Microb Ecol DOI 10.1007/s00248-014-0416-3
SOIL MICROBIOLOGY
Minor Changes in Soil Bacterial and Fungal Community Composition Occur in Response to Monsoon Precipitation in a Semiarid Grassland Theresa A. McHugh & George W. Koch & Egbert Schwartz
Received: 17 April 2013 / Accepted: 1 April 2014 # Springer Science+Business Media New York 2014
Abstract Arizona and New Mexico receive half of their annual precipitation during the summer monsoon season, making this large-scale rain event critical for ecosystem productivity. We used the monsoon rains to explore the responses of soil bacterial and fungal communities to natural moisture pulses in a semiarid grassland. Through 454 pyrosequencing of the 16S rRNA gene and ITS region, we phylogenetically characterized these communities at 22 time points during a summer season. Relative humidity increased before the rains arrived, creating conditions in soil that allowed for the growth of microorganisms. During the course of the study, the relative abundances of most bacterial phyla showed little variation, though some bacterial populations responded immediately to an increase in soil moisture once the monsoon rains arrived. The Firmicutes phylum experienced over a sixfold increase in relative abundance with increasing water availability. Conversely, Actinobacteria, the dominant taxa at our site, were negatively affected by the increase in water availability. No relationship was found between bacterial diversity and soil water potential. Bacterial community structure was unrelated to all environmental variables that we measured, with the exception of a significant relationship with atmospheric relative humidity. Relative abundances of fungal phyla fluctuated more throughout the season than bacterial abundances did. Variation in fungal community structure was unrelated to soil water potential and to most environmental variables. However, ordination analysis showed a distinct fungal community structure late in the season, probably due to plant senescence.
Electronic supplementary material The online version of this article (doi:10.1007/s00248-014-0416-3) contains supplementary material, which is available to authorized users. T. A. McHugh (*) : G. W. Koch : E. Schwartz Department of Biological Sciences, Northern Arizona University, P.O. Box 5640, Flagstaff, AZ 86011, USA e-mail: [email protected]
Introduction Monsoons, which occur in East Asia, India, and parts of North America, are caused by a change in global wind patterns as a result of differential heating of land and oceans [1]. Solar radiation heats landmasses more quickly than bodies of water, producing a low pressure system over land during the warmest part of the year. At the same time, cool air above oceans creates a zone of high pressure. The associated pressure gradient causes winds to shift to an ocean-to-land direction, bringing moist air inland and resulting in periods of intense rainfall [2]. The North American monsoon transports pulses of moisture from the tropical eastern Pacific Ocean, Gulf of California, and Gulf of Mexico [3, 4]. This seasonal precipitation relieves drought as conditions transition from an extremely dry spring to a wet summer for large parts of the southwestern USA and northwestern Mexico. Arizona and New Mexico receive up to 50 % of their annual precipitation during the summer monsoon season [5], making this rain event critical for ecosystem productivity and dynamics. We utilized the natural summer rain event in northern Arizona to examine the impact of seasonal moisture on soil microbial community structure in a semiarid grassland. Climate models project that the southwestern USA, which already is arid, will become drier as climate change proceeds [6]. Temperature rise will increase the risk of drought through heightened evaporation from the landscape, while precipitation in Arizona and New Mexico is expected to decline by 5 to 10 % by the end of this century [7]. Increased evaporation in summer and reduced precipitation year-round will likely impact soil microbial communities, but to date, there are few studies that track microbial community structure during the monsoon season. Consequently, it is difficult to assess the impact of climate change on soil microbial communities in regions subjected to monsoon weather patterns since we do not
T. A. McHugh et al.
know what the baseline of change is during monsoon season. Soil water is an essential resource, and its availability impacts microbial growth, activity, and survival [8]. Water content of soil affects the osmotic environment of microbial cells and influences soil properties such as pH, temperature, and oxygen content. Furthermore, moisture determines plant productivity and can have important consequences for soil microorganisms through changes in the quantity and quality of plant-derived carbon inputs [9]. Soil water affects bacterial activity in two major ways: limiting the movement of bacteria to new nutrient sites and restricting metabolism through nutrient deficiencies. The results are lowered respiration and nutrient mineralization [8, 10, 11]. Fungi, with their filamentous structure, appear more capable of withstanding drying stress because they do not experience the limitation of movement that is inherent in a unicellular structure [12]. Despite numerous studies, the roles of precipitation and moisture in shaping soil microbial communities remain unclear. While some studies have seen moisture-related changes in soil microbial community composition [13, 14], others have observed few or no differences in the microbial community structure between wet and dry soils [15–18]. Soil microorganisms exposed to natural variability in moisture conditions may be adapted to water stress and exhibit resistance or resilience to moisture manipulations in the laboratory [15, 19] or field setting [17, 18]. However, a review of studies that exposed soil microbial communities to various forms of disturbance, including CO2 enrichment, temperature changes, and mineral nutrient addition, found microbial community structure generally to be sensitive to disturbance and slow to return to the original composition [20]. We used the natural monsoon rain event in northern Arizona to establish how soil microbial community structure in a semiarid grassland is impacted by this seasonal precipitation. Through pyrosequencing of ribosomal RNA genes obtained from soil, we were able to assess the response of bacterial and fungal communities to changes in soil moisture. While most previous studies characterized microbial communities at only a few time points [e.g., 14, 19], we collected soil on 22 dates throughout the summer in order to fully characterize the response of soil microorganisms to moisture changes over time. We also utilized a natural rainfall phenomenon, and in doing so, we were able to avoid experimental artifacts inherent in many laboratory and field manipulations. We hypothesized that a large change in soil moisture associated with the advent of the monsoon season would cause dramatic changes in abundance, diversity, and overall composition of bacterial and fungal communities at our grassland site. Alternatively, these communities could be resistant or resilient to this predictable summer rainfall, in which case, we expected either no change in community composition during the monsoon season or that the microbial communities at the end of the
monsoon season would be similar in composition to the soil communities present prior to the arrival of monsoon rains.
Methods Site Description and Sample Collection Our study area is a semiarid, high desert grassland north of Flagstaff, AZ (35° 34′ 20 ″ N, 111° 34′ 4″ W, 1,760 m above sea level, 230 mm of rain annually). Plants are mainly perennial grasses (Bouteloua eriopoda, Bouteloua gracilis, Sporobulus cryptandrus, and Pleuraphis jamesii) with few shrubs (Ericameria nauseousa and Gutierrezia sarothrae). Soils are cindery and are classified in the US Department of Agriculture Soil Taxonomic Subgroup of Typic Haplustolls [21]. The terrain has nearly flat slopes (less than 2 %). This ecosystem is subject to the North American monsoon and experiences a shift first in relative humidity, followed by precipitation during the summer. The dry season typically lasts from May to mid-July and is characterized by dry westerly winds. The wet season extends from mid-July to September and is characterized by wet southeasterly winds. There is a Campbell Scientific (Logan, UT) weather station located at this field site that collects precipitation, temperature, and atmospheric relative humidity data in addition to other environmental variables. In an effort to understand soil microbial dynamics during natural dry-wet cycles, we collected soil before, during, and after monsoon precipitation in the summer of 2010. Five replicate soil cores (5-cm diameter and 5-cm depth) were taken from randomly selected open spaces between plants on 22 collection dates from 23 June to 30 September, for a total of 110 cores. Soil subsamples were homogenized, sieved to 2 mm, and used to determine gravimetric water content (105 °C). Fifty grams of soil was sent to Colorado State University’s Soil, Water, and Plant Testing Laboratory for moisture tension determination. Remaining soil was stored at −40 °C until further processing. Pyrosequencing We extracted DNA from 0.5 g of soil in each sample using PowerLyzer PowerSoil DNA Isolation Kit according to the manufacturer’s instructions, with an initial 10-min incubation at 70 °C followed by bead beating for 90 s (MO BIO Laboratories, Inc., Carlsbad, CA). DNA was quantified with a Qubit Fluorometer (Life Technologies, Carlsbad, CA) and standardized to 10 ng/μl. We pooled replicate extracts to achieve one representative DNA sample for each time point because we were most interested in the average soil microbial community and less concerned with the variation in microbial community composition among samples at a given time point.
