G Model
ARTICLE IN PRESS
NSL 30562 1–6
Neuroscience Letters xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
Neuroscience Letters journal homepage: www.elsevier.com/locate/neulet
MiR-134 blockade prevents status epilepticus like-activity and is neuroprotective in cultured hippocampal neurons
1
2
3 4 5 6
Q1
Xiao-Mu Wang a,1 , Rui-Hua Jia b,1 , Dong Wei a , Wei-Yun Cui c , Wen Jiang a,∗ a b c
Department of Neurology, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, China Department of Neurology, People’s Liberation Army 457th Hospital, Wuhan 430012, China Tianjin Neurological Institute, Tianjin 30052, China
7
8 9 10 11 12
h i g h l i g h t s • MiR-134 is increased by SE-like electrographic activities in vitro. • Inhibiting miR-134 using lentivirus reduces SE-like electrographic activities in vitro. • Inhibiting miR-134 is neuroprotective in cultured hippocampal neurons.
13
14 27
a r t i c l e
i n f o
a b s t r a c t
15 16 17 18 19 20
Article history: Received 21 February 2014 Received in revised form 24 April 2014 Accepted 29 April 2014 Available online xxx
21
26
Keywords: Status epilepticus MiR-134 Hippocampal cultures Lentivirus
28
1. Introduction
22 23 24 25
29 30 31 32 33 34 35
Status epilepticus (SE) is a life-threatening neurological disorder associated with significant morbidity and mortality. MicroRNAs (miRNAs) are small, non-coding RNAs that act post-transcriptionally modulating messenger RNA (mRNA) translation or stability which may have important roles in the pathogenesis of epilepsy. It has been reported that silencing microRNA-134 in vivo has significant neuroprotective and prolonged seizure-suppressive effects. However, the mechanism by which miR-134 inhibition suppressed seizures and whether miR-134 inhibition works in an in vitro model of SE, is unknown. Compared to a complex in vivo system, in vitro models of SE-like electrographic activity can be powerful tools to study this miRNA. Using a cell culture model of low Mg2+ treatment of rat hippocampal neurons, we found SE-like electrographic activity increased expression of miR-134. Inhibiting expression of miR-134 using an inhibitor lentivirus with two miR-134 binding sites reduced SE-like electrographic activity in the hippocampal neurons and reduced neuronal death. This study provides direct evidence that inhibition of miR-134 can block status epilepticus-like discharges and is neuroprotective in hippocampal neuronal cultures and implies that inhibiting miR-134 may be a potential candidate for the clinical treatment of SE. © 2014 Published by Elsevier Ireland Ltd.
Status epilepticus (SE) is defined as seizure events that last greater than 30 min or intermittent seizures without regaining consciousness [1]. SE is a life-threatening neurological disorder associated with a significant morbidity and mortality [1,2]. In southwest China, the proportion of SE patients who died within 30 days was as high as 15.8% [3]. So there is a growing demand for developing newer medications to treat SE.
∗ Corresponding author. Tel.: +86 29 84771319; fax: +86 29 85206750. E-mail addresses: [email protected], [email protected] (W. Jiang). 1 These authors contributed equally to this work.
MicroRNAs (miRNAs) are a family of small (∼22nt) noncoding RNAs that regulate post-transcriptional expression of proteincoding mRNAs. In neurons, miRNAs have been found to regulate translation of a wide range of proteins [4]. These proteins involved in neuronal morphology, ion channels, neuronal migrations, etc. Lots of evidences indicated that miRNAs may be critical to the pathogenesis of epilepsy [5,6]. In rat hippocampus neurons, miR134 is specifically expressed and localized to neuronal dendrites and negatively regulates the size of dendritic spines [7,8]. In vivo silencing miR-134 with antagomirs reduced pyramidal neuron spine density [9]. Remodeling of dendrites and spines loss could contribute to the neuronal hyperexcitability of epilepsy [10]. In hippocampal neurons, miR-134 targets Lim-domain containing kinase 1 (Limk1) mRNA, thereby preventing the Limk1 protein translation. Some miR-134 targets have been identified, including the RNA
http://dx.doi.org/10.1016/j.neulet.2014.04.049 0304-3940/© 2014 Published by Elsevier Ireland Ltd.
Please cite this article in press as: X.-M. Wang, et al., MiR-134 blockade prevents status epilepticus like-activity and is neuroprotective in cultured hippocampal neurons, Neurosci. Lett. (2014), http://dx.doi.org/10.1016/j.neulet.2014.04.049
36 37 38 39 40 41 42 43 44 45 46 47 48 49 50
G Model NSL 30562 1–6
ARTICLE IN PRESS X.-M. Wang et al. / Neuroscience Letters xxx (2014) xxx–xxx
2
75
binding protein Pum2 [11], CREB [12] and DCX [13]. The mechanism of miR-134 remodeling of dendritic spines was confirmed to be via miR-134 locally targeting translation of Limk1 within dendrites in in vivo experiments [9,10]. But the mechanism by which miR-134 antagomirs suppressed seizures and how miR-134 works in the in vitro SE model is unknown. The low Mg2+ hippocampal neuronal culture model of SE-like electrographic activity has been used as a powerful tool to study SE and this model has been widely used to study SE mechanisms in an in vitro setting. The hippocampal neuronal culture model of SE-like electrographic activity can manifest the same neuronal spike frequency and epileptiform discharges observed with animals and human SE [14–16]. This in vitro model is well suited to carry out biochemical, molecular, and electrophysiological investigations of SE. So our study was initiated to evaluate the effectiveness of inhibiting miR-134 with lentivirus in treating SE in vitro, employing the well-characterized hippocampal neuronal culture model of SE-like electrographic activity in order to provide a foundation for the further research in mechanism by which down-regulating miR-134 suppressed seizures. We found that SE resulted in an increase in mature miR-134 levels in the hippocampal neuronal cultures. Inhibiting miR-134 with lentivirus could effectively reduce SE-like electrographic activities in the model and was neuroprotective.
76
2. Materials and methods
77
2.1. Materials
51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74
88
Neurobasal-A medium, B27, fetal bovine serum were obtained from Gibco-BRL (Invitrogen Corp., San Diego, CA). Hoechst was purchased from Beyotime Institute of Biotechnology (Jiangsu, China). All the reagents were purchased from Sigma Chemical Co. (St. Louis, MO, USA). The following antibodies were used in this study: rabbit anti-LIMK1 (1:500 Biorbyt), goat anti-rabbit IgG (HRP) antibody (1:3000 Biorbyt), mouse anti-NeuN (1:300 Merck Millipore), rabbit anti-GFAP (1:200 Sigma), goat anti-mouse IgGAlexa Fluor 488 and goat anti-rabbit IgGAlexa Fluor 594 conjugated secondary antibodies (1:500 Invitrogen). 4 , 6 diamidino-2-phenylindole (DAPI) (Vector Laboratories Ltd.).
89
2.2. Primary rat hippocampal neuron cultures
78 79 80 81 82 83 84 85 86 87
30 mM phosphate buffer, pH 7.4) overnight at 4 ◦ C. Neurons were then washed five times in PBS for 10 min at room temperature and incubated with Alexa-conjugated secondary antibodies in PBS for 2 h at room temperature and washed three times in PBS for 10 min. Neurons were incubated with 0.1 g/ml DAPI in PBS for 8 min and washed three times in PBS for 10 min. 2.4. Hippocampal neuronal culture model of status epilepticus-like electrographic activities (SE-like electrographic activities) Exposing neuronal cultures to physiological bath recording solution (pBRS) without added MgCl2 (low Mg2+ ) containing (in mM): 145 NaCl, 2.5 KCl, 10 HEPES, 2 CaCl2 , 10 glucose and 0.002 glycine, pH 7.3, with the osmolarity adjusted to 315–325 mOsm with sucrose for 2.5 h induced high-frequency epileptiform bursts (SE-like electrographic activities). The SE-like electrographic activities continued until pBRS containing 1 mM MgCl2 was added back to the cultures. Thus, low Mg2+ treatment was carried out with pBRS without added MgCl2 , whereas controls were treated with pBRS containing 1 mM MgCl2 . 2.5. Whole cell current clamp recordings Whole-cell current clamp recordings were performed using previously established procedures [15,16]. Briefly, cell culture dish was mounted on the stage of an inverted microscope (DM-LFSA, Leica, Germany) continuously perfused with pBRS. Patch electrodes with a resistance of 4–7 M were pulled on a Brown-Flaming P97 electrode puller (Sutter Instruments, USA), fire-polished and filled with a solution containing the following (in mM): 140 K + gluconate, 1.1 EGTA, 1 MgCl2 , 10 HEPES and 2 Mg-ATP, pH 7.2, osmolarity 290 ± 10 mOsm adjusted with sucrose. Recordings were carried out using an Axopatch 700B amplifier (Axon Instruments, Foster City, CA) in current-clamp mode. The data were transferred to a PC using a Digidata 1440A (Axon Instruments, USA) interface and acquired using pCLAMP 9 (Axon Instruments) software. Neurons with resting membrane potentials ≤50 mV were selected for recording action potential. 2.6. Western blotting
100
All animals were purchased from the Animal Center of the Fourth Military Medical University. Studies were conducted on primary mixed hippocampal neuronal cultures prepared as described previously with slight modifications [16]. Primary hippocampal cultures were prepared from embryonic day 18 (E18) SD rat brains. Cells were plated onto a 35-mm Falcon cell culture dishes or glass coverslips coated with poly-l-lysine (0.05 mg/ml). Hippocampal cultures were maintained at 37 ◦ C in a 5% CO2 /95% air atmosphere and grown in neurobasal medium (NB) supplemented with 2% B27, 0.5 mM l-glutamine, 100 units/ml penicillin and 100 g/ml streptomycin. Cultures were fed twice weekly.
