Tumor Biol. DOI 10.1007/s13277-015-4086-7

ORIGINAL ARTICLE

MiR-30a regulates the proliferation, migration, and invasion of human osteosarcoma by targeting Runx2 Ruyi Zhang 1 & Shujuan Yan 1 & Jing Wang 1 & Fang Deng 1 & Yangliu Guo 1 & Ya Li 1 & Mengtian Fan 1 & Qilin Song 1 & Hongxia Liu 1 & Yaguang Weng 2 & Qiong Shi 2

Received: 27 July 2015 / Accepted: 13 September 2015 # International Society of Oncology and BioMarkers (ISOBM) 2015

Abstract Osteosarcoma (OS) is the most common primary malignant bone tumor in young patients. However, treatment paradigms and survival rates have not improved in decades. MicroRNAs have been shown to be critical regulators of physiological homeostasis and pathological process, including bone disease. Nearly half of the microRNA (miRNA) genes are located at genomic regions and fragile sites known to be frequently deleted or amplified in various kinds of cancers. In this study, we investigated the role miR-30a in OS. A negative correlation between miR-30a expression and malignant grade was observed in OS cell lines. The overexpression of miR-30a reduced proliferation, migration, and invasion in 143B cells and the inhibitor of miR-30a increased proliferation, migration, and invasion in Saos2 cells. Further studies revealed that runt-related transcription factors 2 (Runx2) was a regulative target gene of miR-30a. Rescue assay significantly reversed the effects of overexpressing or inhibiting miR-30a. miR-30a also suppressed tumor formation and pulmonary metastasis in vivo. All the results suggest a critical role of miR30a in suppressing proliferation, migration, and invasion of OS by targeting Runx2.

* Qiong Shi [email protected] Yaguang Weng [email protected] 1

Key Laboratory of Diagnostic Medicine Designated by the Chinese Ministry of Education, Chongqing Medical University, Chongqing 400016, China

2

Department of Laboratory Medicine, Chongqing Medical University, 1 Yixueyuan Road, Chongqing 400016, China

Keywords Osteosarcoma . miR-30a . Runx2 . Proliferation . Migration . Invasion

Introduction Osteosarcoma (OS) is the most common malignant bone sarcoma and a leading cause of cancer death among children and adolescents [1–3]. Although great advances have been made in the treatment of OS, the survival rate reaches approximately 50–70 % at 5 years [4]. Unfortunately, it remained unchanged during the last few decades [5]. OS has a high propensity to metastasize, especially in the lung. Many of the patients die from lung metastasis [6]. Therefore, improvements of therapy in OS patients, particularly those who have metastatic mass, are needed. Thus, research focusing on the molecular mechanisms of OS may provide some new treatment strategy for OS. Runt-related transcription factors 2 (Runx2) is a key specific regulator of osteoblast differentiation, and its mutation associates with human cleidocranial dysplasia [7–9]. Runx2 stimulates the maturation of osteoblasts during bone differentiation [10]. However, its expression is dysregulated in some kinds of cancer, such as bladder urothelial carcinoma, prostate cancer, and osteosarcoma [11–15]. Runx2 is involved in bladder tumor carcinogenesis and aggressiveness [16]. A high expression of Runx2 is related to osteosarcoma metastasis and poor survival rate [17, 18]. MicroRNAs (miRNAs) are small molecules ranging in size from 17 to 22 bases [19–21]. miRNA-mediated control is one of the posttranscriptional mechanisms that suppress protein translation by matching to the 3′-untranslated region (UTR, 3′-UTR) of the target gene [22, 23]. Computational estimations suggest that one third of protein-coding genes are regulated by miRNAs [24, 25]. It has been shown that miRNAs were widely involved in multiple processes, including

Tumor Biol.

embryogenesis, differentiation, metabolism, and maturation, while aberrant miRNA expression has been associated with oncogenesis and tumor suppression [26]. Among many of the known miRNAs in cancer, miR-30a is abnormally expressed in various forms of carcinomas, including lung cancer, breast cancer, and hepatocellular carcinoma [27–30]. However, the role of miR-30a in osteosarcoma remains largely unknown. In this study, we found that there is an inverse relationship between miR-30a and the malignant degree of OS cell lines. Overexpression of miR-30a inhibited cell proliferation, migration, and invasion in 143B cells, whereas the opposite effect was observed with transfection of miR-30a inhibitor in Saos2 cells. Furthermore, we conducted bioinformatics, quantitative PCR (qPCR), Western blotting, and Luciferase reporter assay to reveal that miR-30a targets Runx2 in osteosarcoma.