Minor Changes in Soil Bacterial and Fungal Communities
DNA was sent to Research and Testing Laboratories, Lubbock, TX, for pyrosequencing of a portion of the bacterial 16S ribosomal RNA (rRNA) gene and fungal internal transcribed spacer (ITS) region. Tag pyrosequencing was performed with primers 28F (GAGTTTGATCNTGGCTCAG) and 519R (GTNTTACNGCGGCKGCTG) for bacteria and ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS4R (TCCT CCGCTTATTGATATGC) for fungi using previously described methods [22, 23]. Microbial Biomass A 20-g subsample of soil from each core was used to measure microbial biomass carbon (C) and nitrogen (N) according to the chloroform fumigation method [24]. Soils were brought to field capacity (21.49 %) to avoid moisture-related differences in extraction efficiency [25]. We fumigated soils over a 5-day period, while a separate 20-g subsample was not fumigated and served as a control. Dissolved C and N were extracted by shaking fumigated and control soils in 50 ml of 0.05 M K2SO4 for 1 h at 200 rpm and filtering through Whatman No. 1 filter papers. Salt precipitates were analyzed for total C and N using a Thermo-Finnigan Delta Plus Advantage isotope ratio mass spectrometer. We calculated microbial biomass by subtracting C and N in control samples from that in fumigated samples, with no corrections applied. Extractable C and N values were derived from unfumigated controls. Nitrogen Pools We measured N pools by extracting ammonium (NH4+) and nitrate (NO3−) from 10-g soil samples in 40 ml of 2M KCl solution in the field. Samples were transported back to the laboratory, shaken for 1 h at 200 rpm, and filtered through Whatman No. 1 filter papers. Ammonium and NO3− extracts were analyzed colorimetrically with a Lachat analyzer.
would be expected to suffer from cloud contamination. Very low values of NDVI (0.1 and below) correspond to barren areas. Moderate values (0.2 to 0.3) represent shrub and grassland, while high values (0.6 to 0.8) indicate dense rainforests. Data Analysis Linear models in R were used to understand the factors driving changes in microbial biomass and microbial abund a n c e s ( h t t p : / / w w w. R - p r o j e c t . o rg ) . A n a l y s i s o f pyrosequencing data was performed using QIIME [26] as established in previous studies [e.g., 27–29]. Specifically, low-quality sequences (less than 200 bp and with a quality score less than 25) were removed. Operational taxonomic units (OTUs) were assigned using a 97 % similarity cutoff with uclust [30]. Bacterial taxonomy was assigned with the Greengenes reference set, and representative sequences were aligned with the PyNAST algorithm [31]. Fungal taxonomy was assigned with BLAST using the UNITE reference database. Alpha diversity and rarefaction were computed for bacterial sequences using the Chao1, observed species, and phylogenetic diversity metrics [32]. Beta diversity (pairwise sample dissimilarity) was computed with UniFrac [33] for bacterial communities, while the non-phylogenetic Bray-Curtis metric was utilized for fungi. Microbial community structure was assessed with nonmetric multidimensional scaling (NMS) in Primer v. 6 (http://www.primer-e.com). We used Mantel tests (rM) to compare the changes in microbial community composition (UniFrac distance matrix for bacteria and BrayCurtis dissimilarity matrix for fungi) with the changes in environmental variables: air temperature, atmospheric relative humidity, water potential, NDVI, inorganic N, and extractable C (Euclidian distance matrices; PAST 3.x [34]). Additionally, an analysis of similarity (ANOSIM) test was performed on the UniFrac (bacteria) and Bray-Curtis (fungi) matrices to test the null hypothesis of no compositional difference between communities on various sampling days.
Normalized Difference Vegetation Index It was challenging to measure aboveground net primary productivity in our study because a large fraction of the plant biomass formed during the previous monsoon season. Separating newly formed green plant biomass from dormant old tissue proved extremely laborious, and the data was not deemed reliable. Therefore, we employed an alternative method for assessing the plant community. We obtained normalized difference vegetation indices (NDVIs) for our study site from Moderate Resolution Imaging Spectroradiometer satellite data. Average 16-day composite NDVIs were calculated for a 9×9 grid of 250-m pixels centered on the location of our study site. The 16-day composite is commonly used in phenological studies because it is likely during a 16-day period to get at least one cloud-free day, whereas a daily time series
Results Relative humidity (RH) increased in the weeks leading up to the first rain event. The RH of the air crossed the 50 % mark on Julian day 177 at approximately 5 o’clock in the morning. Minimum RH, which consistently occurred in the middle of the day, remained below 50 % until Julian day 212. The RH increased before our study site received any precipitation. Two sampling dates occurred while maximum RH was low (0.05). Soil inorganic N concentrations (NO3− and NH4+) ranged from 0.86 to 8.9 μg N/g dry soil and fluctuated periodically throughout the season (Fig. S3). Some
a
b
25
30 20 Soil Water Content (%)
25 Precipitation (mm)
Fig. 1 Monsoon precipitation (a) and soil moisture content (b) at the study site during summer 2010
influence of soil water potential was found for ammonium (R2 =0.222, p=0.0156) but not for nitrate. Pyrosequencing produced 198,574 bacterial sequences and 3,129 OTUs, which were defined at a 97 % similarity. Sequences per sample ranged from 6,069 to 11,435, with an average of 8,427. Rarefaction curves did not asymptote, indicating new bacterial taxa were still being characterized with additional sequences. Alpha diversity (Chao1) was lowest at the start of the monsoon season and highest at the end, though we found no significant relationship between alpha diversity and soil water potential. Bacterial communities were dominated by the phyla Actinobacteria (53 % on average), Proteobacteria (16 %), and Acidobacteria (8.7 %, Fig. 4). During the course of the study, the relative abundances of most bacterial phyla showed little variation. Coefficients of variation for the relative abundances of the dominant phyla were 0.092, 0.185, and 0.224 for Actinobacteria, Proteobacteria, and Acidobacteria, respectively. One exception was the phylum Firmicutes, whose coefficient of variation for relative abundance during the monsoon season was 0.910. The Firmicutes phylum comprised a larger fraction of the community as water availability increased, with 36 % of the variation in relative abundance explained by soil water potential (R 2 = 0.358, p = 0.0035). Members of the Bacillaceae experienced as much as an 800 % increase in relative abundance when the rains commenced. Soil water also showed some degree of influence on Actinobacteria, as increased relative abundances corresponded with decreasing water potential (R2 =0.459, p=0.00053). When communities from the 22 time points were analyzed for similarity using UniFrac distances, bacterial communities in dry soil samples appeared to separate from wetter samples along the second axis. However, ANOSIM analysis indicated that this separation was not significant (Fig. 5). The bacterial community structure was
15
10
5
Gravimetric Volumetric
20 15 10 5
0
0 174 186 198 210 222 234 246 258 270 Julian Day
170 182 194 206 218 230 242 254 266 278 Julian Day
Minor Changes in Soil Bacterial and Fungal Communities
0.50
long-term precipitation records for our grassland site. While the 50-year monsoon rainfall average for the Flagstaff region is 185 mm, our study area generally receives considerably less precipitation. It is very difficult to gauge monsoon precipitation with proxy sites because this precipitation is patchy, with intense storms drenching some areas and not others. Therefore, in studying the impact of climate change on monsoon weather patterns and soil microbial communities, it is critical that long-term weather records are established at research sites such as our semiarid grassland, which has been the subject of numerous studies of the soil microbial community [e.g., 36–39].