Western blotting was performed using previously established procedures [9]. For Western blotting, cultured hippocampal neurons were harvested in SDS buffer and boiled. Samples were loaded onto SDS-PAGE gels and subjected to Western blotting on nitrocellulose membranes. Blots were blocked with 2% bovine serum albumin/0.05% Tween-20 in PBS and incubated with the primary antibodies: Limk1 (1:1000, Biorbyt) and -actin (1:2000, Sigma–Aldrich) at 4 ◦ C overnight. Blots were washed with 0.05% Tween-20 in PBS, incubated with secondary antibodies and developed with enhanced chemiluminescent Western blotting substrate. Images were captured using a Fuji-Film LAS-300 and densitometry performed using AlphaEaseFC4.0 gel-scanning integrated optical density software (Alpha Innotech).
101
2.3. Immunofluorescent staining
2.7. RNA isolation and quantitative real time PCR
Immunocytochemistry was performed using a standard double labeling immunofluorescence method as described previously with slight modifications [17]. After 7–10 days, cultures were utilized for immunofluorescence staining. neurons were fixed for 30 min with 4% paraformaldehyde in phosphate-buffered saline (PBS) at room temperature. After fixation, cells were washed three times in PBS for 10 min at room temperature, and incubated with primary antibodies in GDB buffer (0.2% BSA, 0.8 M NaCl, 0.5% Triton X-100,
RNA isolation and quantitative real time PCR were performed with reference to previous procedures [9]. Primary rat hippocampal neurons were plated at a density of one million per well. Cells were harvested at 7 days. Total RNA was extracted using the miRNeasy kit (Qiagen) according to the manufacture’s instruction and 200 ng reverse transcribed using SYBR PrimeScriptmiRNA RT-PCR kit (TaKaLa RR716) following the handbook protocols. We used RT specific primers for rat miR-134 (TaKaLa) and qPCRs were
90 91 92 93 94 95 96 97 98 99
102 103 104 105 106 107 108 109
Please cite this article in press as: X.-M. Wang, et al., MiR-134 blockade prevents status epilepticus like-activity and is neuroprotective in cultured hippocampal neurons, Neurosci. Lett. (2014), http://dx.doi.org/10.1016/j.neulet.2014.04.049
110 111 112 113 114 115
116 117 118
119 120 121 122 123 124 125 126 127 128
129
130 131 132 133 134 135 136 137 138 139 140 141 142 143 144
145
146 147 148 149 150 151 152 153 154 155 156 157 158
159
160 161 162 163 164 165 166 167
G Model NSL 30562 1–6
ARTICLE IN PRESS X.-M. Wang et al. / Neuroscience Letters xxx (2014) xxx–xxx
171
carried out on a IQ5 Fast Realtime System (Bio-Rad) using SYBR PrimeScriptmiRNA RT-PCR kit (TaKaLa RR716). U6 (TaKaLa) was used for normalization. The data were analyzed using the 2−CT method for relative quantitation.
172
2.8. Hoechst/PI staining
168 169 170
173 174 175 176 177 178 179 180 181 182 183 184 185
186 187
188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229
To determine the portion of dead cells, primary rat hippocampal neurons were observed with PI and hoechst double staining. As a nucleic acid staining, hoechst was utilized to stain nuclei of normal and apoptotic cells while PI was used to visualize the necrotic cells. At 24 h post-hippocampal neuronal culture model of SE-like electrographic activities, PI (1 mM) and hoechst (5 mM) were added to the culture medium and incubated in the dark at 37 ◦ C for 30 min. For quantitation of dead cells, the numbers o PI+ cells plus hoechst+ cells with condensed nuclei were counted in a visual field (about 0.3 mm2 ) at 200× and at least five different visual fields were included in each group. The percentages of surviving cells (excluding apoptotic and necrotic cells) to total cells were calculated.
3
For infection, 4 DIV (days in vitro) rat neurons were cultured in serum-free culture medium, and miR-134 inhibitor recombinant lentivirus with a multiplicity of infection (MOI) of 5 was used to infect the neurons. GFP expression in the infected cells was observed daily under an inverted fluorescence microscope. Three days after infection, miR-134 inhibitor recombinant lentivirus- or control virus-infected and -uninfected neuronal cells were collected, and were exposed to pBRS without added MgCl2 (low Mg2+ ). Then the recombinant lentivirus-infected neuronal cells were used for the following experiments. 2.10. Data analysis Data are expressed as mean ± SEM and were analyzed by Statistical Product and Service Solutions (SPSS) software using paired t-test, unpaired t-test or one-way ANOVA and P < 0.05 was considered as significant.
3. Results
2.9. Rat miR-134 inhibitor lentiviral vector construction, virus packaging and infection
3.1. MiR-134 is increased by SE-like electrographic activities in cultured hippocampal neurons
Lentiviral vector backbone plasmid pCDH-CMV-MCS-EF1copGFP was digested with BamHI and SalI to remove EF1-copGFP. The EGFP ORF fragment was amplified by primer pair EGFPF (5 -CTAGGATCCATGGTGAGCAAGGGCGAGGAG-3 ) and EGFPR (5 CAGGTCGACGAATTCGCGGCCGCCTCGAGCTGCAGTTACTTGTACAGC TCGTC CATGCCG-3 ). The sequencing confirmed EGFP fragment was digested with BamHI and SalI and then inserted into the above digested vector to get a plasmid named pCDH-CMV-MCS-EGFPMCS. A synthesized 362 bp long DNA fragment which containing two miR-134 competitive binding sites was digested with XhoI and EcoRI and inserted into downstream of EGFP sequences in pCDHCMV-MCS-EGFP-MCS vector to get rat miR-134 inhibitor lentiviral vector. The sequence of the synthesized DNA sequence with miR-134 competitive binding sites underlined is as follows: 5 CAAGTAGCTCGAGTGCGGCCCCAAATAATGATTTTATTTTGACTGATA GTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGC CAACTTTGTACAAAAAAGCAGGCTGCGATCGCAATATTTGCATGTCGC TATGTGTTCTGGGAAATCACCATAAACGTGAAATGTCTTTGGATTTGG GAATCTTATAAGTTCTGTATGAGACCACGGATCCGACGGCGCTAGGAT CATCAACCCCCTCTGGTCAATCTACCAGTCACACAAGTATTCTGGTCAC AGAATACAACCCCCTCTGGTCAATCTACCAGTCACACAAGATGATCCT AGCGCCGTCTTTTTTGAATTCTCG-3 . The newly generated miR-134 inhibitor lentiviral vector and three other helper plasmids pLP1, pLP2, pLP/VSV-G (Invitrogen, Carlsbad, CA) were amplified and their concentration was adjusted to 1 g/l. Ninety percent of confluent 293T cells in 100 mm dishes were transfected with plasmid DNA containing 15 g miR-134 inhibitor plasmids or 15 g pCDH-CMV-MCS-EGFP-MCS (negative control vector), 6.5 g pLP1, 2.5 g pLP2, and 3.5 g pLP/VSVG through Lipofectamine2000 (Invitrogen, Carlsbad, CA) method according to the manufacture’s instructions. After overnight incubation, the medium with plasmids was replaced by 10 ml fresh Dulbecco’s modified Eagle’s medium medium supplemented with 10% fetal bovine serum, 2 mmol/l l-glutamine, 100 IU/ml penicillin, and 100 g/ml streptomycin (Mediatech, Herndon, VA). Supernatants were harvested after 30 h culture and filtered through a 0.45 m membrane. The filtered supernatant was mixed with 10% PEG-10,000 and incubated at 4 ◦ C overnight, then was centrifuged for 1 h at 3500 rpm. The pellet containing lentivirus was resuspended in PBS, and aliquots were stored at −80 ◦ C. Viral titers were assayed by infection of 293T cells at different dilutions; titers were adjusted to 1 × 108 IU/ml before infection.