Materials and methods

of CFX Connect™ Real-Time System (Bio-Rad) and the SYBR Premix Ex Taq (TaKaRa). GAPDH or U6 was used as an internal control. miRNA expression was quantified by the 2−ΔΔCt method. Cell viability assay In 96-well culture plates (Corning, Shanghai, China), 1×103 OS cells were seeded per well. The cells were treated with recombinant adenovirus expressing red fluorescent protein (RFP), miR-30a (Ad-miR-30a), Runx2 (Ad-Runx2), siRNAtargeted Runx2 (Ad-siRunx2), or the inhibitor of miR-30 (InmiR-30a) (GenePharma, Shanghai, China) or control inhibitor (In-control). At the indicated time, 20 μL of MTT reagent was added to each well, including controls. Plates were returned to cell culture incubator for 4 h. The supernatant was removed and formazan was dissolved in DMSO by swirling gently, and then absorbance was measured at 492 nm using a microplate reader.

Cell culture Wound healing assay The HEK-293 and human OS cell lines of 143B, MG-63, and U2OS and normal bone marrow cell line of HS-5 were maintained in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10 % fetal bovine serum (FBS) (HyClone, Logan, USA) and antibiotics, and Saos2 cell line was cultured in 15 % FBS. All cell lines were obtained from the American Type Culture Collection (ATCC). HEK-293 cells were used for adenovirus amplification. Quantitative reverse transcription PCR Total RNA was extracted from OS cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Complementary DNA was synthesized by the Reverse Transcriptase M-MLV kit with random hexamer primers (TaKaRa, Dalian, China) (Table 1). Gene expression levels in each group were measured using Real-Time RT-PCR Table 1 Primers of PCR (Homo sapiens)

The cells were seeded in six-well plates and infected with adenovirus the next day. When the cells formed a confluent monolayer, wounds were produced using a 200-μL pipette tip scratched through the center of the well. The culture medium of 143B and Saos2 cells was replaced with either serum-free or 10 % FBS. The initial wound photomicrographs were taken for comparison and to allow migration into blank areas for 24 h in 143B cells or 48 h in Saos2 cells, respectively. Scratch wound healing was monitored by bright-field microscopy. Transwell cell migration and invasion assays Hanging cell culture insert (Millipore, Beijing, China) was utilized to measure the cell migration and invasion ability. For migration assays, approximately 7.5×104 143B and 1× 105 Saos2 cells in 400 μL serum-free medium were seeded

Name of gene

Gene-specific primers (5′–3′)

Hsa-miR-30a

RT primer: GTCGTATCCAGTGCAGGGTCCGAGGTATT CGCACTGGATACGACCTTCCA Forward: GGCTTGTAAACATCCTCGAC Reverse: GTGCAGGGTCCGAGGT RT primer: AAAATATGGAACGCTTCACGAATTTG Forward: CTCGCTTCGGCAGCACATATACT

U6

Runx2 GAPDH

Reverse: ACGCTTCACGAATTTGCGTGTC Forward: TGACCAGTCTTACCCCTCCT Reverse: CTGAAGCACCTGAAATGCG Forward: CAGCGACACCCACTCCTC Reverse: TGAGGTCCACCACCCTGT

Tumor Biol.

into the non-coated chamber; the lower chamber was filled with 600 μL complete medium containing 10 % FBS. For invasion assays, the Transwell membrane was coated with 1:3 diluted Matrigel (BD Biosciences, San Jose, CA, USA) and dried overnight. After incubation for 24 h, stationary cells were removed from the upper surface of the membrane and cells that penetrated the pore filter were fixed and stained with crystal violet solution. The number of stained cells was counted from five random fields under a microscope.

