Mitochondrial DNA Deletions in Inherited Recurrent Myoglobinuria Kinji Ohno, MD,"? Masashi Tanaka, MD, PhD,? KO Sahashi, MD,$ Tohru Ibi, MD,; Wataru Sato, MD,? Tomoko Yamamoto, MD,? Akira Takahashi, MD," and Takayuki Otawa, MD, PhD?
We describe two brothers with inherited recurrent exertional myoglobinuria and alcohol intolerance associated with distinct morphological abnormalities of muscle mitochondria and multiple deletions of muscle mitochondrial DNA. Patient 1 (26 years old) and Patient 2 (21 years old) had recurrent episodes of myoglobinuria provoked by strenuous exercise or alcohol intake, from the age of 18 years. Although their serum lactate and pyruvate levels were normal at rest, they were significantly elevated by aerobic exercise. Histochemistry of their biopsied limb muscles showed ragged-red fibers and cytochrome c oxidase-negative fibers as well as degenerating and regenerating fibers. Electron microscopy showed pronounced accumulation of abnormal mitochondria containing paracrystalline inclusions and moderate increases of glycogen particles. The enzyme activities of the electron-transfer complexes in the isolated muscle mitochondria of Patient 2 were within normal ranges. Southern blot analysis revealed multiple deletions of mitochondrial DNA, some of which were common between the patients. Polymerase chain reaction of their muscle mitochondrial DNA detected multiple abnormal fragments indicating mitochondrial DNA deletions. We propose that a defect of the mitochondrial energy-trdnsducing system due to multiple mitochondrial DNA deletions is a novel genetic cause of inherited recurrent myoglobinuria. Ohno K, Tanaka M, Sahashi K, Ibi T, Sato W, Yamamoto T, Takahashi A, Ozawa T. Mitochondrial DNA deletions in inherited recurrent myoglobinuria. Ann Neurd 1%)1;29.364-369
Myoglobinuria, a synonym for acute rhabdomyolysis, is histologically characterized by acute degeneration and subsequent regeneration of skeletal muscle fibers from various causes. The disorder invariably shows myalgia with muscle weakness and occasionally complicates acute renal failure. Sometimes recurrent myoglobinuria is known to be inherited and is thought to be based on certain congenital metabolic defects. Although six forms of enzyme defects have been recognized, most of the metabolic defects underlying this disorder remain to be determined. The established enzymes whose defects are causally related to recurrent myoglobinuria are phosphorylase, phosphofructokinase, phosphoglycerate kinase, phosphoglyceromutase, lactate dehydrogenase, and carnitine palmitoyl transferase El]. Because the mitochondrial oxidative phosphorylation system is the main energy-producing machinery for muscle contraction, its dysfunction might provoke myoglobinuria. Defects in the mitochondrial energytransducing system, however, have never been described as a cause of inherited recurrent myoglobinuria. Conversely, recurrent myoglobinuria has never been described as a symptom of mitochondrial myopa-
thies, which are clinically heterogeneous disorders characterized by morphological abnormalities of muscle mitochondria [2}. We report, here, a distinct morphological abnormality and a molecular genetic defect of muscle mitochondria in brothers with inherited recurrent myoglobinuria. We propose that a defect of the mitochondrial energy-transducing system due to multiple deletions of mitochondrial DNA (mtDNA) is a novel cause of inherited recurrent myoglobinuria.
From the Departments of *Neurology and ?Biomedical Chemistry, Faculty of Medicine, University of Nagoya, and the $Department of Medicine, Neurology Section, Aichi Medical University, Japan.
Address correspondence to Dr Ozawa, Department of Biomedical Chemistry, Faculty of Medicine, University of Nagoya, 65 Tsurumacho, Showa-ku, Nagoya 466, Japan.
Methods Patients Patient 1 (26-year-oldman) experienced generalized muscular pain with myoglobinuria, which from age 18 years was provoked by strenuous exercise, heavy alcohol intake, or fasting for long periods. Recurrent episodes of rhabdomyolysis wasted his skeletal muscles to the extent that he needed the assistance of his arms to rise from a squatting position. Patient 2 (2 1-year-old man, brother of Patient 1)had similar episodes of recurrent myoglobinuria from age 18 years. Their mother, another brother, and other relatives were clinically normal. The serum creatine kinase levels of the mother and another brother were normal. There was no known consanguinity in
Received May 29, 1990, and in revised form Sep 19. Accepted for publication Sep 21, 1990.
364 Copyright 0 1991 by the American Neurological Association
their parents. Neither patient showed external ophthalmoplegia, pigmentary retinopathy, cardiac conduction block, ataxia, myoclonic epilepsy, or stroke-like episodes. Their intelligence quotients were normal. The serum creatine kinase levels were variably elevated depending on the preceding exercises or alcohol intake (Patient 1, 304-12,290 UIL; Patient 2, 166-9,350 U/L). The serum lactate levels of Patients l and 2 were normal at rest (Patient l, 0.94 mmolil; Patient 2, 1.64 mmol/l; normal, < 1.67 mmoliL). The serum pyruvate levels were normal at rest (Patient 1, 0.07 mmoli L; Patient 2, 0.09 mmoliL; normal, < 0.11 mmoliL). The profile of the serum lactate and pyruvatc levels was within normal ranges on the ischemic forearm exercise loading test, and no muscular cramp was induced. Pronounced elevations of serum lactate and pyruvate levels, however, were noted after an aerobic exercise that involved generating 15 W for 15 minutes on a bicycle ergometer.
Muscle Patboiogy Muscle biopsy specimens were obtained from the biceps brachii after signed consents were given. The serial sections of the muscles were stained histochemically for enzyme activities of succinate dehydrogenase and cytochrome c oxidase. Electron microscopic observations were also performed.
Enzymological Analysis The enzyme activities of NADH-ubiquinone oxidoreductase, succinate-cytochrome c reductase, and cytochrome c oxidase were measured in isolated muscle mitochondria as reported by Yoneda and colleagues 133.