First, we investigated whether the SE-like electrographic activities affected the expression of miR-134 in vitro. Prolonged SE-like electrographic activities were triggered by exposing the hippocampal neurons to a solution containing no added MgCl2 (low Mg2+ ). Real-time quantitative PCR (RT-qPCR) was used to measure the expression level of miR-134 at 24 h, 48 h, and 72 h after SElike electrographic activities. Compared to the control group, the mature miR-134 was significantly increased at 72 h after SE-like electrographic activities (P = 0.0114) (Fig. 1A). This suggested that miR-134 may involved in the pathophysiological consequences of SE. 3.2. MiR-134 blockade blocks SE-like electrographic activities in cultured hippocampal neurons As shown above, miR-134 is increased by SE-like electrographic activities in hippocampal neurons. So we hypothesized that inhibiting miR-134 might affect the cultured hippocampal neuron model of SE-like electrographic activities. To evaluate the anti-hyperexcitability effects of inhibiting miR-134, neuronal cells cultured for 4 days were infected with rat miR-134 inhibitor recombinant lentivirus at a multiplicity of infection (MOI) of 5. Three days after infection, strong GFP expression was observed in the infected cells under an inverted fluorescence microscope (Fig. 1B) and miR134 is decreased in virus-infected hippocampal neurons (Fig. 1C). Then the virus-infected neuronal cell culture dish was mounted on the stage of an inverted microscope, whole-cell current-clamp recordings were carried on the in vitro models of SE. The frequency of SE-like electrographic activity was determined to evaluate the effectiveness of miR-134. Whole-cell current-clamp recordings from 1-week-old control neurons showed baseline activity with the occasionally spontaneous action potentials (Fig. 1D(a)). Removal of MgCl2 (low-Mg2+ ) from the recording solution (cont virus + SE group and SE group) resulted in SE-like electrographic activities (Fig. 1D(b, c)). This hyperexcitable state consisted of repetitive individual burst discharges. The continuous epileptiform activity in this model is characterized by the spike frequency 3 Hz and lasting more than 30 min during the low-Mg2+ exposure. Compared with low-Mg2+ treatment alone, inhibiting miR-134 with lentivirus blocks SE-like electrographic activities (Fig. 1D. d). The frequency of epileptiform burst discharges per minute (23.00 ± 2.082, N = 3)
Please cite this article in press as: X.-M. Wang, et al., MiR-134 blockade prevents status epilepticus like-activity and is neuroprotective in cultured hippocampal neurons, Neurosci. Lett. (2014), http://dx.doi.org/10.1016/j.neulet.2014.04.049
230 231 232 233 234 235 236 237 238 239
240
241 242 243 244
245
246 247
248 249 250 251 252 253 254 255 256 257 258
259 260
261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286
G Model NSL 30562 1–6
ARTICLE IN PRESS X.-M. Wang et al. / Neuroscience Letters xxx (2014) xxx–xxx
4
Fig. 1. MiR-134 blockade blocks status epilepticus activities in cultured hippocampal neurons. (A) MiR-134 up-regulation following in the hippocampal neuronal culture model of SE. RT-qPCR measurement of miR-134 (normalized to U6) in cultured hippocampal neurons at 24 h, 48 h and 72 h after SE (n = 3 per group). MiR-134 levels were significantly increased at 72 h after SE (P = 0.0114). *P < 0.05 compared with the control group. (B) Lentivirus transfected cultured hippocampal neurons. Fluorescent images of the virus-infected, control virus-infected and control neuronal cells. Three days after infection, strong GFP expression was observed in the virus-infected cells under an inverted fluorescence microscope. Scale bar, 60 m. (C) MiR-134 is decreased in virus-infected hippocampal neurons. 4 DIV primary hippocampal neurons were transfected with cont virus and virus. At 7 DIV, RNA was harvested and qPCR analysis was performed. (P = 0.0017). **P < 0.01 compared with the cont virus group. (D) Continuous wholecell current-clamp recorded the frequency of epileptiform burst discharges in control group (exposure to normal Mg2+ solution), cont virus + SE group (before low-Mg2+ given control lentivirus pre-treatment), SE group (non-transfected neurons) and virus + SE group (before low-Mg2+ given lentivirus pre-treatment) in hippocampal neurons. (a) A representative recording from a control neuron showed occasional spontaneous action potentials. (b) A representative recording from cont virus + SE group (before low-Mg2+ given control lentivirus pre-treatment) showed continuous tonic high frequency epileptiform bursts. (c) A representative recording during low-Mg2+ treatment showed continuous tonic high frequency epileptiform bursts (SE). (d) Inhibiting miR-134 with lentivirus significantly blocks SE activities. (E) Bar graph representing average frequencies of cont virus + SE group and inhibiting miR-134 + SE group (n = 3; P = 0.0014).**P < 0.01 compared with the cont virus + SE.
287
was significantly decreased by inhibiting miR-134 (6.00 ± 0.5774,
288Q2 N = 3) (P = 0.0014) (Fig. 3D).
289 290
291 292 293 294
3.3. MiR-134 inhibitor treatment reverse the LIMK1 depression by SE-like electrographic activity induction We next investigated whether LIMK1 protein levels were altered in the hippocampus neuronal culture models of SE-like electrographic activities. First we observed LIMK1 protein levels are decreased in cultured hippocampal neurons 72 h after SE-like
electrographic activities (Fig. 2A). Then, we detected LIMK1 protein levels in cont group, cont virus + SE group and inhibiting miR-134 + SE group. Three days after infection, neuronal cells were collected, Western blot was carried on the hippocampus neuronal culture models of SE-like electrographic activities to test the LIMK1 protein level. Compared with the control group, LIMK1 protein levels in cont virus + SE group are decreased. But miR-134 inhibitor pre-treatment can reverse the LIKM1 depression by SE-like electrographic activities (Fig. 2B). This suggested that LIMK1 may be one of the target of miR-134 in the
Please cite this article in press as: X.-M. Wang, et al., MiR-134 blockade prevents status epilepticus like-activity and is neuroprotective in cultured hippocampal neurons, Neurosci. Lett. (2014), http://dx.doi.org/10.1016/j.neulet.2014.04.049
295 296 297 298 299 300 301 302 303 304
G Model NSL 30562 1–6
ARTICLE IN PRESS X.-M. Wang et al. / Neuroscience Letters xxx (2014) xxx–xxx
5
Fig. 2. Inhibiting miR-134 is neuroprotective in cultured hippocampal neurons. (A) Limk1 is decreased by status epilepticus activities. Photomicrographs showing Limk1 (red) expression in rat hippocampal tissues, below Limk1 (red)/hoechst (blue) expression in cultured hippocampal neurons 72 h after SE compared to control (cont). Insets indicate limk1 positive (red) cells. Scale bar, 60 m. (B) Limk1 protein levels in cont virus + SE group, cont group, and inhibiting miR-134 + SE group. Bar graph shows Limk1 Western blot (72 h after transfection) and densitometry. **P < 0.01 vs. cont virus + SE group. (C) Representative photomicrographs showing hoechst/PI double stained neurons in control group, control lentivirus or lentivirus pre-treatment group. Scale bar, 60 m. (D) Bar graph shows the percentages of surviving cells in different groups. ***P < 0.001 Q3 vs. cont virus + SE group. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
305 306
307 308
309 310 311 312 313 314 315 316 317 318
hippocampus neuronal culture models of SE-like electrographic activities.
3.4. Inhibiting miR-134 is neuroprotective in cultured hippocampal neurons Then, we tested whether inhibiting miR-134 with lentivirus pre-treatment could protect cultured hippocampal neurons against SE injury. After 2.5 h of prolonged seizure-like activities and 24 h recovery, hoechst and PI double staining showed that after 24 h post-SE-like electrographic activity, about 50% neurons were dead while inhibiting miR-134 with lentivirus could decrease SE-induced cell death to 28% (Fig. 2C and D). The results suggested a significant neuroprotective effect of inhibiting miR-134 with lentivirus in SE-like electrographic activity model.