0.45 0.40 0.35
NDVI
0.30 0.25 0.20 0.15 0.10 0.05 280
Julian Day Fig. 2 Mean 16-day composite normalized difference vegetation index (NDVI) for our study area during summer 2010. Error bars are standard error for means
unrelated to all environmental variables that we measured, with the exception of atmospheric relative humidity, which showed some influence (rM =0.265, p=0.00899). Sequencing of the ITS region produced 128,662 sequences and 639 OTUs, defined at a 97 % similarity. Sequences per sample ranged from 2,280 to 14,856 with an average of 5,792. Fungi were dominated by the phyla Ascomycota (56.9 % on average) and Basidiomycota (30.49 %, Fig. 6). Fungal phyla were more variable throughout the summer season than bacteria were, with coefficients of variation ranging from 0.261 to 1.451. NMS ordination of fungal communities present in the grassland throughout the summer season showed no grouping according to soil water potential (Fig. 7). Fungal community structure was unrelated to environmental variables (rM 0.05). However, ANOSIM analysis indicated that fungal communities late in the season (Julian days 245 to 273) differed significantly from communities present earlier in the season (global R=0.874, p=0.001).
Discussion The northern Arizona monsoon season of 2010 delivered 100 mm of precipitation to our study site, with frequent small and infrequent large rain events occurring between mid-July and early September. The season’s rainfall was 14 mm above the 8-year summer average for this grassland, but because that period coincides with a drought, it is unlikely to reflect longterm averages. Recent modeling exercises indicate that due to climate change, average soil moisture may decline as much as 10 % by the end of the twenty-first century [35]. There are no
a
800
250
Microbial C
700
Water Potential
600 500
200 150
400 100
300 200
50
100
Soil Water Potential(-MPa)
250
0
0 170
190
210
230
250
270
Julian Day
b
700
Extractable C
600
Water Potential
250 200
500 400
150
300
100
200 50
100
Soil Water Potential (-MPa)
220
0
0 170
190
210
230
250
270
Julian Day
c
250
160
C:N
140
Water Potential
120 100
200 150
80 100
60 40
50
20
Soil Water Potential (-MPa)
190
Microbial C (ug C/g dry soil)
160
Extractable C (ug C/g dry soil)
130
Extractable C:N
0.00 100
0
0 170
190
210
230
250
270
Julian Day
Fig. 3 Mean microbial biomass C (a), extractable C (b), and extractable C:N (c) as determined by chloroform fumigation extractions. Error bars are standard error for means (n=5)
T. A. McHugh et al. 1
Fig. 4 Dynamics of the 16S rRNA gene-based relative abundance of the dominant bacterial phyla
0.9
Relative Abundance
0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0 174
198
204 216 Julian Day
228
252
Other
Acidobacteria
Actinobacteria
Bacteroidetes
Chloroflexi
Firmicutes
Gemmatimonadetes
Proteobacteria
273
small rain events, while ineffective at triggering plant growth or substantially increasing soil moisture, can stimulate the activity of microorganisms located just beneath the soil surface [41, 42]. An alternative measure of net primary productivity is to use satellite information to quantify the change in greenness of the entire site. NDVI values complemented personal observations of greenness in the field (Figs. 3 and S1) and indicated that larger rain events are necessary to trigger growth of plants in semiarid grasslands [43]. While the spatial resolution of NDVI data is relatively coarse, our grassland study site is homogeneous on a 1-km scale. NDVI measures identified that plant growth reached a peak on Julian day 225. Soil microbial communities are also affected by changes in the overlying plant community. Moisture-induced pulses of nutrient mineralization resulting from the effects of altered water availability on soil microorganisms are important for stimulating plant productivity, which can in turn feedback to affect microbial communities belowground [41, 42, 44, 45].
axis 2
Consistent with monsoon weather patterns, the RH of air increased at our grassland site before monsoon precipitation arrived and soil moisture increased. RH is controlled by temperature, with low RH occurring during the heat of the day and higher values observed when temperatures are lower during the night and early morning hours. Due to the matric potential of soil, RH is often higher in the soil atmosphere than in air above the soil, such that even when air is not saturated, liquid water is available in small soil pores. In measurements of RH at the McMurdo Dry Valleys in Antarctica, for instance, it was observed that the RH 5-cm deep in soil approached 100 % while the air RH varied between 20 and 60 % [40]. Therefore, as the RH at our study site rose to over 50 % prior to the monsoon rains, it is likely that more soil pores filled with water, thereby expanding the habitat for bacteria. We observed a statistically significant relationship between the bacterial community structure and atmospheric relative humidity. The first rain shower occurred on Julian day 197, delivering just 0.25 mm of precipitation. Like elevated RH,
Fig. 5 Nonmetric multidimensional scaling ordination of the weighted UniFrac pairwise dissimilarity of bacterial sequences from the 16S rRNA gene. Numbers represent sampling dates (n=22), and bubbles indicate soil water potential (−MPa) on each sampling date
186
axis 1
Minor Changes in Soil Bacterial and Fungal Communities 1
Fig. 6 Dynamics of the ITSbased relative abundance of fungal phyla
0.9
Relative Abundance
0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0 174
198
Other
Ascomycota
Glomeromycota
Zygomycota
204 216 228 Julian Day Basidiomycota
252
273
Chytridiomycota
Unidentified
at our study site has been observed to nearly double upon arrival of the monsoon rains (McHugh, unpublished data). The subtle changes in microbial community composition we observed in response to precipitation are similar to findings of several recent rain manipulation studies. One laboratory manipulation of soil moisture utilizing DGGE analysis of bacterial 16S rRNA genes showed no change in bacterial community structure with varied moisture regimes, leading the researchers to conclude that the bacterial communities in their study were resistant to water stress [15]. Another study using 16S rRNA gene microarrays found little difference between manipulated soil moisture plots and ambient controls [17], and a comparable field study using PLFA analysis showed no effect of moisture treatments on soil microbial community composition [18]. Perhaps, moisture variations alone do not reflect the changes that occur in the microbial communities of arid grassland soils during the monsoon season. Alternatively, the method of microbial community analysis could dictate whether changes in microbial community composition due to variation in soil moisture are observed.