Southern Blot Analysis Total DNA was isolated from 10 mg frozen biopsied muscles as described by Ozawa and co-workers [ 4 ] . The total muscle DNA (50 ng) was digested with restriction enzyme, PzwII, which cleaves a closed circular mtDNA at one site yielding one linear fragment of 16.6 kb in normal subjects. The digested total DNA was electrophoretically separated in a 0.6% agarose gel and blotted onto a nylon membrane (Hybond-N+, Amersham, Buckingharnshire, UK). A mixture of six fragments (2.0-3.0 kb), which was designed to cover the whole length of mtDNA, was amplified from control mtDNA by the polymerase chain reaction (PCR) method and used as a hybridization probe after labeling with horseradish peroxidase using the enhanced chemiluminescence (ECL) gene detection system (Amersham). Hybridization was performed at 42°C for 15 hours in the ECL hybridization buffer (Amcrsham) containing 0.5 M NaC1. The membrane was subjected to washing twice with 6 M urea, 0.4% sodium dodecyl sulfate, 75 mM NaCI, and 7.5 mM sodium citrate, p H 7.0, at 42°C for 20 minutes, followed by two washings with 0.3 M NaCl and 30 mM sodium citrate, p H 7.0, at room temperature for 5 minutes. The hybridized probes were detected by exposing the membrane to a radiographic film at room temperature for 5 minutes.
PCR Ana&~i.r Fragments of mtDNA were amplified from 10 ng total cellular DNA isolated from biopsied skeletal muscle by using the GeneAmp kit (Perkin-Elmer-Cetus, Norwalk, CT) and 1 p,M
Table 1. Synthesized Primers for the Polymerase Chain Reactions Primer' Sequence 5'+3'
Complementary Siteh
L853 ACGAAAATCTGTTCGCTTCA 8,531 to L881 CACCCAACTATCTATAAACC 8,811 to H1338 TCTTGTTCATTGTTAAGGTT 13,381 to H1420 TTAGTAGTAGTTACTGGTTG 14,201 to
8,550
8,830 13,400 14,220
"The first letter of the primer, L or H, specifies its priming strand. bThe site of mitochondrial DNA is according to the Cambridge sequence [5].
of each primer. Platelet mtDNAs obtained from the patients, their mother, and another brother were also subjected to PCR gene amplification. The primers synthesized for the reactions are shown in Table 1.We confirmed that no abnormal fragments were amplified in controls. The possibility of mispriming was excluded by the primer shift PCR method [6}. PCR was performed in a Thermal Cycler (Perkin-ElmerCetus) for a total of 35 cycles under the following condition: 15 seconds of denaturation at 94"C, 15 seconds of annealing at 55"C, and 80 seconds of primer extension at 72°C. We had designed the PCR condition to allow amplification of a fragment as long as 5 kb. Shorter denaturation period at 94°C seems essential for amplification of a large fragment. Amplified fragments were electrophoresed in 1% agarose gels, stained with 0.5 Fgiml ethidium bromide, and visualized on an ultraviolet transilluminator (TF-ZOM, Vilber Lourmat, Cedex, France).
Results Muscle Pathology Figure 1 shows histochemistry and electron microscopy of the biopsied biceps brachii in Patient 1. Central migration of nuclei, fiber splitting, and actively degenerating and regenerating fibers were observed in both Patients 1 and 2. The ratios of ragged-red fibers in Patients 1 and 2 were 4.7% and l.l%, respectively, whereas the ratios of cytochrome c oxidase-negative fibers were 8.7% and 7.995, respectively. All the ragged-red fibers and some cytochrome c oxidase-negative fibers were stained strongly for succinate dehydrogenase activity. Under electron microscopy, a pronounced accumulation of abnormal mitochondria containing paracrystalline inclusions was observed, and moderate increases of glycogen particles were also detected.
Enzymological Analysis T h e enzyme activities of the electron-transfer complexes in the isolated muscle mitochondria of Patient 2 were within normal ranges, as follows: N A D H ubiquinone oxidoreductase activity, 12 1 nmol/min/mg protein (controls, 146 f 59 [mean .t SD}; range, 81-246; n = 6); succinate-cytochrome c reductase activity, 254 nmol/min/mg protein (controls, 145 & 59; range, 79-261; n = 6); cytochrome coxidase activ-
Ohno et al: Inherited Recurrent Myoglobinuria
365
Fig I . Histochemistry and electron microscopy of the biopsied biceps brachii i n Patient 1. (A) Modfjied Gomori's tvichrome staining shows atypical ragged-red fiben, crntraral migvation of nuclei, hyaline degenerations. (Original mgnzfication, x 100.i (Bi Electron microscopy shows accumulation of abnormal mitochondria containing paracqstalline inclusions in snbsarcolemmal region (bar = 0.I pm). C and D are serialsections. (C)Succinate dehydrogenase activity staining indicates that some fibers are strongly activefor the enzyme. (Original magnzjication. x 100.) (0)Cytochrome c oxidase activity staining illnstrates that the succinate dehydrogenase-positive fibers (arrows i n C ) are exclusively negativefor cytochrome c oxidase (arrows). Conversely,some ofthe cytochrome c oxiduse-negative fibers react normallyforsuccinate dehydrogenase. (Original magnz$cation, x 100.)