4. Discussion Our study shows lentivirus-mediated miR-134 blockade suppress SE-like electrographic activities in hippocampal neuronal culture model. Our study indicates inhibiting miR-134 may be a new strategy for the treatment of SE. SE-like electrographic activity was induced after exposing cultured hippocampal neurons to low-Mg2+ solution, with spike frequency within epileptiform bursts ranging from 5 Hz to 18 Hz. This SE-like electrographic activity in vitro model is a commonly used model to study the mechanisms underlying seizures and seizure-induced plasticity [1,14]. The hippocampal neuronal culture model of SE-like electrographic activity has the unique advantage to study molecular mechanisms underlying SE [16]. During exposure of epileptic cultures with SE-like electrographic activity, we used neurons 24 h after 2.5 h exposure to low-Mg2+ solution in this in vitro model of SE-like electrographic activity and
Please cite this article in press as: X.-M. Wang, et al., MiR-134 blockade prevents status epilepticus like-activity and is neuroprotective in cultured hippocampal neurons, Neurosci. Lett. (2014), http://dx.doi.org/10.1016/j.neulet.2014.04.049
319
320 321 322 323 324 325 326 327 328 329 330 331 332 333 334
G Model NSL 30562 1–6
ARTICLE IN PRESS X.-M. Wang et al. / Neuroscience Letters xxx (2014) xxx–xxx
6
383
found that inhibiting miR-134 via lentiviral-mediated delivery had effects manifested by a decrease in frequencies of SE-like electrographic activities, while, phenytoin and phenobarbital which are used as clinical anticonvulsants and represent two diverse mechanisms of antiepileptic action could abolish low Mg2+ -induced prolonged seizure-like activities [16]. The effects of the lentivirus inhibition of miR-134 were comparable to the effects of two known anticonvulsants in the same model. So inhibiting miR-134 may have significant clinical implications for the treatment of SE. Recent work has suggested an association between seizures and changes to miRNA expression. MiR-134 was discovered as a brain-specific miRNA. It is constitutively expressed in the adult brain in neurons and detectable in dendrites [9,10]. In vivo experiment implicated silencing miR-134 can alter pathologic electrical activity in brain [9]. And miR-134 can affect dentritic spine development through down-regulating Limk1 mRNA expression. In our study, miR-134 is increased significantly by prolonged seizure-like activities in hippocampal neuronal culture model and inhibition of miR-134 with lentivirus can decrease in frequencies of SE-like electrographic activities and increased the expression of LIMK1. But in vitro how miR-134 regulate the excitability of neurons and whether miR-134 affects the SE-like electrographic activities through down-regulating the expression of LIMK1 or other miR134 targets need further study. SE can cause neuronal damage, memory loss, and several longterm plasticity changes that can result in significant mortality and morbidity [18–20]. Neuronal injury that was induced by SE is a consequence of excessive neuronal excitability and the underlying etiology of SE [21]. It is established that continuous high-frequency epileptiform discharges can cause neuronal death [22]. So preventing neuronal damage induced by SE is also an important therapeutic goal. We evaluated the effects of SE-like electrographic activities in epileptic cultures on neuronal death by comparing cell death using hoechst/PI double staining on cultures that were undergoing cont virus + SE group (before low-Mg2+ given control lentivirus pretreatment) and virus + SE (before SE given lentivirus pre-treatment to inhibit miR-134) or control (exposure to normal Mg2+ solution) cultures. SE-like electrographic activity caused neuronal death in this in vitro model and inhibiting miR134 was able to block the cell death that caused by SE-like electrographic activity. Our data showed that inhibition of miR-134 have neural protective effects in cultured hippocampal neurons and thus offers considerable therapeutic potential in preventing brain injury following SE. Future studies are needed to find the mechanisms of the neuroprotective action of inhibiting miR-134. Since the virus essentially abolished SE-like activity in the cells it is most likely that the neuroprotective effect is secondary to reduced seizure-induced injury rather than any direct effect of neuroprotection.
384
5. Conclusion
335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382
385 386 387 388
MicroRNAs (miRNAs) may be critical to the pathogenesis of several neurologic disorders, including epilepsy [4,5]. This study provides a direct evidence that inhibition of miR-134 via lentivirus pre-treatment can block status epilepticus-like electrographic activities and is neuroprotective in hippocampal neuronal culture
model. Since SE is one of the most severe neurological emergencies, studying the use of agents that inhibiting miR-134 offers a new hope for the effective treatment of SE. Acknowledgments We thank Chen Wu, Yuan-Chu Liu and Ge-Min Zhu for technical assistance with the primary hippocampal neuron cultures. References [1] R.J. DeLorenzo, J.M. Pellock, A.R. Towne, J.G. Boggs, Epidemiology of status epilepticus, J. Clin. Neurophysiol. 12 (1995) 316–325. [2] R.J. DeLorenzo, Epidemiology and clinical presentation of status epilepticus, Adv. Neurol. 97 (2006) 199–215. [3] J.M. Li, L. Chen, B. Zhou, Y. Zhu, D. Zhou, Convulsive status epilepticus in adults and adolescents of southwest China: mortality, etiology, and predictors of death, Epilepsy Behav. 14 (2009) 146–149. [4] K.S. Kosik, The neuronal microRNA system, Nat. Rev. Neurosci. 7 (2006) 911–920. [5] D.B. Dogini, S.H. Avansini, A.S. Vieira, I. Lopes-Cendes, MicroRNA regulation and dysregulation in epilepsy, Front. Cell. Neurosci. 7 (2013) 172. [6] D.C. Henshall, MicroRNA and epilepsy: profiling, functions and potential clinical applications, Curr. Opin. Neurol. 27 (2014) 199–205. [7] Y. Ma, A. Ramachandran, N. Ford, I. Parada, D.A. Prince, Remodeling of dendrites and spines in the C1q knockout model of genetic epilepsy, Epilepsia 54 (2013) 1232–1239. [8] J.W. Swann, S. Al-Noori, M. Jiang, C.L. Lee, Spine loss and other dendritic abnormalities in epilepsy, Hippocampus 10 (2000) 617–625. [9] E.M. Jimenez-Mateos, T. Engel, P. Merino-Serrais, R.C. McKiernan, K. Tanaka, G. Mouri, T. Sano, C. O’Tuathaigh, J.L. Waddington, S. Prenter, N. Delanty, M.A. Farrell, D.F. O’Brien, R.M. Conroy, R.L. Stallings, J. DeFelipe, D.C. Henshall, Silencing microRNA-134 produces neuroprotective and prolonged seizure-suppressive effects, Nat. Med. 18 (2012) 1087–1094. [10] G.M. Schratt, F. Tuebing, E.A. Nigh, C.G. Kane, M.E. Sabatini, M. Kiebler, M.E. Greenberg, A brain-specific microRNA regulates dendritic spine development, Nature 439 (2006) 283–289. [11] R. Fiore, S. Khudayberdiev, M. Christensen, G. Siegel, S.W. Flavell, T.K. Kim, M.E. Greenberg, G. Schratt, Mef2-mediated transcription of the miR379-410 cluster regulates activity-dependent dendritogenesis by fine-tuning Pumilio2 protein levels, EMBO J. 28 (2009) 697–710. [12] J. Gao, W.Y. Wang, Y.W. Mao, J. Graff, J.S. Guan, L. Pan, G. Mak, D. Kim, S.C. Su, L.H. Tsai, A novel pathway regulates memory and plasticity via SIRT1 and miR-134, Nature 466 (2010) 1105–1109. [13] P. Gaughwin, M. Ciesla, H. Yang, B. Lim, P. Brundin, Stage-specific modulation of cortical neuronal development by Mmu-miR-134, Cerebr. Cortex 21 (2011) 1857–1869. [14] R.J. Delorenzo, D.A. Sun, L.S. Deshpande, Cellular mechanisms underlying acquired epilepsy: the calcium hypothesis of the induction and maintenance of epilepsy, Pharmacol. Ther. 105 (2005) 229–266. [15] P.S. Mangan, J. Kapur, Factors underlying bursting behavior in a network of cultured hippocampal neurons exposed to zero magnesium, J. Neurophysiol. 91 (2004) 946–957. [16] S. Sombati, R.J. Delorenzo, Recurrent spontaneous seizure activity in hippocampal neuronal networks in culture, J. Neurophysiol. 73 (1995) 1706–1711. [17] C.W. Chiang, Y.C. Chen, J.C. Lu, Y.T. Hsiao, C.W. Chang, P.C. Huang, Y.T. Chang, P.Y. Chang, C.T. Wang, Synaptotagmin I regulates patterned spontaneous activity in the developing rat retina via calcium binding to the C2AB domains, PLoS ONE 7 (2012) e47465. [18] F.W. Drislane, Presentation, evaluation, and treatment of nonconvulsive status epilepticus, Epilepsy Behav. 1 (2000) 301–314. [19] J.S. Duncan, Seizure-induced neuronal injury: human data, Neurology 59 (2002) S15–S20. [20] D.G. Fujikawa, Prolonged seizures and cellular injury: understanding the connection, Epilepsy Behav. 7 (Suppl. 3) (2005) S3–S11. [21] D.H. Lowenstein, B.K. Alldredge, Status epilepticus, N. Engl. J. Med. 338 (1998) 970–976. [22] L.S. Deshpande, J.K. Lou, A. Mian, R.E. Blair, S. Sombati, R.J. DeLorenzo, In vitro status epilepticus but not spontaneous recurrent seizures cause cell death in cultured hippocampal neurons, Epilepsy Res. 75 (2007) 171–179.