were co-transfected with 200 ng recombination plasmid, 200 ng β-gal reporter control plasmid, and optimum AdmiR-30a or Ad-GFP using Lipofectamine 2000 (Invitrogen). The medium was changed with complete medium containing 10 % FBS after 6 h, and 143B cells were lysed to be measured 36 h posttransfection. Luciferase activities were detected using the Luciferase Assay System (Promega, San Luis Obispo, CA, USA) with a GloMax luminometer (Promega), and the results were normalized against β-gal activities by βGalactosidase Assay Kit (Beyotime, Beijing, China).

Western blot analysis Adenovirus infection and the inhibitor transfection For protein isolation, RIPA buffer was prepared. Cell lysis solution was centrifuged at 13,000×g for 5 min at 4 °C and the supernatants were collected. The protein concentration was determined using the BCA assay. Proteins were loaded in SDS-PAGE on 10 % polyacrylamide gels and transferred to PVDF membranes. The membrane was blocked for 0.5 h at room temperature using 5 % skim milk, followed by primary antibody incubation. After washing three times with TBST, 5 min each, the membranes were incubated with a secondary antibody for 1 h at room temperature and washed again. Immunoblotting was performed with rabbit anti-Runx2 (1:800, Santa Cruz Biotechnology, TX, USA) and mouse anti-β-actin (1:1000, Santa Cruz Biotechnology) antibodies. Goat antirabbit and anti-mouse IgGs (Zhongshan, Beijing, China) were used as secondary antibodies diluted at 1:5000. Images were acquired using Immobilon Western Chemiluminescent HRP Substrate kit (Millipore, Beijing, China) according to the manufacturer’s protocol. Flow cytometry analysis of cell cycle OS cells were seeded into six-well culture plates. Adenovirus was added, while the cellular confluence is at 60 %. Log phase cells from each group were harvested by trypsinization and washed with cold phosphate-buffered saline (PBS) thrice. OS cells were fixed at a concentration of 1×106 cells/mL with 70 % cold ethanol. A FACSVantage SE flow cytometer (Becton Dickinson, USA) was utilized to measure cell cycle distribution. Luciferase reporter assay The 3′-UTR reporter plasmids were constructed by introducing a 59-base pair miR-30a seed sequence containing Runx2 3′-UTR fragment into the multiple inserting predicted in the pMIR-REPORT Luciferase miRNA Expression Reporter Vector (Invitrogen) with HindIII/ SpeI. The wild-type and mutant Runx2 3′-UTR complementary oligonucleotides (BIOLIGO, Shanghai, China) were annealed in boiling water bath for 10 min then cooled down in room temperature. When 143B cells were 60 % confluent in 24-well plates, the cells

The cells were infected with adenovirus or the control vectors Ad-GFP. The medium was replaced to reduce the toxicity of polybrene after the infection 8–10 h. To find available efficiency of infection, the fluorescence was observed 24 h later. The inhibitor of miR-30a was synthesized by GenePharma (Shanghai, China). Oligonucleotide transfection was performed with Entranster-R RNA Transfection Reagent (Engreen Biosystem, Beijing, China) according to the manufacturer’s instructions. Animal studies All animal experiments in the present study were performed in compliance with the guidelines of the Committee on Use of Live Animals in Chongqing Medical University. The xenograft model was established as previously reported [31]. Briefly, 4-week-old male athymic nude mice were anesthetized by exposure to 3 % isoflurane, and then, 1.5×106 143B cells was injected into the tibia. The tumor size was measured by calipers and calculated by the following formula: (smallest diameter2 ×widest diameter)/2. The nude mice were sacrificed after 45 days, and tumor tissues and the lungs were collected and stained with H&E in order to examine the histopathology. Statistical analysis All collected data were subjected to statistical analysis. Student’s t test or one-way ANOVA was used to examine the difference. P