ity, 1,007 nmol/min/mg protein (controls, 613 2 276; range, 325-1,143; n = 6). Southern Blot Analysis Southern blot hybridization of PmII-digested total muscle D N A probed with a mixture of six fragments covering the whole length mtDNA revealed multiple
366 Annals of Neurology Vol 29 No 4 April 1991
bands of deleted mtDNAs and a 16.6-kb band of normal-sized mtDNA (Fig 2). Although the blot indicated several common bands of 7, 8, and 7 kb between the patients, a 7-kb band indicating a deletion of 9.6 kb was dominant in Patient 1, and a 13-kb band indicating a deletion of 3.6 kb was dominant in Patient 2. Another experiment of Southern blot hybridization using a restriction enzyme, BamHI, which cleaves mtDNA at one site, also detected multiple abnormal bands (data not shown). PCR Analysir Electrophoretic patterns of the muscle mtDNA fragments amplified by the primer shift PCR method are shown in Figure 3. Sizes of the amplified abnormal fragments and the calculated sizes of deletions are shown in Table 2. In Patient 1, PCR amplification suggested the presence of four different mtDNA deletions in the region between the genes for ATPase 816 and the ND5 gene. The presence of 3.7-kb and 4.1-
kb mtDNA deletions were confirmed by shifting both L- and H-strand primers. The presence of 3.5-kb and 3.9-kb mtDNA deletions was confirmed by shifting Lstrand primers. In Patient 2, the primer shift PCR of the same region confirmed the presence of three different mtDNA deletions of 3.5, 3.8, and 3.9 kb. PCR survey for deleted mtDNAs in other regions of mtDNA using four primer pairs revealed several abnormal bands, some of which were common between the patients (data not shown). Gene amplifications of platelet mtDNA of Patients 1 and 2, their mother, and another brother failed to detect abnormal fragments even by using the same primer pairs as those used for muscle mtDNA amplifications (data not shown).
Fig 2. Southern blot analysis. The restriction enzyme, PvulI, cleaves a circukar mitochondria1 D N A at a singLe site, producing a linear fragment of 16.6 kb in the control (lane CI. In Patient 1 (lane I ) , abnormal bands of 9, 8: and 7 kb weye detected. In Patient 2 (lane 2))abnormal bands of 13, 9, 8, and 7 kb were detected. Among the multiple extra bands. the 7-kb band was dominant in Patient 1 , and the 13-kb band was dominant irr Patient 2.
Discussion Defects in the following six enzymes have been shown to be related to inherited recurrent myoglobinuria: phosphorylase, phosphofructokinase, phosphoglycer-
Fig .3. Electropho~ticpatt~ns of the primershijitpolymerase chain reaction (PCRj pmducts. PCR reactions with three pvimer pain ranging from the ATPase 816 genes to the ND5 gene amplzjied abnormalfragments (lanes PI and P2 represent Patients 1 and 2, ye.@ectivelyi. No abnorma1,fragments were ampl$ed in the control (lane Cj. Open arrowheads indicate normal mitochondria1 D N A lmtDNA) fragmena amplzjied by the PCR reactions. (A) Geae amplification using primers L853 and HI420 detected abnormul fragments of 2.0 and 1.6 kb in Patient I (lane P I ) and abnormal fragments of2.2, 1.9, 1.8. 1.0, and 0.8 kb in Patient
2 (lane P2). (B) Gene amplification using primers L853 and H I 338 detected abnormal fragments of 1.4, 1.2, 1 .O, and 0.8 kb in Patient I (lane P1i and abnormal fragments of 1.4, 1.1, and I .O kb in Patient 2 (lane P2). (C) Gene amplz$cation using primers L88I and H1.338 detected abnormal fragments of 1 .1, 0.9, 0.7, and 0.5 kb in Patient 1 (hne P I ) and abnormal fragments of 1.1, 0.8. and 0.7 kb in Patient 2 (lane P2). Closed arrowheads indicate definite mtDNA deletions determined by the shifis of both L- and H-strandprimers. The other abnomal fragments possibbi indicate mtDNA deletions.
Ohno et al: Inherited Recurrent Myoglobinuria 367
Table 2. Sizes of Abnormal Fragments Arnplz$ed with Three Primer Pairs and Calculation of Siza
of mtDNA Deletions
Patient
Primer Pair
Distance Between Primers (kb)
Fragment Size (kb)
Deletion Size (kb)
Patient 1
L85 3-H 1420
5.7
3. 7 a 4. 1"
L853-Hl338
4.7
2.0 1.6 1.4 1.2 1.0 0.8
Patient 2
L881-HI338
4.6
L853-H1420
5.7
1.1 0.9 0.7 0.5 2.2
1.9
L853-Hl338
4.7
L88 1-H1338
4.6
1.8 1.0 0.8 1.4 1.1 1.0 1.1 0.8 0.7
3.5b
3.7" 3.7b 4.1" 3.5b 3.7" 3.7b 4.1" 3.5" 3.8" 3.9" 4.7 4.7 3.5" 3.8" 3.7" 3.5" 3.8" 3.7"
'Definite deletion confirmed by comparing the change in sizes of amplified fragments with the shift in positions of both L- and H-strand primers. bPossible deletion suggested by comparing the change in sizes of amplified fragments with the shift in positions of L-strand primers.