Please cite this article in press as: X.-M. Wang, et al., MiR-134 blockade prevents status epilepticus like-activity and is neuroprotective in cultured hippocampal neurons, Neurosci. Lett. (2014), http://dx.doi.org/10.1016/j.neulet.2014.04.049
389 390 391
392
393 394 395
396
397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455
ARTICLE IN PRESS
NSL 30562 1–6
Neuroscience Letters xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
Neuroscience Letters journal homepage: www.elsevier.com/locate/neulet
MiR-134 blockade prevents status epilepticus like-activity and is neuroprotective in cultured hippocampal neurons
1
2
3 4 5 6
Q1
Xiao-Mu Wang a,1 , Rui-Hua Jia b,1 , Dong Wei a , Wei-Yun Cui c , Wen Jiang a,∗ a b c
Department of Neurology, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, China Department of Neurology, People’s Liberation Army 457th Hospital, Wuhan 430012, China Tianjin Neurological Institute, Tianjin 30052, China
7
8 9 10 11 12
h i g h l i g h t s • MiR-134 is increased by SE-like electrographic activities in vitro. • Inhibiting miR-134 using lentivirus reduces SE-like electrographic activities in vitro. • Inhibiting miR-134 is neuroprotective in cultured hippocampal neurons.
13
14 27
a r t i c l e
i n f o
a b s t r a c t
15 16 17 18 19 20
Article history: Received 21 February 2014 Received in revised form 24 April 2014 Accepted 29 April 2014 Available online xxx
21
26
Keywords: Status epilepticus MiR-134 Hippocampal cultures Lentivirus
28
1. Introduction
22 23 24 25
29 30 31 32 33 34 35
Status epilepticus (SE) is a life-threatening neurological disorder associated with significant morbidity and mortality. MicroRNAs (miRNAs) are small, non-coding RNAs that act post-transcriptionally modulating messenger RNA (mRNA) translation or stability which may have important roles in the pathogenesis of epilepsy. It has been reported that silencing microRNA-134 in vivo has significant neuroprotective and prolonged seizure-suppressive effects. However, the mechanism by which miR-134 inhibition suppressed seizures and whether miR-134 inhibition works in an in vitro model of SE, is unknown. Compared to a complex in vivo system, in vitro models of SE-like electrographic activity can be powerful tools to study this miRNA. Using a cell culture model of low Mg2+ treatment of rat hippocampal neurons, we found SE-like electrographic activity increased expression of miR-134. Inhibiting expression of miR-134 using an inhibitor lentivirus with two miR-134 binding sites reduced SE-like electrographic activity in the hippocampal neurons and reduced neuronal death. This study provides direct evidence that inhibition of miR-134 can block status epilepticus-like discharges and is neuroprotective in hippocampal neuronal cultures and implies that inhibiting miR-134 may be a potential candidate for the clinical treatment of SE. © 2014 Published by Elsevier Ireland Ltd.
Status epilepticus (SE) is defined as seizure events that last greater than 30 min or intermittent seizures without regaining consciousness [1]. SE is a life-threatening neurological disorder associated with a significant morbidity and mortality [1,2]. In southwest China, the proportion of SE patients who died within 30 days was as high as 15.8% [3]. So there is a growing demand for developing newer medications to treat SE.
∗ Corresponding author. Tel.: +86 29 84771319; fax: +86 29 85206750. E-mail addresses: [email protected], [email protected] (W. Jiang). 1 These authors contributed equally to this work.
MicroRNAs (miRNAs) are a family of small (∼22nt) noncoding RNAs that regulate post-transcriptional expression of proteincoding mRNAs. In neurons, miRNAs have been found to regulate translation of a wide range of proteins [4]. These proteins involved in neuronal morphology, ion channels, neuronal migrations, etc. Lots of evidences indicated that miRNAs may be critical to the pathogenesis of epilepsy [5,6]. In rat hippocampus neurons, miR134 is specifically expressed and localized to neuronal dendrites and negatively regulates the size of dendritic spines [7,8]. In vivo silencing miR-134 with antagomirs reduced pyramidal neuron spine density [9]. Remodeling of dendrites and spines loss could contribute to the neuronal hyperexcitability of epilepsy [10]. In hippocampal neurons, miR-134 targets Lim-domain containing kinase 1 (Limk1) mRNA, thereby preventing the Limk1 protein translation. Some miR-134 targets have been identified, including the RNA
http://dx.doi.org/10.1016/j.neulet.2014.04.049 0304-3940/© 2014 Published by Elsevier Ireland Ltd.
Please cite this article in press as: X.-M. Wang, et al., MiR-134 blockade prevents status epilepticus like-activity and is neuroprotective in cultured hippocampal neurons, Neurosci. Lett. (2014), http://dx.doi.org/10.1016/j.neulet.2014.04.049
36 37 38 39 40 41 42 43 44 45 46 47 48 49 50
G Model NSL 30562 1–6
ARTICLE IN PRESS X.-M. Wang et al. / Neuroscience Letters xxx (2014) xxx–xxx
2
75
binding protein Pum2 [11], CREB [12] and DCX [13]. The mechanism of miR-134 remodeling of dendritic spines was confirmed to be via miR-134 locally targeting translation of Limk1 within dendrites in in vivo experiments [9,10]. But the mechanism by which miR-134 antagomirs suppressed seizures and how miR-134 works in the in vitro SE model is unknown. The low Mg2+ hippocampal neuronal culture model of SE-like electrographic activity has been used as a powerful tool to study SE and this model has been widely used to study SE mechanisms in an in vitro setting. The hippocampal neuronal culture model of SE-like electrographic activity can manifest the same neuronal spike frequency and epileptiform discharges observed with animals and human SE [14–16]. This in vitro model is well suited to carry out biochemical, molecular, and electrophysiological investigations of SE. So our study was initiated to evaluate the effectiveness of inhibiting miR-134 with lentivirus in treating SE in vitro, employing the well-characterized hippocampal neuronal culture model of SE-like electrographic activity in order to provide a foundation for the further research in mechanism by which down-regulating miR-134 suppressed seizures. We found that SE resulted in an increase in mature miR-134 levels in the hippocampal neuronal cultures. Inhibiting miR-134 with lentivirus could effectively reduce SE-like electrographic activities in the model and was neuroprotective.
76
2. Materials and methods
77
2.1. Materials
51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74
88
Neurobasal-A medium, B27, fetal bovine serum were obtained from Gibco-BRL (Invitrogen Corp., San Diego, CA). Hoechst was purchased from Beyotime Institute of Biotechnology (Jiangsu, China). All the reagents were purchased from Sigma Chemical Co. (St. Louis, MO, USA). The following antibodies were used in this study: rabbit anti-LIMK1 (1:500 Biorbyt), goat anti-rabbit IgG (HRP) antibody (1:3000 Biorbyt), mouse anti-NeuN (1:300 Merck Millipore), rabbit anti-GFAP (1:200 Sigma), goat anti-mouse IgGAlexa Fluor 488 and goat anti-rabbit IgGAlexa Fluor 594 conjugated secondary antibodies (1:500 Invitrogen). 4 , 6 diamidino-2-phenylindole (DAPI) (Vector Laboratories Ltd.).
89
2.2. Primary rat hippocampal neuron cultures
78 79 80 81 82 83 84 85 86 87
30 mM phosphate buffer, pH 7.4) overnight at 4 ◦ C. Neurons were then washed five times in PBS for 10 min at room temperature and incubated with Alexa-conjugated secondary antibodies in PBS for 2 h at room temperature and washed three times in PBS for 10 min. Neurons were incubated with 0.1 g/ml DAPI in PBS for 8 min and washed three times in PBS for 10 min. 2.4. Hippocampal neuronal culture model of status epilepticus-like electrographic activities (SE-like electrographic activities) Exposing neuronal cultures to physiological bath recording solution (pBRS) without added MgCl2 (low Mg2+ ) containing (in mM): 145 NaCl, 2.5 KCl, 10 HEPES, 2 CaCl2 , 10 glucose and 0.002 glycine, pH 7.3, with the osmolarity adjusted to 315–325 mOsm with sucrose for 2.5 h induced high-frequency epileptiform bursts (SE-like electrographic activities). The SE-like electrographic activities continued until pBRS containing 1 mM MgCl2 was added back to the cultures. Thus, low Mg2+ treatment was carried out with pBRS without added MgCl2 , whereas controls were treated with pBRS containing 1 mM MgCl2 . 2.5. Whole cell current clamp recordings Whole-cell current clamp recordings were performed using previously established procedures [15,16]. Briefly, cell culture dish was mounted on the stage of an inverted microscope (DM-LFSA, Leica, Germany) continuously perfused with pBRS. Patch electrodes with a resistance of 4–7 M were pulled on a Brown-Flaming P97 electrode puller (Sutter Instruments, USA), fire-polished and filled with a solution containing the following (in mM): 140 K + gluconate, 1.1 EGTA, 1 MgCl2 , 10 HEPES and 2 Mg-ATP, pH 7.2, osmolarity 290 ± 10 mOsm adjusted with sucrose. Recordings were carried out using an Axopatch 700B amplifier (Axon Instruments, Foster City, CA) in current-clamp mode. The data were transferred to a PC using a Digidata 1440A (Axon Instruments, USA) interface and acquired using pCLAMP 9 (Axon Instruments) software. Neurons with resting membrane potentials ≤50 mV were selected for recording action potential. 2.6. Western blotting
100
All animals were purchased from the Animal Center of the Fourth Military Medical University. Studies were conducted on primary mixed hippocampal neuronal cultures prepared as described previously with slight modifications [16]. Primary hippocampal cultures were prepared from embryonic day 18 (E18) SD rat brains. Cells were plated onto a 35-mm Falcon cell culture dishes or glass coverslips coated with poly-l-lysine (0.05 mg/ml). Hippocampal cultures were maintained at 37 ◦ C in a 5% CO2 /95% air atmosphere and grown in neurobasal medium (NB) supplemented with 2% B27, 0.5 mM l-glutamine, 100 units/ml penicillin and 100 g/ml streptomycin. Cultures were fed twice weekly.