axis 2
We did not observe any direct links between bacterial community composition and plant growth. However, in the ordination analysis, fungal communities sampled at the end of the season when plants had completed growth, clustered separately from fungal samples retrieved earlier in the season, suggesting that plant growth did impact fungal community composition. Microbial C in soil increased immediately prior to monsoon rains, indicating that the changes in RH, which likely increased water-filled pore space, were sufficient to support new microbial growth. Microbial biomass was found to be twice as high during the dry season than during the growing season in a California grassland, possibly a result of hydrologically driven decreases in microbial deaths as microbes in dry soils became isolated from predators and pathogens [46]. After soil moisture increased in our study, microbial C declined, perhaps due to predation. Clarholm [47] observed that bacterial growth after rain was followed by an increase in predator abundance and subsequent decline in microbial prey. Nematodes are present in this grassland, and their abundance Fig. 7 Nonmetric multidimensional scaling ordination of the Bray-Curtis pairwise dissimilarity of fungal sequences from the ITS region. Numbers represent sampling dates (n=22), and bubbles indicate soil water potential (−MPa) on each sampling date
186
axis 1
T. A. McHugh et al.
When marker genes for bacterial (16S) and fungal (28S) DNA and RNA were sequenced, the DNA-based approach showed that bacterial communities in California grassland soils were affected by dry down but not wet up, while the RNA-based approach indicated that both dry down and wet up influenced the bacterial community structure; in contrast, neither dry down nor wet up significantly altered the present or potentially active fungal communities [48]. Though the relative abundances of most bacterial phyla showed little variation over the study period, two groups exhibited a large relative response to monsoon precipitation. Abundance of populations within the phylum Firmicutes increased in response to rainfall. This finding is consistent with a laboratory wet up experiment that identified the Firmicutes phylum as exhibiting intermediate positive response to moisture [49]. The shift that we observed with an increase in soil moisture was triggered by increased abundances of the genus Bacillus, which includes facultative anaerobes. In contrast to the positive association found between Firmicutes and soil water content, Actinobacteria responded negatively to the increase in water availability. Actinobacteria are commonly found in terrestrial ecosystems [50], and members of the Actinomycetales, the most predominant order of Actinobacteria at the grassland site, have been shown to occur in high abundances in soils exhibiting low moisture conditions [51, 52]. These findings are consistent with our results, which showed highest abundance of Actinobacteria in dry soils.
Conclusion While an increasing number of studies have attempted to characterize how microbial communities respond to environmental stressors, few have examined the time course of microbial composition following relief from physiological stress. We tracked bacterial and fungal communities over a three and a half month period during monsoon season in the arid Southwest in order to fully assess the response of these organisms to precipitation. Based on the results of our field study, we conclude that the composition of soil bacterial and fungal communities changes relatively little throughout the monsoon season and does not show a direct response to precipitation.
Acknowledgments A National Science Foundation CAREER Award (EF-0747397) to E Schwartz funded this research. T McHugh was supported by a National Science Foundation IGERT Fellowship (DGE0549505). We thank Paul Dijkstra and Amy Welty-Bernard for the lab assistance and helpful suggestions.
References 1. Bryson R, Lowry WP (1955) Synoptic climatology of the Arizona summer precipitation singularity. Bull Am Meteorol Soc 36:329–339 2. Adams DK, Comrie AC (1997) The North American monsoon. Bull Am Meteorol Soc 78:2197–2213 3. Hales JE (1972) Surges of maritime tropical air northward over the Gulf of California. Mon Weather Rev 100:298–306 4. Brenner IS (1974) A surge of maritime tropical air—Gulf of California to the southwestern United States. Mon Weather Rev 102:375–389 5. Climate Assessment for the Southwest. University of Arizona. http:// www.climas.arizona.edu/sw-climate/monsoon. Accessed 30 Nov 2012 6. Seager R, Ting M, Held I, Kushnir Y, Lu J, Vecci G et al (2007) Model projections of an imminent transition to a more arid climate in southwestern North America. Science 316:1181–1184 7. Southwest Climate Change Network. Institute of the Environment, University of Arizona. http://www.southwestclimatechange.org/ climate/southwest/precipitation-changes. Accessed 15 Jan 2013 8. Harris RF (1981) Effect of water potential on microbial growth and activity. In: Parr JF, Gardner WR, Elliott LF (eds) Water potential relations in soil microbiology. Soil Science Society of America, Madison, pp 23–95 9. Lynch JM, Whipps JM (1990) Substrate flow in the rhizosphere. Plant Soil 129:1–10 10. Griffin DM (1981) Water and microbial stress. Adv Microb Ecol 5: 91–136 11. Schimel JP, Balser TC, Wallenstein M (2007) Microbial stressresponse physiology and its implications for ecosystem function. Ecology 88:1386–1394 12. Griffin DM (1981) Water potential as a selective factor in the microbial ecology of soils. In: Parr JF, Gardner WR, Elliott LF (eds) Water potential relations in soil microbiology. Soil Science Society of America, Madison, pp 141–151 13. Castro HF, Classen AT, Austin EE, Norby RJ, Schadt CW (2010) Soil microbial community responses to multiple experimental change drivers. Appl Environ Microbiol 76:999–1007 14. Cregger MA, Schadt CW, McDowell NG, Pockman WT, Classen AT (2012) Response of the soil microbial community to changes in precipitation in a semiarid ecosystem. Appl Environ Microbiol 78: 8587–8594 15. Griffiths RI, Whiteley AS, O’Donnell AG, Bailey MJ (2003) Physiological and community responses of established grassland bacterial populations to water stress. Appl Environ Microbiol 69: 6961–6968 16. Williams MA (2007) Response of microbial communities to water stress in irrigated and drought-prone tallgrass prairie soils. Soil Biol Biochem 39:2750–2757 17. Cruz-Martinez K, Suttle KB, Brodie EL, Power ME, Andersen GL, Banfield JF (2009) Despite strong seasonal responses, soil microbial consortia are more resilient to long-term changes in rainfall than overlying grassland. ISME J 3:738–744 18. Landesman WJ, Dighton J (2010) Response of soil microbial communities and the production of plant-available nitrogen to a two-year rainfall manipulation in the New Jersey Pinelands. Soil Biol Biochem 42:1751–1758 19. Fierer N, Schimel JP, Holden PA (2003) Influence of dryingrewetting frequency on soil bacterial community structure. Microb Ecol 45:63–71 20. Allison SD, Martiny JBH (2008) Resistance, resilience, and redundancy in microbial communities. Proc Natl Acad Sci 105:11512– 11519 21. Taylor DR (1983) Soil survey of Coconino County Area Arizona, central part. United States Department of Agriculture, Soil
Minor Changes in Soil Bacterial and Fungal Communities Conservation Service in Cooperation with Arizona Agricultural Experiment Station, Washington 22. Dowd SE, Callaway TR, Wolcott RD, Sun Y, McKeehan T, Hagevoort RG et al (2008) Evaluation of the bacterial diversity in the feces of cattle using 16S rRNA bacterial tag-encoded FLX amplicon pyrosequencing. BMC Microbiol 8:125 23. Acosta-Martinez V, Dowd S, Sun Y, Allen V (2008) Tag-encoded pyrosequencing analysis of bacterial diversity in a single soil type as affected by management and land use. Soil Biol Biochem 40:2762– 2770 24. Brookes PC, Landman A, Pruden G, Jenkinson DS (1985) Chloroform fumigation and the release of soil nitrogen, a rapid direct extraction method to measure microbial biomass nitrogen in soil. Soil Biol Biochem 17:837–842 25. Haubensak KA, Hart SC, Stark JM (2002) Influences of chloroform exposure time and soil water content on C and N release in forest soils. Soil Biol Biochem 34:1549–1562 26. Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello EK et al (2010) QIIME allows analysis of high-throughput community sequencing data. Nat Methods 7:335–336 27. Fierer N, Hamady M, Lauber CL, Knight R (2008) The influence of sex, handedness, and washing on the diversity of hand surface bacteria. Proc Natl Acad Sci 105:17994–17999 28. Lauber CL, Hamady M, Knight R, Fierer N (2009) Pyrosequencingbased assessment of soil pH as a predictor of soil bacterial community structure at the continental scale. Appl Environ Microbiol 75:5111– 5120 29. Evans S, Wallenstein MD (2012) Soil microbial community response to drying and rewetting stress: does historical precipitation regime matter? Biogeochemistry 109:101–116 30. Edgar RC (2010) Search and clustering orders of magnitude faster than BLAST. Bioinformatics 26:2460–2461 31. Caporaso JG, Bittinger K, Bushman FD, DeSantis TZ, Andersen GL, Knight R (2010) PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics 26:266–267 32. Faith DP, Baker AM (2007) Phylogenetic diversity (PD) and biodiversity conservation: some bioinformatics challenges. Evol Bioinformatics Online 2:121–128 33. Lozupone C, Knight R (2005) UniFrac: a new phylogenetic method for comparing microbial communities. Appl Environ Microbiol 71: 8228–8235 34. Hammer O, Harper DAT, Ryan PD (2001) PAST: paleontological statistics software package for education and data analysis. Palaeontol Electron 4:1–9 35. Dai A (2012) Increasing drought under global warming in observations and models. Nat Clim Chang 3:52–58 36. Adair KL, Schwartz E (2008) Evidence that ammonia-oxidizing archaea are more abundant than ammonia-oxidizing bacteria in semiarid soils of Northern Arizona, USA. Microb Ecol 56:420–426 37. Dijkstra P, Menyailo OV, Doucett RR, Hart SC, Schwartz E, Hungate BA (2006) C and N availability affects the 15N natural abundance of
38.