ate kinase, phosphoglyceromutase, lactate dehydrogenase, and carnitine palmitoyl transferase 117. The first five enzymes are involved in glycogenolysis and glycolysis, and the last is involved in fatty acid transport. In our patients, the normal profiles of the serum lactate and pyruvate levels on the ischemic forearm exercise loading test excluded the defects in the first five enzymes. Carnitine palmitoyl transferase deficiency could be excluded on the basis of the histological findings. For this deficiency, an accumulation of lipid droplets is the only significant electron microscopic finding in the skeletal muscle 177. Our electron microscopic study revealed moderate increases of glycogen particles and morphologically abnormal mitochondria containing paracrystalline inclusions (see Fig 1). The mitochondrial abnormality in our patients was also indicated by ragged-red fibers in the modified Gomori's trichrome staining and cytochrome c oxidase-negative fibers in the activity staining. These morphological findings-glycogen storage and abnormal mitochondria in muscle fibers-suggest a disorder of the oxidative phosphorylation system [S]. The excessive deposition of glycogen particles in our patients may be attributed to a defect of mitochondrial oxidative metabolism with subsequent impairment of NAD H oxidation through the a-glycerophosphate-dihydroxyacetone phosphate shuttle and consequent inhibition of glycolysis. The induction of myoglobinuria by alcohol intake in our patients might also be related
368 Annals of Neurology Vol 29 No 4 April 1791
to impaired oxidation of N A D H generated in the cytoplasm by alcohol dehydrogenase. A defect of the mitochondrial energy-transducing system was also indicated by the pronounced elevations of serum lactate and pyruvate levels after an aerobic exercise loading test. Although the muscle pathology and the abnormal profile in the aerobic exercise loading test are consistent with mitochondrial myopathy, our patients lacked the symptoms common to mitochondrial myopathies, such as external ophthalmoplegia, pigmentary retinopathy, or cardiac conduction block. They are assumed to be an atypical presentation of mitochondrial abnormalities. In Kearns-Sayre syndrome and chronic progressive external ophthalmoplegia, most of the described mtDNA mutations are the heteroplasmy of a normalsized mtDNA and a largely deleted mtDNA 14, 9, 101. Conversely, there are two recent studies on pleioplasmy of a normal-sized mtDNA and multiple largely deleted mtDNAs that are detectable with the Southern blot analysis Ell, 121. We previously reported a patient with familial chronic progressive external ophthalmoplegia in which multiple mtDNA deletions were disclosed not by the Southern blot analysis but by the PCR method [GI. In our present study, multiple deletions of mtDNA were identified both by the Southern blot hybridization (see Fig 2) and by the gene amplification using the PCR method (see Fig 3). We and other investigators have recently described
the involvement of directly repeated sequences in the formation of mtDNA deletion [13, 141. These descriptions suggest that mtDNA deletions originate from either slipped mispairing or recombination. Therefore, it is unlikely that the multiple mtDNA deletions observed in our patients resulted from degradation of mtDNA due to recurrent rhabdomyolysis. We recently examined mtDNA deletions in another patient with acute rhabdomyolysis, but the patient lacked any detectable mtDNA deletion. This finding also suggests that the multiple mtDNA deletions found in Patients 1 and 2 are not the sequelae but the cause of their recurrent rhabdomyolysis. Although both patients had pleioplasmic mtDNA deletions, some deletions were common between them, whereas other deletions were detectable only in either of the patients. These results suggest that mtDNA deletions in these patients result from a mtDNA mutation that predisposes mtDNA itself to deletions. In this instance, the difference in clinical phenotypes among the patients, their mother, and another brother might be ascribed to a difference in the population of the mutant mtDNA, as is demonstrated in neurological disorders caused by maternal transmission of heteroplasmic mutant mtDNA [lS, 161. Alternatively, the mtDNA deletions might result from an abnormality of a nuclear gene product that is required for proper replication of mtDNA or for maintenance of intact mtDNA [lo]. Multiple mtDNA deletions and the consequent defects of mitochondrial energy-transducing system are a novel cause of inherited recurrent myoglobinuria. Moreover, the fact that multiple mtDNA deletions were found in a disease other than mitochondrial myopathy supports our recent hypothesis that mtDNA mutations are an important contributor to aging and degenerative diseases 1171. This work was supported in part by the Grants-in-Aid for General ScientificResearch (62570128) (to M.T.), and for Scientific Research on Priority Areas (Bioenergetics, 01617002) (to T.O.), from the Ministry of Education, Science, and Culture of Japan, and by Grants (to K.S., T.A., and T.O.) from the National Center for Nervous, Mental, and Muscular Disorders of the Ministry of Health and Welfare of Japan.
References 1. Penn AS. Myoglobinuria. In: Engel AG, ed. Myology. New York: McGraw-Hill, 1986:1785-1805 2. DiMauro S, Bonilla E, Zeviani M, et al. Mitochondrial myopathies. Ann Neurol 1985;17:521-538 3. Yoneda M, Tanaka M, Nishikimi H, et al. Pleiotropic molecular defects in energy-transducing complexes in mitochondrial encephalopathy (MELAS). J Neurol Sci 1989;92:143-158 4. Ozawa T, Yoneda M, Tanaka M, et al. Maternal inheritance of deleted mitochondrial DNA in a family with mitochondrial myopathy. Biochem Biophys Res Commun 1988;154:12401247 5. Anderson S, Bankier AT, Barrel BG, et al. Sequence and organization of the human mitochondrial genome. Nature 1981; 290:457-465 6. Sat0 W, Tanaka M, Ohno K, et al. Multiple populations of deleted mitochondrial DNA detected by a novel gene amplification method. Biochem Biophys Res Commun 1989;162: 664-672 7. Bank WJ, DiMauro S, Bonilla E, et al. A disorder of muscle lipid metabolism and myoglobinuria. N Engl J Med 1975;292: 44 3-449 8. DiMauro S, Schotland DL, Bonilla E, et al. Progressive ophthalmoplegia, glycogen storage, and abnormal mitochondria Arch Neurol 1973;29:170-179 9. Holt IJ, Harding AE, Morgan-Hughes JA. Deletions of muscle mitochondrial DNA in patients with mitochondrial myopathies. Nature 1988;33 1:717-7 19 10 Moraes CT, DiMauro S, Zeviani M, et al. Mitochondrial DNA deletions in progressive external ophthalmoplegia and KearnsSayre syndrome. N Engl J Med 1989;320:1293-1299 11 Zeviani M, Servidei S, Gellera C, et al. An autosomal dominant disorder with multiple deletions of mitochondrial DNA starting at the D-loop region. Nature 1989;339:309-311 12 Yuzaki M, Ohkoshi N, Kanazawa I, et al. Multiple deletions in mitochondrial DNA at direct repeats of non-D-loop regions in cases of familial mitochondrial myopathy. Biochem Biophys Res Commun 1989;164:1352-1 357 13. Schon EA, Rizzuto R, Moraes CT,et al. A direct repcat is a hotspot for large-scale deletion of human mitochondrial DNA. Science 1989;244:346-349 14. Tanaka M, Sato W, Ohno K, et al. Direct sequencing of deleted mitochondrial DNA in myopathic patients. Biochem Biophys Res Commun 1989;164:156-163 15. Singh G, Lott MT, Wallace DC. A mitochondrial DNA mutation as a cause of Leber’s hereditary optic neuropathy. N Engl J Med 1989;320:1300-1305 16. Holt IJ, Harding AE, Petty RKH, Morgan-Hughes JA, et al. A new mitochondrial disease associated with mitochondrial DNA heteroplasmy. Am J Hum Genet 1990;46:428-433 17. Linnane AW, Marzuki S, Ozawa T, Tanaka M. Mitochondrial DNA mutations as an important contributor to ageing and degenerative diseases. Lancet 1989;1:642-645
