochondria isolated from skeletal muscle in their native state. A patient and a representative control sample were loaded in duplicate using an equal amount of mitochondrial protein (appr. 50 μg/lane). In the left panel of the figure (transmission scan), the proteins in the OXPHOS complexes can be visualized due to their binding to Serva Blue G. As the catalytic properties of the complexes are retained, the different complex activities can be tested by adding specific staining solutions. In the first set of lanes, the activity staining of complex I, III and IV was performed; in the second the activity staining of complex V and II. C, control; OXPHOS complexes, I, II, III, IV and V; P, patient.
in skeletal muscle tissue only, or at low level of heteroplasmy in other tissues. Finally, a third group of patients (Comi et al., 1998; Bruno et al., 1999; Varlamov et al., 2002; Lucioli et al., 2006; Tam et al., 2008; Lamperti et al., 2012) can be defined clinically, characterized by encephalomyopathy and progressive multisystemic neurological involvement, including seizures, stroke-like episodes, basal ganglia lesions, deafness, regression and cognitive impairment, partially overlapping with MELAS-like and Leigh-like syndromes. Obviously, the patient presented here belongs to the last category. The reason why some patients present myopathy only and others have multisystemic neurological involvement is unclear. The nature of the mutation seems not to affect the phenotype as nonsense mutations have been reported in myopathic patients (Karadimas et al., 2000; Kollberg et al., 2005; Valente et al., 2009) and missense mutations in encephalopathic forms (Varlamov et al., 2002; Lucioli et al., 2006; Tam et al., 2008; Lamperti et al., 2012). As illustrated in Table 2, a high percentage of heteroplasmy correlates imperfectly with the severity of the phenotype but tissue distribution of the mutation seems to be the better predictive factor for central
nervous system involvement: in 3/5 of the patients with isolated myopathy, the mutation was found in muscle mtDNA only (Karadimas et al., 2000; Kollberg et al., 2005; Massie et al., 2012), whereas in 4/4 of the patients with encephalopathy (Bruno et al., 1999; Varlamov et al., 2002; Tam et al., 2008; Lamperti et al., 2012) (where information available), the mutation was also detectable in other tissues, including blood cells, fibroblast or urinary sediment. In the proband, we detected the mutation at lower allele frequency in urine epithelial cells and leukocytes. In conclusion, mitochondrial encephalomyopathies are associated with an extreme genetic heterogeneity. Mutations in mitochondrially encoded complex IV subunits should be considered in patients presenting with COX negative fibers, in whom mtDNA deletion and common pathogenic tRNA mutations have been excluded. Next generation sequencing is a rapid and powerful method for whole mitochondrial genome analysis, much cheaper and less laborious than complete mtDNA analysis with Sanger sequencing, and allows to identify and quantify new and private mutations in the mtDNA sequence.
110
mutation load
90
70
50
30
10
-10 Fig. 4. Western blot of several OXPHOS proteins showing reduction of the COX2 subunit, which indicates reduction of the fully assembled complex IV.
Fig. 5. Graphical representation of the mutation load (in %) of COX+ (●) and COX− (Δ) muscle fibers of the patient and her mother.
F.-G. Debray et al. / Mitochondrion 17 (2014) 101–105
105
Table 2 Clinical and molecular findings in patients with MTCO1 mutation. Pt
Clinical features
Mutation
Muscle heteroplasmy
Other tissues
Transm.
Ref
1
Rhabdomyolysis
61%
9
Rhabdomyolysis
De novo
10
3
De novo
11
4
Mental retardation Muscle weakness Exercise intolerance Rhabdomyolysis
70%
Blood: 0% Fibro: 0% Blood: 0% Fibro: 0% Blood: heteropl. Fibro: heteropl. Urine: heteropl. Urine: 15%
De novo
2
m.5920G N A p.Trp6* m.6708G N A p.Gly269* m.6955G N A p.Gly351Asp
De novo
12
5
Muscle weakness
24–37%
Blood: 0%
De novo
13
6
Multisystemic and motor neuron disease Multisystemic Myoclonic seizure Hearing loss Multisystemic Epilepsia partialis Continua Cardioencephalopathy Myopathy Stroke-like episodes Multisystemic Seizure Stroke-like episode Multisystemic Stroke-like episode Hearing loss
47–68%
Non available
De novo
14
75%
Blood: 27%
De novo
15
m.6489C N A p.Leu196Ile
90%
Blood: 29%
Inherited
16
m.6328C N T p.Ser142Phe
100%
Non available
Unknown
17
m.7023G N A p.Val374Met
96%
Blood: 70% Fibro: 10–50%
De novo
18
m.6597C N A p.Gln232Lys
95%
Blood: 30% Fibro: 40% Urine: 70%
De novo
19
7
8
9
10
11
m.6698delA p.Lys265Lysfs6* m.7222A N G p.Tyr440Cys m.6015_6019del p.Glu40Glyfs3* m.6930G N A p.Gly343*
81–89% 100%