39.
40.
41.
42. 43.
44.
45.
46.
47. 48.
49.
50.
51.
52.
the soil microbial biomass across a cattle manure gradient. Eur J Soil Sci 57:468–475 Schwartz E, Blazewicz S, Doucett R, Hungate BA, Hart SC, Dijkstra P (2007) Natural abundance of δ15N and δ13C of DNA extracted from soil. Soil Biol Biochem 39:3101–3107 Dijkstra P, Thomas SC, Heinrich PL, Koch GW, Schwartz E, Hungate BA (2011) Effect of temperature on metabolic activity of intact microbial communities: evidence for altered metabolic pathway activity but not for increased maintenance respiration and reduced carbon use efficiency. Soil Biol Biochem 43:2023–2031 Cameron RE, Conrow HP (1969) Soil moisture, relative humidity, and microbial abundance in dry valleys of southern Victoria Land. Antarct J US 4:23–28 Austin AT, Yahdjian ML, Stark JM, Belnap J, Porporato A, Norton U et al (2004) Water pulses and biogeochemical cycles in arid and semiarid ecosystems. Oecologia 141:221–235 Schwinning S, Sala OE (2004) Hierarchy of responses to resource pulses in arid and semi-arid ecosystems. Oecologia 141:211–220 Reynolds JF, Kemp PR, Ogle K, Fernandez RJ (2004) Modifying the “pulse-reserve” paradigm for deserts of North America: precipitation pulses, soil water and plant responses. Oecologia 141:194–210 Collins SL, Sinsabaugh RL, Crenshaw C, Green L, Porras-Alfaro A, Stursova M, Zeglin LH (2008) Pulse dynamics and microbial processes in aridland ecosystems. J Ecol 96:413–420 Borken W, Matzner E (2009) Reappraisal of drying and wetting effects on C and N mineralization and fluxes in soils. Glob Chang Biol 15:808–824 Parker SS, Schimel JP (2011) Soil nitrogen availability and transformations differ between the summer and the growing season in a California grassland. Appl Soil Ecol 48:185–192 Clarholm M (1981) Protozoan grazing of bacteria in soil—impact and importance. Microb Ecol 7:343–350 Bernard RL, Osborne CA, Firestone ME (2013) Responses of soil bacterial and fungal communities to extreme desiccation and rewetting. ISME J 7:2229–2241 Placella SA, Brodie EL, Firestone MK (2012) Rainfall-induced carbon dioxide pulses result from sequential resuscitation of phylogenetically clustered microbial groups. Proc Natl Acad Sci 109:10931–10936 Youssef N, Sheik CS, Krumholz LR, Najar FZ, Roe BA, Elshahed MS (2009) Comparison of species richness estimates obtained using nearly complete fragments and simulated pyrosequencing-generated fragments in 16S rRNA gene-based environmental surveys. Appl Environ Microbiol 75:5227–5236 Alvarez HM, Silva RA, Cesari AC, Zamit AL, Peressutti SR, Reichelt R, Keller U, Malkus U, Rasch C, Maskow T, Mayer F, Steinbüchel A (2004) Physiological and morphological responses of the soil bacterium Rhodococcus opacus strain PD630 to water stress. FEMS Microbiol Ecol 50:75–86 LeBlanc JC, Goncalves ER, Mohn WW (2008) Global response to desiccation stress in the soil actinomycete Rhodococcus jostii RHA1. Appl Environ Microbiol 74:2627–2636
SOIL MICROBIOLOGY
Minor Changes in Soil Bacterial and Fungal Community Composition Occur in Response to Monsoon Precipitation in a Semiarid Grassland Theresa A. McHugh & George W. Koch & Egbert Schwartz
Received: 17 April 2013 / Accepted: 1 April 2014 # Springer Science+Business Media New York 2014
Abstract Arizona and New Mexico receive half of their annual precipitation during the summer monsoon season, making this large-scale rain event critical for ecosystem productivity. We used the monsoon rains to explore the responses of soil bacterial and fungal communities to natural moisture pulses in a semiarid grassland. Through 454 pyrosequencing of the 16S rRNA gene and ITS region, we phylogenetically characterized these communities at 22 time points during a summer season. Relative humidity increased before the rains arrived, creating conditions in soil that allowed for the growth of microorganisms. During the course of the study, the relative abundances of most bacterial phyla showed little variation, though some bacterial populations responded immediately to an increase in soil moisture once the monsoon rains arrived. The Firmicutes phylum experienced over a sixfold increase in relative abundance with increasing water availability. Conversely, Actinobacteria, the dominant taxa at our site, were negatively affected by the increase in water availability. No relationship was found between bacterial diversity and soil water potential. Bacterial community structure was unrelated to all environmental variables that we measured, with the exception of a significant relationship with atmospheric relative humidity. Relative abundances of fungal phyla fluctuated more throughout the season than bacterial abundances did. Variation in fungal community structure was unrelated to soil water potential and to most environmental variables. However, ordination analysis showed a distinct fungal community structure late in the season, probably due to plant senescence.
Electronic supplementary material The online version of this article (doi:10.1007/s00248-014-0416-3) contains supplementary material, which is available to authorized users. T. A. McHugh (*) : G. W. Koch : E. Schwartz Department of Biological Sciences, Northern Arizona University, P.O. Box 5640, Flagstaff, AZ 86011, USA e-mail: [email protected]
Introduction Monsoons, which occur in East Asia, India, and parts of North America, are caused by a change in global wind patterns as a result of differential heating of land and oceans [1]. Solar radiation heats landmasses more quickly than bodies of water, producing a low pressure system over land during the warmest part of the year. At the same time, cool air above oceans creates a zone of high pressure. The associated pressure gradient causes winds to shift to an ocean-to-land direction, bringing moist air inland and resulting in periods of intense rainfall [2]. The North American monsoon transports pulses of moisture from the tropical eastern Pacific Ocean, Gulf of California, and Gulf of Mexico [3, 4]. This seasonal precipitation relieves drought as conditions transition from an extremely dry spring to a wet summer for large parts of the southwestern USA and northwestern Mexico. Arizona and New Mexico receive up to 50 % of their annual precipitation during the summer monsoon season [5], making this rain event critical for ecosystem productivity and dynamics. We utilized the natural summer rain event in northern Arizona to examine the impact of seasonal moisture on soil microbial community structure in a semiarid grassland. Climate models project that the southwestern USA, which already is arid, will become drier as climate change proceeds [6]. Temperature rise will increase the risk of drought through heightened evaporation from the landscape, while precipitation in Arizona and New Mexico is expected to decline by 5 to 10 % by the end of this century [7]. Increased evaporation in summer and reduced precipitation year-round will likely impact soil microbial communities, but to date, there are few studies that track microbial community structure during the monsoon season. Consequently, it is difficult to assess the impact of climate change on soil microbial communities in regions subjected to monsoon weather patterns since we do not