O h n o et al: Inherited Recurrent Myoglobinuria
369
We describe two brothers with inherited recurrent exertional myoglobinuria and alcohol intolerance associated with distinct morphological abnormalities of muscle mitochondria and multiple deletions of muscle mitochondrial DNA. Patient 1 (26 years old) and Patient 2 (21 years old) had recurrent episodes of myoglobinuria provoked by strenuous exercise or alcohol intake, from the age of 18 years. Although their serum lactate and pyruvate levels were normal at rest, they were significantly elevated by aerobic exercise. Histochemistry of their biopsied limb muscles showed ragged-red fibers and cytochrome c oxidase-negative fibers as well as degenerating and regenerating fibers. Electron microscopy showed pronounced accumulation of abnormal mitochondria containing paracrystalline inclusions and moderate increases of glycogen particles. The enzyme activities of the electron-transfer complexes in the isolated muscle mitochondria of Patient 2 were within normal ranges. Southern blot analysis revealed multiple deletions of mitochondrial DNA, some of which were common between the patients. Polymerase chain reaction of their muscle mitochondrial DNA detected multiple abnormal fragments indicating mitochondrial DNA deletions. We propose that a defect of the mitochondrial energy-trdnsducing system due to multiple mitochondrial DNA deletions is a novel genetic cause of inherited recurrent myoglobinuria. Ohno K, Tanaka M, Sahashi K, Ibi T, Sato W, Yamamoto T, Takahashi A, Ozawa T. Mitochondrial DNA deletions in inherited recurrent myoglobinuria. Ann Neurd 1%)1;29.364-369
Myoglobinuria, a synonym for acute rhabdomyolysis, is histologically characterized by acute degeneration and subsequent regeneration of skeletal muscle fibers from various causes. The disorder invariably shows myalgia with muscle weakness and occasionally complicates acute renal failure. Sometimes recurrent myoglobinuria is known to be inherited and is thought to be based on certain congenital metabolic defects. Although six forms of enzyme defects have been recognized, most of the metabolic defects underlying this disorder remain to be determined. The established enzymes whose defects are causally related to recurrent myoglobinuria are phosphorylase, phosphofructokinase, phosphoglycerate kinase, phosphoglyceromutase, lactate dehydrogenase, and carnitine palmitoyl transferase El]. Because the mitochondrial oxidative phosphorylation system is the main energy-producing machinery for muscle contraction, its dysfunction might provoke myoglobinuria. Defects in the mitochondrial energytransducing system, however, have never been described as a cause of inherited recurrent myoglobinuria. Conversely, recurrent myoglobinuria has never been described as a symptom of mitochondrial myopa-
thies, which are clinically heterogeneous disorders characterized by morphological abnormalities of muscle mitochondria [2}. We report, here, a distinct morphological abnormality and a molecular genetic defect of muscle mitochondria in brothers with inherited recurrent myoglobinuria. We propose that a defect of the mitochondrial energy-transducing system due to multiple deletions of mitochondrial DNA (mtDNA) is a novel cause of inherited recurrent myoglobinuria.
From the Departments of *Neurology and ?Biomedical Chemistry, Faculty of Medicine, University of Nagoya, and the $Department of Medicine, Neurology Section, Aichi Medical University, Japan.
Address correspondence to Dr Ozawa, Department of Biomedical Chemistry, Faculty of Medicine, University of Nagoya, 65 Tsurumacho, Showa-ku, Nagoya 466, Japan.
Methods Patients Patient 1 (26-year-oldman) experienced generalized muscular pain with myoglobinuria, which from age 18 years was provoked by strenuous exercise, heavy alcohol intake, or fasting for long periods. Recurrent episodes of rhabdomyolysis wasted his skeletal muscles to the extent that he needed the assistance of his arms to rise from a squatting position. Patient 2 (2 1-year-old man, brother of Patient 1)had similar episodes of recurrent myoglobinuria from age 18 years. Their mother, another brother, and other relatives were clinically normal. The serum creatine kinase levels of the mother and another brother were normal. There was no known consanguinity in
Received May 29, 1990, and in revised form Sep 19. Accepted for publication Sep 21, 1990.
364 Copyright 0 1991 by the American Neurological Association
their parents. Neither patient showed external ophthalmoplegia, pigmentary retinopathy, cardiac conduction block, ataxia, myoclonic epilepsy, or stroke-like episodes. Their intelligence quotients were normal. The serum creatine kinase levels were variably elevated depending on the preceding exercises or alcohol intake (Patient 1, 304-12,290 UIL; Patient 2, 166-9,350 U/L). The serum lactate levels of Patients l and 2 were normal at rest (Patient l, 0.94 mmolil; Patient 2, 1.64 mmol/l; normal, < 1.67 mmoliL). The serum pyruvate levels were normal at rest (Patient 1, 0.07 mmoli L; Patient 2, 0.09 mmoliL; normal, < 0.11 mmoliL). The profile of the serum lactate and pyruvatc levels was within normal ranges on the ischemic forearm exercise loading test, and no muscular cramp was induced. Pronounced elevations of serum lactate and pyruvate levels, however, were noted after an aerobic exercise that involved generating 15 W for 15 minutes on a bicycle ergometer.
Muscle Patboiogy Muscle biopsy specimens were obtained from the biceps brachii after signed consents were given. The serial sections of the muscles were stained histochemically for enzyme activities of succinate dehydrogenase and cytochrome c oxidase. Electron microscopic observations were also performed.
Enzymological Analysis The enzyme activities of NADH-ubiquinone oxidoreductase, succinate-cytochrome c reductase, and cytochrome c oxidase were measured in isolated muscle mitochondria as reported by Yoneda and colleagues 133.