Western blotting was performed using previously established procedures [9]. For Western blotting, cultured hippocampal neurons were harvested in SDS buffer and boiled. Samples were loaded onto SDS-PAGE gels and subjected to Western blotting on nitrocellulose membranes. Blots were blocked with 2% bovine serum albumin/0.05% Tween-20 in PBS and incubated with the primary antibodies: Limk1 (1:1000, Biorbyt) and -actin (1:2000, Sigma–Aldrich) at 4 ◦ C overnight. Blots were washed with 0.05% Tween-20 in PBS, incubated with secondary antibodies and developed with enhanced chemiluminescent Western blotting substrate. Images were captured using a Fuji-Film LAS-300 and densitometry performed using AlphaEaseFC4.0 gel-scanning integrated optical density software (Alpha Innotech).
101
2.3. Immunofluorescent staining
2.7. RNA isolation and quantitative real time PCR
Immunocytochemistry was performed using a standard double labeling immunofluorescence method as described previously with slight modifications [17]. After 7–10 days, cultures were utilized for immunofluorescence staining. neurons were fixed for 30 min with 4% paraformaldehyde in phosphate-buffered saline (PBS) at room temperature. After fixation, cells were washed three times in PBS for 10 min at room temperature, and incubated with primary antibodies in GDB buffer (0.2% BSA, 0.8 M NaCl, 0.5% Triton X-100,
RNA isolation and quantitative real time PCR were performed with reference to previous procedures [9]. Primary rat hippocampal neurons were plated at a density of one million per well. Cells were harvested at 7 days. Total RNA was extracted using the miRNeasy kit (Qiagen) according to the manufacture’s instruction and 200 ng reverse transcribed using SYBR PrimeScriptmiRNA RT-PCR kit (TaKaLa RR716) following the handbook protocols. We used RT specific primers for rat miR-134 (TaKaLa) and qPCRs were
90 91 92 93 94 95 96 97 98 99
102 103 104 105 106 107 108 109
Please cite this article in press as: X.-M. Wang, et al., MiR-134 blockade prevents status epilepticus like-activity and is neuroprotective in cultured hippocampal neurons, Neurosci. Lett. (2014), http://dx.doi.org/10.1016/j.neulet.2014.04.049
110 111 112 113 114 115
116 117 118
119 120 121 122 123 124 125 126 127 128
129
130 131 132 133 134 135 136 137 138 139 140 141 142 143 144
145
146 147 148 149 150 151 152 153 154 155 156 157 158
159
160 161 162 163 164 165 166 167
G Model NSL 30562 1–6
ARTICLE IN PRESS X.-M. Wang et al. / Neuroscience Letters xxx (2014) xxx–xxx
171
carried out on a IQ5 Fast Realtime System (Bio-Rad) using SYBR PrimeScriptmiRNA RT-PCR kit (TaKaLa RR716). U6 (TaKaLa) was used for normalization. The data were analyzed using the 2−CT method for relative quantitation.
172
2.8. Hoechst/PI staining
168 169 170
173 174 175 176 177 178 179 180 181 182 183 184 185
186 187
188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229
To determine the portion of dead cells, primary rat hippocampal neurons were observed with PI and hoechst double staining. As a nucleic acid staining, hoechst was utilized to stain nuclei of normal and apoptotic cells while PI was used to visualize the necrotic cells. At 24 h post-hippocampal neuronal culture model of SE-like electrographic activities, PI (1 mM) and hoechst (5 mM) were added to the culture medium and incubated in the dark at 37 ◦ C for 30 min. For quantitation of dead cells, the numbers o PI+ cells plus hoechst+ cells with condensed nuclei were counted in a visual field (about 0.3 mm2 ) at 200× and at least five different visual fields were included in each group. The percentages of surviving cells (excluding apoptotic and necrotic cells) to total cells were calculated.
3
For infection, 4 DIV (days in vitro) rat neurons were cultured in serum-free culture medium, and miR-134 inhibitor recombinant lentivirus with a multiplicity of infection (MOI) of 5 was used to infect the neurons. GFP expression in the infected cells was observed daily under an inverted fluorescence microscope. Three days after infection, miR-134 inhibitor recombinant lentivirus- or control virus-infected and -uninfected neuronal cells were collected, and were exposed to pBRS without added MgCl2 (low Mg2+ ). Then the recombinant lentivirus-infected neuronal cells were used for the following experiments. 2.10. Data analysis Data are expressed as mean ± SEM and were analyzed by Statistical Product and Service Solutions (SPSS) software using paired t-test, unpaired t-test or one-way ANOVA and P < 0.05 was considered as significant.
3. Results
2.9. Rat miR-134 inhibitor lentiviral vector construction, virus packaging and infection
3.1. MiR-134 is increased by SE-like electrographic activities in cultured hippocampal neurons
Lentiviral vector backbone plasmid pCDH-CMV-MCS-EF1copGFP was digested with BamHI and SalI to remove EF1-copGFP. The EGFP ORF fragment was amplified by primer pair EGFPF (5 -CTAGGATCCATGGTGAGCAAGGGCGAGGAG-3 ) and EGFPR (5 CAGGTCGACGAATTCGCGGCCGCCTCGAGCTGCAGTTACTTGTACAGC TCGTC CATGCCG-3 ). The sequencing confirmed EGFP fragment was digested with BamHI and SalI and then inserted into the above digested vector to get a plasmid named pCDH-CMV-MCS-EGFPMCS. A synthesized 362 bp long DNA fragment which containing two miR-134 competitive binding sites was digested with XhoI and EcoRI and inserted into downstream of EGFP sequences in pCDHCMV-MCS-EGFP-MCS vector to get rat miR-134 inhibitor lentiviral vector. The sequence of the synthesized DNA sequence with miR-134 competitive binding sites underlined is as follows: 5 CAAGTAGCTCGAGTGCGGCCCCAAATAATGATTTTATTTTGACTGATA GTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGC CAACTTTGTACAAAAAAGCAGGCTGCGATCGCAATATTTGCATGTCGC TATGTGTTCTGGGAAATCACCATAAACGTGAAATGTCTTTGGATTTGG GAATCTTATAAGTTCTGTATGAGACCACGGATCCGACGGCGCTAGGAT CATCAACCCCCTCTGGTCAATCTACCAGTCACACAAGTATTCTGGTCAC AGAATACAACCCCCTCTGGTCAATCTACCAGTCACACAAGATGATCCT AGCGCCGTCTTTTTTGAATTCTCG-3 . The newly generated miR-134 inhibitor lentiviral vector and three other helper plasmids pLP1, pLP2, pLP/VSV-G (Invitrogen, Carlsbad, CA) were amplified and their concentration was adjusted to 1 g/l. Ninety percent of confluent 293T cells in 100 mm dishes were transfected with plasmid DNA containing 15 g miR-134 inhibitor plasmids or 15 g pCDH-CMV-MCS-EGFP-MCS (negative control vector), 6.5 g pLP1, 2.5 g pLP2, and 3.5 g pLP/VSVG through Lipofectamine2000 (Invitrogen, Carlsbad, CA) method according to the manufacture’s instructions. After overnight incubation, the medium with plasmids was replaced by 10 ml fresh Dulbecco’s modified Eagle’s medium medium supplemented with 10% fetal bovine serum, 2 mmol/l l-glutamine, 100 IU/ml penicillin, and 100 g/ml streptomycin (Mediatech, Herndon, VA). Supernatants were harvested after 30 h culture and filtered through a 0.45 m membrane. The filtered supernatant was mixed with 10% PEG-10,000 and incubated at 4 ◦ C overnight, then was centrifuged for 1 h at 3500 rpm. The pellet containing lentivirus was resuspended in PBS, and aliquots were stored at −80 ◦ C. Viral titers were assayed by infection of 293T cells at different dilutions; titers were adjusted to 1 × 108 IU/ml before infection.