T. A. McHugh et al.
know what the baseline of change is during monsoon season. Soil water is an essential resource, and its availability impacts microbial growth, activity, and survival [8]. Water content of soil affects the osmotic environment of microbial cells and influences soil properties such as pH, temperature, and oxygen content. Furthermore, moisture determines plant productivity and can have important consequences for soil microorganisms through changes in the quantity and quality of plant-derived carbon inputs [9]. Soil water affects bacterial activity in two major ways: limiting the movement of bacteria to new nutrient sites and restricting metabolism through nutrient deficiencies. The results are lowered respiration and nutrient mineralization [8, 10, 11]. Fungi, with their filamentous structure, appear more capable of withstanding drying stress because they do not experience the limitation of movement that is inherent in a unicellular structure [12]. Despite numerous studies, the roles of precipitation and moisture in shaping soil microbial communities remain unclear. While some studies have seen moisture-related changes in soil microbial community composition [13, 14], others have observed few or no differences in the microbial community structure between wet and dry soils [15–18]. Soil microorganisms exposed to natural variability in moisture conditions may be adapted to water stress and exhibit resistance or resilience to moisture manipulations in the laboratory [15, 19] or field setting [17, 18]. However, a review of studies that exposed soil microbial communities to various forms of disturbance, including CO2 enrichment, temperature changes, and mineral nutrient addition, found microbial community structure generally to be sensitive to disturbance and slow to return to the original composition [20]. We used the natural monsoon rain event in northern Arizona to establish how soil microbial community structure in a semiarid grassland is impacted by this seasonal precipitation. Through pyrosequencing of ribosomal RNA genes obtained from soil, we were able to assess the response of bacterial and fungal communities to changes in soil moisture. While most previous studies characterized microbial communities at only a few time points [e.g., 14, 19], we collected soil on 22 dates throughout the summer in order to fully characterize the response of soil microorganisms to moisture changes over time. We also utilized a natural rainfall phenomenon, and in doing so, we were able to avoid experimental artifacts inherent in many laboratory and field manipulations. We hypothesized that a large change in soil moisture associated with the advent of the monsoon season would cause dramatic changes in abundance, diversity, and overall composition of bacterial and fungal communities at our grassland site. Alternatively, these communities could be resistant or resilient to this predictable summer rainfall, in which case, we expected either no change in community composition during the monsoon season or that the microbial communities at the end of the
monsoon season would be similar in composition to the soil communities present prior to the arrival of monsoon rains.
Methods Site Description and Sample Collection Our study area is a semiarid, high desert grassland north of Flagstaff, AZ (35° 34′ 20 ″ N, 111° 34′ 4″ W, 1,760 m above sea level, 230 mm of rain annually). Plants are mainly perennial grasses (Bouteloua eriopoda, Bouteloua gracilis, Sporobulus cryptandrus, and Pleuraphis jamesii) with few shrubs (Ericameria nauseousa and Gutierrezia sarothrae). Soils are cindery and are classified in the US Department of Agriculture Soil Taxonomic Subgroup of Typic Haplustolls [21]. The terrain has nearly flat slopes (less than 2 %). This ecosystem is subject to the North American monsoon and experiences a shift first in relative humidity, followed by precipitation during the summer. The dry season typically lasts from May to mid-July and is characterized by dry westerly winds. The wet season extends from mid-July to September and is characterized by wet southeasterly winds. There is a Campbell Scientific (Logan, UT) weather station located at this field site that collects precipitation, temperature, and atmospheric relative humidity data in addition to other environmental variables. In an effort to understand soil microbial dynamics during natural dry-wet cycles, we collected soil before, during, and after monsoon precipitation in the summer of 2010. Five replicate soil cores (5-cm diameter and 5-cm depth) were taken from randomly selected open spaces between plants on 22 collection dates from 23 June to 30 September, for a total of 110 cores. Soil subsamples were homogenized, sieved to 2 mm, and used to determine gravimetric water content (105 °C). Fifty grams of soil was sent to Colorado State University’s Soil, Water, and Plant Testing Laboratory for moisture tension determination. Remaining soil was stored at −40 °C until further processing. Pyrosequencing We extracted DNA from 0.5 g of soil in each sample using PowerLyzer PowerSoil DNA Isolation Kit according to the manufacturer’s instructions, with an initial 10-min incubation at 70 °C followed by bead beating for 90 s (MO BIO Laboratories, Inc., Carlsbad, CA). DNA was quantified with a Qubit Fluorometer (Life Technologies, Carlsbad, CA) and standardized to 10 ng/μl. We pooled replicate extracts to achieve one representative DNA sample for each time point because we were most interested in the average soil microbial community and less concerned with the variation in microbial community composition among samples at a given time point.
Minor Changes in Soil Bacterial and Fungal Communities
DNA was sent to Research and Testing Laboratories, Lubbock, TX, for pyrosequencing of a portion of the bacterial 16S ribosomal RNA (rRNA) gene and fungal internal transcribed spacer (ITS) region. Tag pyrosequencing was performed with primers 28F (GAGTTTGATCNTGGCTCAG) and 519R (GTNTTACNGCGGCKGCTG) for bacteria and ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS4R (TCCT CCGCTTATTGATATGC) for fungi using previously described methods [22, 23]. Microbial Biomass A 20-g subsample of soil from each core was used to measure microbial biomass carbon (C) and nitrogen (N) according to the chloroform fumigation method [24]. Soils were brought to field capacity (21.49 %) to avoid moisture-related differences in extraction efficiency [25]. We fumigated soils over a 5-day period, while a separate 20-g subsample was not fumigated and served as a control. Dissolved C and N were extracted by shaking fumigated and control soils in 50 ml of 0.05 M K2SO4 for 1 h at 200 rpm and filtering through Whatman No. 1 filter papers. Salt precipitates were analyzed for total C and N using a Thermo-Finnigan Delta Plus Advantage isotope ratio mass spectrometer. We calculated microbial biomass by subtracting C and N in control samples from that in fumigated samples, with no corrections applied. Extractable C and N values were derived from unfumigated controls. Nitrogen Pools We measured N pools by extracting ammonium (NH4+) and nitrate (NO3−) from 10-g soil samples in 40 ml of 2M KCl solution in the field. Samples were transported back to the laboratory, shaken for 1 h at 200 rpm, and filtered through Whatman No. 1 filter papers. Ammonium and NO3− extracts were analyzed colorimetrically with a Lachat analyzer.