Southern Blot Analysis Total DNA was isolated from 10 mg frozen biopsied muscles as described by Ozawa and co-workers [ 4 ] . The total muscle DNA (50 ng) was digested with restriction enzyme, PzwII, which cleaves a closed circular mtDNA at one site yielding one linear fragment of 16.6 kb in normal subjects. The digested total DNA was electrophoretically separated in a 0.6% agarose gel and blotted onto a nylon membrane (Hybond-N+, Amersham, Buckingharnshire, UK). A mixture of six fragments (2.0-3.0 kb), which was designed to cover the whole length of mtDNA, was amplified from control mtDNA by the polymerase chain reaction (PCR) method and used as a hybridization probe after labeling with horseradish peroxidase using the enhanced chemiluminescence (ECL) gene detection system (Amersham). Hybridization was performed at 42°C for 15 hours in the ECL hybridization buffer (Amcrsham) containing 0.5 M NaC1. The membrane was subjected to washing twice with 6 M urea, 0.4% sodium dodecyl sulfate, 75 mM NaCI, and 7.5 mM sodium citrate, p H 7.0, at 42°C for 20 minutes, followed by two washings with 0.3 M NaCl and 30 mM sodium citrate, p H 7.0, at room temperature for 5 minutes. The hybridized probes were detected by exposing the membrane to a radiographic film at room temperature for 5 minutes.
PCR Ana&~i.r Fragments of mtDNA were amplified from 10 ng total cellular DNA isolated from biopsied skeletal muscle by using the GeneAmp kit (Perkin-Elmer-Cetus, Norwalk, CT) and 1 p,M
Table 1. Synthesized Primers for the Polymerase Chain Reactions Primer' Sequence 5'+3'
Complementary Siteh
L853 ACGAAAATCTGTTCGCTTCA 8,531 to L881 CACCCAACTATCTATAAACC 8,811 to H1338 TCTTGTTCATTGTTAAGGTT 13,381 to H1420 TTAGTAGTAGTTACTGGTTG 14,201 to
8,550
8,830 13,400 14,220
"The first letter of the primer, L or H, specifies its priming strand. bThe site of mitochondrial DNA is according to the Cambridge sequence [5].
of each primer. Platelet mtDNAs obtained from the patients, their mother, and another brother were also subjected to PCR gene amplification. The primers synthesized for the reactions are shown in Table 1.We confirmed that no abnormal fragments were amplified in controls. The possibility of mispriming was excluded by the primer shift PCR method [6}. PCR was performed in a Thermal Cycler (Perkin-ElmerCetus) for a total of 35 cycles under the following condition: 15 seconds of denaturation at 94"C, 15 seconds of annealing at 55"C, and 80 seconds of primer extension at 72°C. We had designed the PCR condition to allow amplification of a fragment as long as 5 kb. Shorter denaturation period at 94°C seems essential for amplification of a large fragment. Amplified fragments were electrophoresed in 1% agarose gels, stained with 0.5 Fgiml ethidium bromide, and visualized on an ultraviolet transilluminator (TF-ZOM, Vilber Lourmat, Cedex, France).
Results Muscle Pathology Figure 1 shows histochemistry and electron microscopy of the biopsied biceps brachii in Patient 1. Central migration of nuclei, fiber splitting, and actively degenerating and regenerating fibers were observed in both Patients 1 and 2. The ratios of ragged-red fibers in Patients 1 and 2 were 4.7% and l.l%, respectively, whereas the ratios of cytochrome c oxidase-negative fibers were 8.7% and 7.995, respectively. All the ragged-red fibers and some cytochrome c oxidase-negative fibers were stained strongly for succinate dehydrogenase activity. Under electron microscopy, a pronounced accumulation of abnormal mitochondria containing paracrystalline inclusions was observed, and moderate increases of glycogen particles were also detected.
Enzymological Analysis T h e enzyme activities of the electron-transfer complexes in the isolated muscle mitochondria of Patient 2 were within normal ranges, as follows: N A D H ubiquinone oxidoreductase activity, 12 1 nmol/min/mg protein (controls, 146 f 59 [mean .t SD}; range, 81-246; n = 6); succinate-cytochrome c reductase activity, 254 nmol/min/mg protein (controls, 145 & 59; range, 79-261; n = 6); cytochrome coxidase activ-
Ohno et al: Inherited Recurrent Myoglobinuria
365
Fig I . Histochemistry and electron microscopy of the biopsied biceps brachii i n Patient 1. (A) Modfjied Gomori's tvichrome staining shows atypical ragged-red fiben, crntraral migvation of nuclei, hyaline degenerations. (Original mgnzfication, x 100.i (Bi Electron microscopy shows accumulation of abnormal mitochondria containing paracqstalline inclusions in snbsarcolemmal region (bar = 0.I pm). C and D are serialsections. (C)Succinate dehydrogenase activity staining indicates that some fibers are strongly activefor the enzyme. (Original magnzjication. x 100.) (0)Cytochrome c oxidase activity staining illnstrates that the succinate dehydrogenase-positive fibers (arrows i n C ) are exclusively negativefor cytochrome c oxidase (arrows). Conversely,some ofthe cytochrome c oxiduse-negative fibers react normallyforsuccinate dehydrogenase. (Original magnz$cation, x 100.)
ity, 1,007 nmol/min/mg protein (controls, 613 2 276; range, 325-1,143; n = 6). Southern Blot Analysis Southern blot hybridization of PmII-digested total muscle D N A probed with a mixture of six fragments covering the whole length mtDNA revealed multiple
366 Annals of Neurology Vol 29 No 4 April 1991
bands of deleted mtDNAs and a 16.6-kb band of normal-sized mtDNA (Fig 2). Although the blot indicated several common bands of 7, 8, and 7 kb between the patients, a 7-kb band indicating a deletion of 9.6 kb was dominant in Patient 1, and a 13-kb band indicating a deletion of 3.6 kb was dominant in Patient 2. Another experiment of Southern blot hybridization using a restriction enzyme, BamHI, which cleaves mtDNA at one site, also detected multiple abnormal bands (data not shown). PCR Analysir Electrophoretic patterns of the muscle mtDNA fragments amplified by the primer shift PCR method are shown in Figure 3. Sizes of the amplified abnormal fragments and the calculated sizes of deletions are shown in Table 2. In Patient 1, PCR amplification suggested the presence of four different mtDNA deletions in the region between the genes for ATPase 816 and the ND5 gene. The presence of 3.7-kb and 4.1-
kb mtDNA deletions were confirmed by shifting both L- and H-strand primers. The presence of 3.5-kb and 3.9-kb mtDNA deletions was confirmed by shifting Lstrand primers. In Patient 2, the primer shift PCR of the same region confirmed the presence of three different mtDNA deletions of 3.5, 3.8, and 3.9 kb. PCR survey for deleted mtDNAs in other regions of mtDNA using four primer pairs revealed several abnormal bands, some of which were common between the patients (data not shown). Gene amplifications of platelet mtDNA of Patients 1 and 2, their mother, and another brother failed to detect abnormal fragments even by using the same primer pairs as those used for muscle mtDNA amplifications (data not shown).