Acknowledgments The authors are grateful for the contribution of the late Manuel Deprez, from the Department of Neuropathology, CHU of Liège, who interpreted the muscle biopsy of the patient and her mother. References Bruno, C., Martinuzzi, A., Tang, Y., Andreu, A.L., Pallotti, F., Bonilla, E., Shanske, S., Fu, J., Sue, C.M., Angelini, C., DiMauro, S., Manfredi, G., 1999. A stop-codon mutation in the human mtDNA cytochrome c oxidase gene disrupts the functional structure of complex IV. Am. J. Hum. Genet. 65, 611–620. Comi, G.P., Bordoni, A., Salani, S., Franceschina, L., Sciacco, M., Prelle, A., Fortunato, F., Zeviani, M., Napoli, L., Bresolin, N., Moggio, M., Ausenda, C.D., Taanman, J.W., Scarlato, G., 1998. Cytochrome c oxidase subunit I microdeletion in a patient with motor neuron disease. Ann. Neurol. 43, 110–116. DiMauro, S., 2013. Mitochondrial encephalomyopathies. Fifty years on: the Robert Wartenberg lecture. Neurology 81, 281–291. DiMauro, S., Tanji, K., Schon, E.A., 2012. The many clinical faces of cytochrome c oxidase deficiency. Adv. Exp. Med. Biol. 748, 341–357. Gattermann, N., Retzlaff, S., Wang, Y.L., Hofhaus, G., Heinisch, J., Aul, C., Schneider, W., 1997. Heteroplasmic point mutations of mitochondrial DNA affecting subunit I of cytochrome c oxidase in two patients with acquired idiopathic sideroblasticanémia. Blood 90, 4961–4972. Herrero-Martín, M.D., Pineda, M., Briones, P., López-Gallardo, E., Carreras, M., Benac, M., Angel Idoate, M., Vilaseca, M.A., Artuch, R., López-Pérez, M.J., Ruiz-Pesini, E., Montoya, J., 2008. A new pathologic mitochondrial DNA mutation in the cytochrome oxidase subunit I (MT-CO1). Hum. Mutat. 29, E112–E122. http://www.mitomap.org (updated November 15th 2013). Karadimas, C.L., Greenstein, P., Sue, C.M., et al., 2000. Recurrent myoglobinuria due to a nonsense mutation in the COX I gene of mitochondrial DNA. Neurology 55, 644–649. Kollberg, G., Moslemi, A.R., Lindberg, C., Holme, E., Oldfors, A., 2005. Mitochondrial myopathy and rhabdomyolysisassociatedwith a novel nonsense mutation in the geneencoding cytochrome c oxidasesubunit I. J. Neuropathol. Exp. Neurol. 64, 123–128. Lamperti, C., Diodato, D., Lamantea, E., Carrara, F., Ghezzi, D., Mereghetti, P., Rizzi, R., Zeviani, M., 2012. MELAS-like encephalomyopathy caused by a new pathogenic
mutation in the mitochondrial DNA encoded cytochrome c oxidase subunit I. Neuromuscul. Disord. 22, 990–994. Lucioli, S., Hoffmeier, K., Carrozzo, R., Tessa, A., Ludwig, B., Santorelli, F.M., 2006. Introducing a novel human mtDNA mutation into Paracoccusdenitrificans COX I gene explains functional deficits in a patient. Neurogenetics 7, 51–57. Massie, R., Wang, J., Chen, L.C., Zhang, V.W., Collins, M.P., Wong, L.J., Milone, M., 2012. Mitochondrial myopathy due to novel missense mutation in the cytochrome c oxidase 1 gene. J. Neurol. Sci. 319, 158–163. Seneca, S., Vancampenhout, K., Van Coster, R., Smet, J., Lissens, W., Vanlander, A., De Paepe, B., Jonckheere, A., Stouffs, K., De Meirleir, L., 2014. Analysis of the whole mitochondrial genome: translation of the ion torrent personal genome machine system to the diagnostic bench? Eur. J. Hum. Genet. http://dx.doi.org/10.1038/ejhg.2014.49. Tam, E.W., Feigenbaum, A., Addis, J.B., Blaser, S., Mackay, N., Al-Dosary, M., Taylor, R.W., Ackerley, C., Cameron, J.M., Robinson, B.H., 2008. A novel mitochondrial DNA mutation in COX I leads to strokes, seizures, and lactic acidosis. Neuropediatrics 39, 328–334. Valente, L., Piga, D., Lamantea, E., Carrara, F., Uziel, G., Cudia, P., Zani, A., Farina, L., Morandi, L., Mora, M., Spinazzola, A., Zeviani, M., Tiranti, V., 2009. Identification of novel mutations in five patients with mitochondrial encephalomyopathy. Biochim. Biophys. Acta 1787, 491–501. Van Coster, R., Smet, J., George, E., De Meirleir, L., Seneca, S., Van Hove, J., Sebire, G., Verhelst, H., De Bleecker, J., Van Vlem, B., Verloo, P., Leroy, J., 2001. Blue native polyacrylamide gel electrophoresis: a powerful tool in diagnosis of oxidative phosphorylation defects. Pediatr. Res. 50 (5), 658–665. Vandewoestyne, M., Van Nieuwerburgh, F., Van Hoofstat, D., Deforce, D., 2012. Evaluation of three DNA extraction protocols for forensic STR typing after laser capture microdissection. Forensic Sci. Int. Genet 6 (2), 258–262. Varlamov, D.A., Kudin, A.P., Vielhaber, S., Schröder, R., Sassen, R., Becker, A., Kunz, D., Haug, K., Rebstock, J., Heils, A., Elger, C.E., Kunz, W.S., 2002. Metabolic consequences of a novel missense mutation of the mtDNA CO I gene. Hum. Mol. Genet. 11, 1797–1805. Zecic, A., Smet, J.E., De Praeter, C.M., Vanhaesebrouck, P., Viscomi, C., Van Den Broecke, C., De Paepe, B., Lohse, P., Martin, J.J., Jackson, J.G., 2009. Lactic acidosis in a newborn with adrenal calcifications. Pediatr. Res. 66, 317–322.