would be expected to suffer from cloud contamination. Very low values of NDVI (0.1 and below) correspond to barren areas. Moderate values (0.2 to 0.3) represent shrub and grassland, while high values (0.6 to 0.8) indicate dense rainforests. Data Analysis Linear models in R were used to understand the factors driving changes in microbial biomass and microbial abund a n c e s ( h t t p : / / w w w. R - p r o j e c t . o rg ) . A n a l y s i s o f pyrosequencing data was performed using QIIME [26] as established in previous studies [e.g., 27–29]. Specifically, low-quality sequences (less than 200 bp and with a quality score less than 25) were removed. Operational taxonomic units (OTUs) were assigned using a 97 % similarity cutoff with uclust [30]. Bacterial taxonomy was assigned with the Greengenes reference set, and representative sequences were aligned with the PyNAST algorithm [31]. Fungal taxonomy was assigned with BLAST using the UNITE reference database. Alpha diversity and rarefaction were computed for bacterial sequences using the Chao1, observed species, and phylogenetic diversity metrics [32]. Beta diversity (pairwise sample dissimilarity) was computed with UniFrac [33] for bacterial communities, while the non-phylogenetic Bray-Curtis metric was utilized for fungi. Microbial community structure was assessed with nonmetric multidimensional scaling (NMS) in Primer v. 6 (http://www.primer-e.com). We used Mantel tests (rM) to compare the changes in microbial community composition (UniFrac distance matrix for bacteria and BrayCurtis dissimilarity matrix for fungi) with the changes in environmental variables: air temperature, atmospheric relative humidity, water potential, NDVI, inorganic N, and extractable C (Euclidian distance matrices; PAST 3.x [34]). Additionally, an analysis of similarity (ANOSIM) test was performed on the UniFrac (bacteria) and Bray-Curtis (fungi) matrices to test the null hypothesis of no compositional difference between communities on various sampling days.
Normalized Difference Vegetation Index It was challenging to measure aboveground net primary productivity in our study because a large fraction of the plant biomass formed during the previous monsoon season. Separating newly formed green plant biomass from dormant old tissue proved extremely laborious, and the data was not deemed reliable. Therefore, we employed an alternative method for assessing the plant community. We obtained normalized difference vegetation indices (NDVIs) for our study site from Moderate Resolution Imaging Spectroradiometer satellite data. Average 16-day composite NDVIs were calculated for a 9×9 grid of 250-m pixels centered on the location of our study site. The 16-day composite is commonly used in phenological studies because it is likely during a 16-day period to get at least one cloud-free day, whereas a daily time series
Results Relative humidity (RH) increased in the weeks leading up to the first rain event. The RH of the air crossed the 50 % mark on Julian day 177 at approximately 5 o’clock in the morning. Minimum RH, which consistently occurred in the middle of the day, remained below 50 % until Julian day 212. The RH increased before our study site received any precipitation. Two sampling dates occurred while maximum RH was low (0.05). Soil inorganic N concentrations (NO3− and NH4+) ranged from 0.86 to 8.9 μg N/g dry soil and fluctuated periodically throughout the season (Fig. S3). Some
a
b
25
30 20 Soil Water Content (%)
25 Precipitation (mm)
Fig. 1 Monsoon precipitation (a) and soil moisture content (b) at the study site during summer 2010
influence of soil water potential was found for ammonium (R2 =0.222, p=0.0156) but not for nitrate. Pyrosequencing produced 198,574 bacterial sequences and 3,129 OTUs, which were defined at a 97 % similarity. Sequences per sample ranged from 6,069 to 11,435, with an average of 8,427. Rarefaction curves did not asymptote, indicating new bacterial taxa were still being characterized with additional sequences. Alpha diversity (Chao1) was lowest at the start of the monsoon season and highest at the end, though we found no significant relationship between alpha diversity and soil water potential. Bacterial communities were dominated by the phyla Actinobacteria (53 % on average), Proteobacteria (16 %), and Acidobacteria (8.7 %, Fig. 4). During the course of the study, the relative abundances of most bacterial phyla showed little variation. Coefficients of variation for the relative abundances of the dominant phyla were 0.092, 0.185, and 0.224 for Actinobacteria, Proteobacteria, and Acidobacteria, respectively. One exception was the phylum Firmicutes, whose coefficient of variation for relative abundance during the monsoon season was 0.910. The Firmicutes phylum comprised a larger fraction of the community as water availability increased, with 36 % of the variation in relative abundance explained by soil water potential (R 2 = 0.358, p = 0.0035). Members of the Bacillaceae experienced as much as an 800 % increase in relative abundance when the rains commenced. Soil water also showed some degree of influence on Actinobacteria, as increased relative abundances corresponded with decreasing water potential (R2 =0.459, p=0.00053). When communities from the 22 time points were analyzed for similarity using UniFrac distances, bacterial communities in dry soil samples appeared to separate from wetter samples along the second axis. However, ANOSIM analysis indicated that this separation was not significant (Fig. 5). The bacterial community structure was
15
10
5
Gravimetric Volumetric
20 15 10 5
0
0 174 186 198 210 222 234 246 258 270 Julian Day
170 182 194 206 218 230 242 254 266 278 Julian Day
Minor Changes in Soil Bacterial and Fungal Communities
0.50
long-term precipitation records for our grassland site. While the 50-year monsoon rainfall average for the Flagstaff region is 185 mm, our study area generally receives considerably less precipitation. It is very difficult to gauge monsoon precipitation with proxy sites because this precipitation is patchy, with intense storms drenching some areas and not others. Therefore, in studying the impact of climate change on monsoon weather patterns and soil microbial communities, it is critical that long-term weather records are established at research sites such as our semiarid grassland, which has been the subject of numerous studies of the soil microbial community [e.g., 36–39].
0.45 0.40 0.35
NDVI
0.30 0.25 0.20 0.15 0.10 0.05 280
Julian Day Fig. 2 Mean 16-day composite normalized difference vegetation index (NDVI) for our study area during summer 2010. Error bars are standard error for means
unrelated to all environmental variables that we measured, with the exception of atmospheric relative humidity, which showed some influence (rM =0.265, p=0.00899). Sequencing of the ITS region produced 128,662 sequences and 639 OTUs, defined at a 97 % similarity. Sequences per sample ranged from 2,280 to 14,856 with an average of 5,792. Fungi were dominated by the phyla Ascomycota (56.9 % on average) and Basidiomycota (30.49 %, Fig. 6). Fungal phyla were more variable throughout the summer season than bacteria were, with coefficients of variation ranging from 0.261 to 1.451. NMS ordination of fungal communities present in the grassland throughout the summer season showed no grouping according to soil water potential (Fig. 7). Fungal community structure was unrelated to environmental variables (rM 0.05). However, ANOSIM analysis indicated that fungal communities late in the season (Julian days 245 to 273) differed significantly from communities present earlier in the season (global R=0.874, p=0.001).