Fig 2. Southern blot analysis. The restriction enzyme, PvulI, cleaves a circukar mitochondria1 D N A at a singLe site, producing a linear fragment of 16.6 kb in the control (lane CI. In Patient 1 (lane I ) , abnormal bands of 9, 8: and 7 kb weye detected. In Patient 2 (lane 2))abnormal bands of 13, 9, 8, and 7 kb were detected. Among the multiple extra bands. the 7-kb band was dominant in Patient 1 , and the 13-kb band was dominant irr Patient 2.
Discussion Defects in the following six enzymes have been shown to be related to inherited recurrent myoglobinuria: phosphorylase, phosphofructokinase, phosphoglycer-
Fig .3. Electropho~ticpatt~ns of the primershijitpolymerase chain reaction (PCRj pmducts. PCR reactions with three pvimer pain ranging from the ATPase 816 genes to the ND5 gene amplzjied abnormalfragments (lanes PI and P2 represent Patients 1 and 2, ye.@ectivelyi. No abnorma1,fragments were ampl$ed in the control (lane Cj. Open arrowheads indicate normal mitochondria1 D N A lmtDNA) fragmena amplzjied by the PCR reactions. (A) Geae amplification using primers L853 and HI420 detected abnormul fragments of 2.0 and 1.6 kb in Patient I (lane P I ) and abnormal fragments of2.2, 1.9, 1.8. 1.0, and 0.8 kb in Patient
2 (lane P2). (B) Gene amplification using primers L853 and H I 338 detected abnormal fragments of 1.4, 1.2, 1 .O, and 0.8 kb in Patient I (lane P1i and abnormal fragments of 1.4, 1.1, and I .O kb in Patient 2 (lane P2). (C) Gene amplz$cation using primers L88I and H1.338 detected abnormal fragments of 1 .1, 0.9, 0.7, and 0.5 kb in Patient 1 (hne P I ) and abnormal fragments of 1.1, 0.8. and 0.7 kb in Patient 2 (lane P2). Closed arrowheads indicate definite mtDNA deletions determined by the shifis of both L- and H-strandprimers. The other abnomal fragments possibbi indicate mtDNA deletions.
Ohno et al: Inherited Recurrent Myoglobinuria 367
Table 2. Sizes of Abnormal Fragments Arnplz$ed with Three Primer Pairs and Calculation of Siza
of mtDNA Deletions
Patient
Primer Pair
Distance Between Primers (kb)
Fragment Size (kb)
Deletion Size (kb)
Patient 1
L85 3-H 1420
5.7
3. 7 a 4. 1"
L853-Hl338
4.7
2.0 1.6 1.4 1.2 1.0 0.8
Patient 2
L881-HI338
4.6
L853-H1420
5.7
1.1 0.9 0.7 0.5 2.2
1.9
L853-Hl338
4.7
L88 1-H1338
4.6
1.8 1.0 0.8 1.4 1.1 1.0 1.1 0.8 0.7
3.5b
3.7" 3.7b 4.1" 3.5b 3.7" 3.7b 4.1" 3.5" 3.8" 3.9" 4.7 4.7 3.5" 3.8" 3.7" 3.5" 3.8" 3.7"
'Definite deletion confirmed by comparing the change in sizes of amplified fragments with the shift in positions of both L- and H-strand primers. bPossible deletion suggested by comparing the change in sizes of amplified fragments with the shift in positions of L-strand primers.
ate kinase, phosphoglyceromutase, lactate dehydrogenase, and carnitine palmitoyl transferase 117. The first five enzymes are involved in glycogenolysis and glycolysis, and the last is involved in fatty acid transport. In our patients, the normal profiles of the serum lactate and pyruvate levels on the ischemic forearm exercise loading test excluded the defects in the first five enzymes. Carnitine palmitoyl transferase deficiency could be excluded on the basis of the histological findings. For this deficiency, an accumulation of lipid droplets is the only significant electron microscopic finding in the skeletal muscle 177. Our electron microscopic study revealed moderate increases of glycogen particles and morphologically abnormal mitochondria containing paracrystalline inclusions (see Fig 1). The mitochondrial abnormality in our patients was also indicated by ragged-red fibers in the modified Gomori's trichrome staining and cytochrome c oxidase-negative fibers in the activity staining. These morphological findings-glycogen storage and abnormal mitochondria in muscle fibers-suggest a disorder of the oxidative phosphorylation system [S]. The excessive deposition of glycogen particles in our patients may be attributed to a defect of mitochondrial oxidative metabolism with subsequent impairment of NAD H oxidation through the a-glycerophosphate-dihydroxyacetone phosphate shuttle and consequent inhibition of glycolysis. The induction of myoglobinuria by alcohol intake in our patients might also be related
368 Annals of Neurology Vol 29 No 4 April 1791
to impaired oxidation of N A D H generated in the cytoplasm by alcohol dehydrogenase. A defect of the mitochondrial energy-transducing system was also indicated by the pronounced elevations of serum lactate and pyruvate levels after an aerobic exercise loading test. Although the muscle pathology and the abnormal profile in the aerobic exercise loading test are consistent with mitochondrial myopathy, our patients lacked the symptoms common to mitochondrial myopathies, such as external ophthalmoplegia, pigmentary retinopathy, or cardiac conduction block. They are assumed to be an atypical presentation of mitochondrial abnormalities. In Kearns-Sayre syndrome and chronic progressive external ophthalmoplegia, most of the described mtDNA mutations are the heteroplasmy of a normalsized mtDNA and a largely deleted mtDNA 14, 9, 101. Conversely, there are two recent studies on pleioplasmy of a normal-sized mtDNA and multiple largely deleted mtDNAs that are detectable with the Southern blot analysis Ell, 121. We previously reported a patient with familial chronic progressive external ophthalmoplegia in which multiple mtDNA deletions were disclosed not by the Southern blot analysis but by the PCR method [GI. In our present study, multiple deletions of mtDNA were identified both by the Southern blot hybridization (see Fig 2) and by the gene amplification using the PCR method (see Fig 3). We and other investigators have recently described