First, we investigated whether the SE-like electrographic activities affected the expression of miR-134 in vitro. Prolonged SE-like electrographic activities were triggered by exposing the hippocampal neurons to a solution containing no added MgCl2 (low Mg2+ ). Real-time quantitative PCR (RT-qPCR) was used to measure the expression level of miR-134 at 24 h, 48 h, and 72 h after SElike electrographic activities. Compared to the control group, the mature miR-134 was significantly increased at 72 h after SE-like electrographic activities (P = 0.0114) (Fig. 1A). This suggested that miR-134 may involved in the pathophysiological consequences of SE. 3.2. MiR-134 blockade blocks SE-like electrographic activities in cultured hippocampal neurons As shown above, miR-134 is increased by SE-like electrographic activities in hippocampal neurons. So we hypothesized that inhibiting miR-134 might affect the cultured hippocampal neuron model of SE-like electrographic activities. To evaluate the anti-hyperexcitability effects of inhibiting miR-134, neuronal cells cultured for 4 days were infected with rat miR-134 inhibitor recombinant lentivirus at a multiplicity of infection (MOI) of 5. Three days after infection, strong GFP expression was observed in the infected cells under an inverted fluorescence microscope (Fig. 1B) and miR134 is decreased in virus-infected hippocampal neurons (Fig. 1C). Then the virus-infected neuronal cell culture dish was mounted on the stage of an inverted microscope, whole-cell current-clamp recordings were carried on the in vitro models of SE. The frequency of SE-like electrographic activity was determined to evaluate the effectiveness of miR-134. Whole-cell current-clamp recordings from 1-week-old control neurons showed baseline activity with the occasionally spontaneous action potentials (Fig. 1D(a)). Removal of MgCl2 (low-Mg2+ ) from the recording solution (cont virus + SE group and SE group) resulted in SE-like electrographic activities (Fig. 1D(b, c)). This hyperexcitable state consisted of repetitive individual burst discharges. The continuous epileptiform activity in this model is characterized by the spike frequency 3 Hz and lasting more than 30 min during the low-Mg2+ exposure. Compared with low-Mg2+ treatment alone, inhibiting miR-134 with lentivirus blocks SE-like electrographic activities (Fig. 1D. d). The frequency of epileptiform burst discharges per minute (23.00 ± 2.082, N = 3)
Please cite this article in press as: X.-M. Wang, et al., MiR-134 blockade prevents status epilepticus like-activity and is neuroprotective in cultured hippocampal neurons, Neurosci. Lett. (2014), http://dx.doi.org/10.1016/j.neulet.2014.04.049
230 231 232 233 234 235 236 237 238 239
240
241 242 243 244
245
246 247
248 249 250 251 252 253 254 255 256 257 258
259 260
261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286
G Model NSL 30562 1–6
ARTICLE IN PRESS X.-M. Wang et al. / Neuroscience Letters xxx (2014) xxx–xxx
4
Fig. 1. MiR-134 blockade blocks status epilepticus activities in cultured hippocampal neurons. (A) MiR-134 up-regulation following in the hippocampal neuronal culture model of SE. RT-qPCR measurement of miR-134 (normalized to U6) in cultured hippocampal neurons at 24 h, 48 h and 72 h after SE (n = 3 per group). MiR-134 levels were significantly increased at 72 h after SE (P = 0.0114). *P < 0.05 compared with the control group. (B) Lentivirus transfected cultured hippocampal neurons. Fluorescent images of the virus-infected, control virus-infected and control neuronal cells. Three days after infection, strong GFP expression was observed in the virus-infected cells under an inverted fluorescence microscope. Scale bar, 60 m. (C) MiR-134 is decreased in virus-infected hippocampal neurons. 4 DIV primary hippocampal neurons were transfected with cont virus and virus. At 7 DIV, RNA was harvested and qPCR analysis was performed. (P = 0.0017). **P < 0.01 compared with the cont virus group. (D) Continuous wholecell current-clamp recorded the frequency of epileptiform burst discharges in control group (exposure to normal Mg2+ solution), cont virus + SE group (before low-Mg2+ given control lentivirus pre-treatment), SE group (non-transfected neurons) and virus + SE group (before low-Mg2+ given lentivirus pre-treatment) in hippocampal neurons. (a) A representative recording from a control neuron showed occasional spontaneous action potentials. (b) A representative recording from cont virus + SE group (before low-Mg2+ given control lentivirus pre-treatment) showed continuous tonic high frequency epileptiform bursts. (c) A representative recording during low-Mg2+ treatment showed continuous tonic high frequency epileptiform bursts (SE). (d) Inhibiting miR-134 with lentivirus significantly blocks SE activities. (E) Bar graph representing average frequencies of cont virus + SE group and inhibiting miR-134 + SE group (n = 3; P = 0.0014).**P < 0.01 compared with the cont virus + SE.
287
was significantly decreased by inhibiting miR-134 (6.00 ± 0.5774,
288Q2 N = 3) (P = 0.0014) (Fig. 3D).
289 290
291 292 293 294
3.3. MiR-134 inhibitor treatment reverse the LIMK1 depression by SE-like electrographic activity induction We next investigated whether LIMK1 protein levels were altered in the hippocampus neuronal culture models of SE-like electrographic activities. First we observed LIMK1 protein levels are decreased in cultured hippocampal neurons 72 h after SE-like
electrographic activities (Fig. 2A). Then, we detected LIMK1 protein levels in cont group, cont virus + SE group and inhibiting miR-134 + SE group. Three days after infection, neuronal cells were collected, Western blot was carried on the hippocampus neuronal culture models of SE-like electrographic activities to test the LIMK1 protein level. Compared with the control group, LIMK1 protein levels in cont virus + SE group are decreased. But miR-134 inhibitor pre-treatment can reverse the LIKM1 depression by SE-like electrographic activities (Fig. 2B). This suggested that LIMK1 may be one of the target of miR-134 in the
Please cite this article in press as: X.-M. Wang, et al., MiR-134 blockade prevents status epilepticus like-activity and is neuroprotective in cultured hippocampal neurons, Neurosci. Lett. (2014), http://dx.doi.org/10.1016/j.neulet.2014.04.049
295 296 297 298 299 300 301 302 303 304
G Model NSL 30562 1–6
ARTICLE IN PRESS X.-M. Wang et al. / Neuroscience Letters xxx (2014) xxx–xxx
5
Fig. 2. Inhibiting miR-134 is neuroprotective in cultured hippocampal neurons. (A) Limk1 is decreased by status epilepticus activities. Photomicrographs showing Limk1 (red) expression in rat hippocampal tissues, below Limk1 (red)/hoechst (blue) expression in cultured hippocampal neurons 72 h after SE compared to control (cont). Insets indicate limk1 positive (red) cells. Scale bar, 60 m. (B) Limk1 protein levels in cont virus + SE group, cont group, and inhibiting miR-134 + SE group. Bar graph shows Limk1 Western blot (72 h after transfection) and densitometry. **P < 0.01 vs. cont virus + SE group. (C) Representative photomicrographs showing hoechst/PI double stained neurons in control group, control lentivirus or lentivirus pre-treatment group. Scale bar, 60 m. (D) Bar graph shows the percentages of surviving cells in different groups. ***P < 0.001 Q3 vs. cont virus + SE group. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
305 306
307 308
309 310 311 312 313 314 315 316 317 318
hippocampus neuronal culture models of SE-like electrographic activities.
3.4. Inhibiting miR-134 is neuroprotective in cultured hippocampal neurons Then, we tested whether inhibiting miR-134 with lentivirus pre-treatment could protect cultured hippocampal neurons against SE injury. After 2.5 h of prolonged seizure-like activities and 24 h recovery, hoechst and PI double staining showed that after 24 h post-SE-like electrographic activity, about 50% neurons were dead while inhibiting miR-134 with lentivirus could decrease SE-induced cell death to 28% (Fig. 2C and D). The results suggested a significant neuroprotective effect of inhibiting miR-134 with lentivirus in SE-like electrographic activity model.