the involvement of directly repeated sequences in the formation of mtDNA deletion [13, 141. These descriptions suggest that mtDNA deletions originate from either slipped mispairing or recombination. Therefore, it is unlikely that the multiple mtDNA deletions observed in our patients resulted from degradation of mtDNA due to recurrent rhabdomyolysis. We recently examined mtDNA deletions in another patient with acute rhabdomyolysis, but the patient lacked any detectable mtDNA deletion. This finding also suggests that the multiple mtDNA deletions found in Patients 1 and 2 are not the sequelae but the cause of their recurrent rhabdomyolysis. Although both patients had pleioplasmic mtDNA deletions, some deletions were common between them, whereas other deletions were detectable only in either of the patients. These results suggest that mtDNA deletions in these patients result from a mtDNA mutation that predisposes mtDNA itself to deletions. In this instance, the difference in clinical phenotypes among the patients, their mother, and another brother might be ascribed to a difference in the population of the mutant mtDNA, as is demonstrated in neurological disorders caused by maternal transmission of heteroplasmic mutant mtDNA [lS, 161. Alternatively, the mtDNA deletions might result from an abnormality of a nuclear gene product that is required for proper replication of mtDNA or for maintenance of intact mtDNA [lo]. Multiple mtDNA deletions and the consequent defects of mitochondrial energy-transducing system are a novel cause of inherited recurrent myoglobinuria. Moreover, the fact that multiple mtDNA deletions were found in a disease other than mitochondrial myopathy supports our recent hypothesis that mtDNA mutations are an important contributor to aging and degenerative diseases 1171. This work was supported in part by the Grants-in-Aid for General ScientificResearch (62570128) (to M.T.), and for Scientific Research on Priority Areas (Bioenergetics, 01617002) (to T.O.), from the Ministry of Education, Science, and Culture of Japan, and by Grants (to K.S., T.A., and T.O.) from the National Center for Nervous, Mental, and Muscular Disorders of the Ministry of Health and Welfare of Japan.
References 1. Penn AS. Myoglobinuria. In: Engel AG, ed. Myology. New York: McGraw-Hill, 1986:1785-1805 2. DiMauro S, Bonilla E, Zeviani M, et al. Mitochondrial myopathies. Ann Neurol 1985;17:521-538 3. Yoneda M, Tanaka M, Nishikimi H, et al. Pleiotropic molecular defects in energy-transducing complexes in mitochondrial encephalopathy (MELAS). J Neurol Sci 1989;92:143-158 4. Ozawa T, Yoneda M, Tanaka M, et al. Maternal inheritance of deleted mitochondrial DNA in a family with mitochondrial myopathy. Biochem Biophys Res Commun 1988;154:12401247 5. Anderson S, Bankier AT, Barrel BG, et al. Sequence and organization of the human mitochondrial genome. Nature 1981; 290:457-465 6. Sat0 W, Tanaka M, Ohno K, et al. Multiple populations of deleted mitochondrial DNA detected by a novel gene amplification method. Biochem Biophys Res Commun 1989;162: 664-672 7. Bank WJ, DiMauro S, Bonilla E, et al. A disorder of muscle lipid metabolism and myoglobinuria. N Engl J Med 1975;292: 44 3-449 8. DiMauro S, Schotland DL, Bonilla E, et al. Progressive ophthalmoplegia, glycogen storage, and abnormal mitochondria Arch Neurol 1973;29:170-179 9. Holt IJ, Harding AE, Morgan-Hughes JA. Deletions of muscle mitochondrial DNA in patients with mitochondrial myopathies. Nature 1988;33 1:717-7 19 10 Moraes CT, DiMauro S, Zeviani M, et al. Mitochondrial DNA deletions in progressive external ophthalmoplegia and KearnsSayre syndrome. N Engl J Med 1989;320:1293-1299 11 Zeviani M, Servidei S, Gellera C, et al. An autosomal dominant disorder with multiple deletions of mitochondrial DNA starting at the D-loop region. Nature 1989;339:309-311 12 Yuzaki M, Ohkoshi N, Kanazawa I, et al. Multiple deletions in mitochondrial DNA at direct repeats of non-D-loop regions in cases of familial mitochondrial myopathy. Biochem Biophys Res Commun 1989;164:1352-1 357 13. Schon EA, Rizzuto R, Moraes CT,et al. A direct repcat is a hotspot for large-scale deletion of human mitochondrial DNA. Science 1989;244:346-349 14. Tanaka M, Sato W, Ohno K, et al. Direct sequencing of deleted mitochondrial DNA in myopathic patients. Biochem Biophys Res Commun 1989;164:156-163 15. Singh G, Lott MT, Wallace DC. A mitochondrial DNA mutation as a cause of Leber’s hereditary optic neuropathy. N Engl J Med 1989;320:1300-1305 16. Holt IJ, Harding AE, Petty RKH, Morgan-Hughes JA, et al. A new mitochondrial disease associated with mitochondrial DNA heteroplasmy. Am J Hum Genet 1990;46:428-433 17. Linnane AW, Marzuki S, Ozawa T, Tanaka M. Mitochondrial DNA mutations as an important contributor to ageing and degenerative diseases. Lancet 1989;1:642-645
O h n o et al: Inherited Recurrent Myoglobinuria
369