4. Discussion Our study shows lentivirus-mediated miR-134 blockade suppress SE-like electrographic activities in hippocampal neuronal culture model. Our study indicates inhibiting miR-134 may be a new strategy for the treatment of SE. SE-like electrographic activity was induced after exposing cultured hippocampal neurons to low-Mg2+ solution, with spike frequency within epileptiform bursts ranging from 5 Hz to 18 Hz. This SE-like electrographic activity in vitro model is a commonly used model to study the mechanisms underlying seizures and seizure-induced plasticity [1,14]. The hippocampal neuronal culture model of SE-like electrographic activity has the unique advantage to study molecular mechanisms underlying SE [16]. During exposure of epileptic cultures with SE-like electrographic activity, we used neurons 24 h after 2.5 h exposure to low-Mg2+ solution in this in vitro model of SE-like electrographic activity and
Please cite this article in press as: X.-M. Wang, et al., MiR-134 blockade prevents status epilepticus like-activity and is neuroprotective in cultured hippocampal neurons, Neurosci. Lett. (2014), http://dx.doi.org/10.1016/j.neulet.2014.04.049
319
320 321 322 323 324 325 326 327 328 329 330 331 332 333 334
G Model NSL 30562 1–6
ARTICLE IN PRESS X.-M. Wang et al. / Neuroscience Letters xxx (2014) xxx–xxx
6
383
found that inhibiting miR-134 via lentiviral-mediated delivery had effects manifested by a decrease in frequencies of SE-like electrographic activities, while, phenytoin and phenobarbital which are used as clinical anticonvulsants and represent two diverse mechanisms of antiepileptic action could abolish low Mg2+ -induced prolonged seizure-like activities [16]. The effects of the lentivirus inhibition of miR-134 were comparable to the effects of two known anticonvulsants in the same model. So inhibiting miR-134 may have significant clinical implications for the treatment of SE. Recent work has suggested an association between seizures and changes to miRNA expression. MiR-134 was discovered as a brain-specific miRNA. It is constitutively expressed in the adult brain in neurons and detectable in dendrites [9,10]. In vivo experiment implicated silencing miR-134 can alter pathologic electrical activity in brain [9]. And miR-134 can affect dentritic spine development through down-regulating Limk1 mRNA expression. In our study, miR-134 is increased significantly by prolonged seizure-like activities in hippocampal neuronal culture model and inhibition of miR-134 with lentivirus can decrease in frequencies of SE-like electrographic activities and increased the expression of LIMK1. But in vitro how miR-134 regulate the excitability of neurons and whether miR-134 affects the SE-like electrographic activities through down-regulating the expression of LIMK1 or other miR134 targets need further study. SE can cause neuronal damage, memory loss, and several longterm plasticity changes that can result in significant mortality and morbidity [18–20]. Neuronal injury that was induced by SE is a consequence of excessive neuronal excitability and the underlying etiology of SE [21]. It is established that continuous high-frequency epileptiform discharges can cause neuronal death [22]. So preventing neuronal damage induced by SE is also an important therapeutic goal. We evaluated the effects of SE-like electrographic activities in epileptic cultures on neuronal death by comparing cell death using hoechst/PI double staining on cultures that were undergoing cont virus + SE group (before low-Mg2+ given control lentivirus pretreatment) and virus + SE (before SE given lentivirus pre-treatment to inhibit miR-134) or control (exposure to normal Mg2+ solution) cultures. SE-like electrographic activity caused neuronal death in this in vitro model and inhibiting miR134 was able to block the cell death that caused by SE-like electrographic activity. Our data showed that inhibition of miR-134 have neural protective effects in cultured hippocampal neurons and thus offers considerable therapeutic potential in preventing brain injury following SE. Future studies are needed to find the mechanisms of the neuroprotective action of inhibiting miR-134. Since the virus essentially abolished SE-like activity in the cells it is most likely that the neuroprotective effect is secondary to reduced seizure-induced injury rather than any direct effect of neuroprotection.
384
5. Conclusion
335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382
385 386 387 388
MicroRNAs (miRNAs) may be critical to the pathogenesis of several neurologic disorders, including epilepsy [4,5]. This study provides a direct evidence that inhibition of miR-134 via lentivirus pre-treatment can block status epilepticus-like electrographic activities and is neuroprotective in hippocampal neuronal culture
model. Since SE is one of the most severe neurological emergencies, studying the use of agents that inhibiting miR-134 offers a new hope for the effective treatment of SE. Acknowledgments We thank Chen Wu, Yuan-Chu Liu and Ge-Min Zhu for technical assistance with the primary hippocampal neuron cultures. References [1] R.J. DeLorenzo, J.M. Pellock, A.R. Towne, J.G. Boggs, Epidemiology of status epilepticus, J. Clin. Neurophysiol. 12 (1995) 316–325. [2] R.J. DeLorenzo, Epidemiology and clinical presentation of status epilepticus, Adv. Neurol. 97 (2006) 199–215. [3] J.M. Li, L. Chen, B. Zhou, Y. Zhu, D. Zhou, Convulsive status epilepticus in adults and adolescents of southwest China: mortality, etiology, and predictors of death, Epilepsy Behav. 14 (2009) 146–149. [4] K.S. Kosik, The neuronal microRNA system, Nat. Rev. Neurosci. 7 (2006) 911–920. [5] D.B. Dogini, S.H. Avansini, A.S. Vieira, I. Lopes-Cendes, MicroRNA regulation and dysregulation in epilepsy, Front. Cell. Neurosci. 7 (2013) 172. [6] D.C. Henshall, MicroRNA and epilepsy: profiling, functions and potential clinical applications, Curr. Opin. Neurol. 27 (2014) 199–205. [7] Y. Ma, A. Ramachandran, N. Ford, I. Parada, D.A. Prince, Remodeling of dendrites and spines in the C1q knockout model of genetic epilepsy, Epilepsia 54 (2013) 1232–1239. [8] J.W. Swann, S. Al-Noori, M. Jiang, C.L. Lee, Spine loss and other dendritic abnormalities in epilepsy, Hippocampus 10 (2000) 617–625. [9] E.M. Jimenez-Mateos, T. Engel, P. Merino-Serrais, R.C. McKiernan, K. Tanaka, G. Mouri, T. Sano, C. O’Tuathaigh, J.L. Waddington, S. Prenter, N. Delanty, M.A. Farrell, D.F. O’Brien, R.M. Conroy, R.L. Stallings, J. DeFelipe, D.C. Henshall, Silencing microRNA-134 produces neuroprotective and prolonged seizure-suppressive effects, Nat. Med. 18 (2012) 1087–1094. [10] G.M. Schratt, F. Tuebing, E.A. Nigh, C.G. Kane, M.E. Sabatini, M. Kiebler, M.E. Greenberg, A brain-specific microRNA regulates dendritic spine development, Nature 439 (2006) 283–289. [11] R. Fiore, S. Khudayberdiev, M. Christensen, G. Siegel, S.W. Flavell, T.K. Kim, M.E. Greenberg, G. Schratt, Mef2-mediated transcription of the miR379-410 cluster regulates activity-dependent dendritogenesis by fine-tuning Pumilio2 protein levels, EMBO J. 28 (2009) 697–710. [12] J. Gao, W.Y. Wang, Y.W. Mao, J. Graff, J.S. Guan, L. Pan, G. Mak, D. Kim, S.C. Su, L.H. Tsai, A novel pathway regulates memory and plasticity via SIRT1 and miR-134, Nature 466 (2010) 1105–1109. [13] P. Gaughwin, M. Ciesla, H. Yang, B. Lim, P. Brundin, Stage-specific modulation of cortical neuronal development by Mmu-miR-134, Cerebr. Cortex 21 (2011) 1857–1869. [14] R.J. Delorenzo, D.A. Sun, L.S. Deshpande, Cellular mechanisms underlying acquired epilepsy: the calcium hypothesis of the induction and maintenance of epilepsy, Pharmacol. Ther. 105 (2005) 229–266. [15] P.S. Mangan, J. Kapur, Factors underlying bursting behavior in a network of cultured hippocampal neurons exposed to zero magnesium, J. Neurophysiol. 91 (2004) 946–957. [16] S. Sombati, R.J. Delorenzo, Recurrent spontaneous seizure activity in hippocampal neuronal networks in culture, J. Neurophysiol. 73 (1995) 1706–1711. [17] C.W. Chiang, Y.C. Chen, J.C. Lu, Y.T. Hsiao, C.W. Chang, P.C. Huang, Y.T. Chang, P.Y. Chang, C.T. Wang, Synaptotagmin I regulates patterned spontaneous activity in the developing rat retina via calcium binding to the C2AB domains, PLoS ONE 7 (2012) e47465. [18] F.W. Drislane, Presentation, evaluation, and treatment of nonconvulsive status epilepticus, Epilepsy Behav. 1 (2000) 301–314. [19] J.S. Duncan, Seizure-induced neuronal injury: human data, Neurology 59 (2002) S15–S20. [20] D.G. Fujikawa, Prolonged seizures and cellular injury: understanding the connection, Epilepsy Behav. 7 (Suppl. 3) (2005) S3–S11. [21] D.H. Lowenstein, B.K. Alldredge, Status epilepticus, N. Engl. J. Med. 338 (1998) 970–976. [22] L.S. Deshpande, J.K. Lou, A. Mian, R.E. Blair, S. Sombati, R.J. DeLorenzo, In vitro status epilepticus but not spontaneous recurrent seizures cause cell death in cultured hippocampal neurons, Epilepsy Res. 75 (2007) 171–179.
Please cite this article in press as: X.-M. Wang, et al., MiR-134 blockade prevents status epilepticus like-activity and is neuroprotective in cultured hippocampal neurons, Neurosci. Lett. (2014), http://dx.doi.org/10.1016/j.neulet.2014.04.049
389 390 391
392
393 394 395
396
397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455