Discussion The northern Arizona monsoon season of 2010 delivered 100 mm of precipitation to our study site, with frequent small and infrequent large rain events occurring between mid-July and early September. The season’s rainfall was 14 mm above the 8-year summer average for this grassland, but because that period coincides with a drought, it is unlikely to reflect longterm averages. Recent modeling exercises indicate that due to climate change, average soil moisture may decline as much as 10 % by the end of the twenty-first century [35]. There are no
a
800
250
Microbial C
700
Water Potential
600 500
200 150
400 100
300 200
50
100
Soil Water Potential(-MPa)
250
0
0 170
190
210
230
250
270
Julian Day
b
700
Extractable C
600
Water Potential
250 200
500 400
150
300
100
200 50
100
Soil Water Potential (-MPa)
220
0
0 170
190
210
230
250
270
Julian Day
c
250
160
C:N
140
Water Potential
120 100
200 150
80 100
60 40
50
20
Soil Water Potential (-MPa)
190
Microbial C (ug C/g dry soil)
160
Extractable C (ug C/g dry soil)
130
Extractable C:N
0.00 100
0
0 170
190
210
230
250
270
Julian Day
Fig. 3 Mean microbial biomass C (a), extractable C (b), and extractable C:N (c) as determined by chloroform fumigation extractions. Error bars are standard error for means (n=5)
T. A. McHugh et al. 1
Fig. 4 Dynamics of the 16S rRNA gene-based relative abundance of the dominant bacterial phyla
0.9
Relative Abundance
0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0 174
198
204 216 Julian Day
228
252
Other
Acidobacteria
Actinobacteria
Bacteroidetes
Chloroflexi
Firmicutes
Gemmatimonadetes
Proteobacteria
273
small rain events, while ineffective at triggering plant growth or substantially increasing soil moisture, can stimulate the activity of microorganisms located just beneath the soil surface [41, 42]. An alternative measure of net primary productivity is to use satellite information to quantify the change in greenness of the entire site. NDVI values complemented personal observations of greenness in the field (Figs. 3 and S1) and indicated that larger rain events are necessary to trigger growth of plants in semiarid grasslands [43]. While the spatial resolution of NDVI data is relatively coarse, our grassland study site is homogeneous on a 1-km scale. NDVI measures identified that plant growth reached a peak on Julian day 225. Soil microbial communities are also affected by changes in the overlying plant community. Moisture-induced pulses of nutrient mineralization resulting from the effects of altered water availability on soil microorganisms are important for stimulating plant productivity, which can in turn feedback to affect microbial communities belowground [41, 42, 44, 45].
axis 2
Consistent with monsoon weather patterns, the RH of air increased at our grassland site before monsoon precipitation arrived and soil moisture increased. RH is controlled by temperature, with low RH occurring during the heat of the day and higher values observed when temperatures are lower during the night and early morning hours. Due to the matric potential of soil, RH is often higher in the soil atmosphere than in air above the soil, such that even when air is not saturated, liquid water is available in small soil pores. In measurements of RH at the McMurdo Dry Valleys in Antarctica, for instance, it was observed that the RH 5-cm deep in soil approached 100 % while the air RH varied between 20 and 60 % [40]. Therefore, as the RH at our study site rose to over 50 % prior to the monsoon rains, it is likely that more soil pores filled with water, thereby expanding the habitat for bacteria. We observed a statistically significant relationship between the bacterial community structure and atmospheric relative humidity. The first rain shower occurred on Julian day 197, delivering just 0.25 mm of precipitation. Like elevated RH,
Fig. 5 Nonmetric multidimensional scaling ordination of the weighted UniFrac pairwise dissimilarity of bacterial sequences from the 16S rRNA gene. Numbers represent sampling dates (n=22), and bubbles indicate soil water potential (−MPa) on each sampling date
186
axis 1
Minor Changes in Soil Bacterial and Fungal Communities 1
Fig. 6 Dynamics of the ITSbased relative abundance of fungal phyla
0.9
Relative Abundance
0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0 174
198
Other
Ascomycota
Glomeromycota
Zygomycota
204 216 228 Julian Day Basidiomycota
252
273
Chytridiomycota
Unidentified
at our study site has been observed to nearly double upon arrival of the monsoon rains (McHugh, unpublished data). The subtle changes in microbial community composition we observed in response to precipitation are similar to findings of several recent rain manipulation studies. One laboratory manipulation of soil moisture utilizing DGGE analysis of bacterial 16S rRNA genes showed no change in bacterial community structure with varied moisture regimes, leading the researchers to conclude that the bacterial communities in their study were resistant to water stress [15]. Another study using 16S rRNA gene microarrays found little difference between manipulated soil moisture plots and ambient controls [17], and a comparable field study using PLFA analysis showed no effect of moisture treatments on soil microbial community composition [18]. Perhaps, moisture variations alone do not reflect the changes that occur in the microbial communities of arid grassland soils during the monsoon season. Alternatively, the method of microbial community analysis could dictate whether changes in microbial community composition due to variation in soil moisture are observed.
axis 2
We did not observe any direct links between bacterial community composition and plant growth. However, in the ordination analysis, fungal communities sampled at the end of the season when plants had completed growth, clustered separately from fungal samples retrieved earlier in the season, suggesting that plant growth did impact fungal community composition. Microbial C in soil increased immediately prior to monsoon rains, indicating that the changes in RH, which likely increased water-filled pore space, were sufficient to support new microbial growth. Microbial biomass was found to be twice as high during the dry season than during the growing season in a California grassland, possibly a result of hydrologically driven decreases in microbial deaths as microbes in dry soils became isolated from predators and pathogens [46]. After soil moisture increased in our study, microbial C declined, perhaps due to predation. Clarholm [47] observed that bacterial growth after rain was followed by an increase in predator abundance and subsequent decline in microbial prey. Nematodes are present in this grassland, and their abundance Fig. 7 Nonmetric multidimensional scaling ordination of the Bray-Curtis pairwise dissimilarity of fungal sequences from the ITS region. Numbers represent sampling dates (n=22), and bubbles indicate soil water potential (−MPa) on each sampling date
186
axis 1
T. A. McHugh et al.
When marker genes for bacterial (16S) and fungal (28S) DNA and RNA were sequenced, the DNA-based approach showed that bacterial communities in California grassland soils were affected by dry down but not wet up, while the RNA-based approach indicated that both dry down and wet up influenced the bacterial community structure; in contrast, neither dry down nor wet up significantly altered the present or potentially active fungal communities [48]. Though the relative abundances of most bacterial phyla showed little variation over the study period, two groups exhibited a large relative response to monsoon precipitation. Abundance of populations within the phylum Firmicutes increased in response to rainfall. This finding is consistent with a laboratory wet up experiment that identified the Firmicutes phylum as exhibiting intermediate positive response to moisture [49]. The shift that we observed with an increase in soil moisture was triggered by increased abundances of the genus Bacillus, which includes facultative anaerobes. In contrast to the positive association found between Firmicutes and soil water content, Actinobacteria responded negatively to the increase in water availability. Actinobacteria are commonly found in terrestrial ecosystems [50], and members of the Actinomycetales, the most predominant order of Actinobacteria at the grassland site, have been shown to occur in high abundances in soils exhibiting low moisture conditions [51, 52]. These findings are consistent with our results, which showed highest abundance of Actinobacteria in dry soils.
Conclusion While an increasing number of studies have attempted to characterize how microbial communities respond to environmental stressors, few have examined the time course of microbial composition following relief from physiological stress. We tracked bacterial and fungal communities over a three and a half month period during monsoon season in the arid Southwest in order to fully assess the response of these organisms to precipitation. Based on the results of our field study, we conclude that the composition of soil bacterial and fungal communities changes relatively little throughout the monsoon season and does not show a direct response to precipitation.
Acknowledgments A National Science Foundation CAREER Award (EF-0747397) to E Schwartz funded this research. T McHugh was supported by a National Science Foundation IGERT Fellowship (DGE0549505). We thank Paul Dijkstra and Amy Welty-Bernard for the lab assistance and helpful suggestions.
References 1. Bryson R, Lowry WP (1955) Synoptic climatology of the Arizona summer precipitation singularity. Bull Am Meteorol Soc 36:329–339 2. Adams DK, Comrie AC (1997) The North American monsoon. Bull Am Meteorol Soc 78:2197–2213 3. Hales JE (1972) Surges of maritime tropical air northward over the Gulf of California. Mon Weather Rev 100:298–306 4. Brenner IS (1974) A surge of maritime tropical air—Gulf of California to the southwestern United States. Mon Weather Rev 102:375–389 5. Climate Assessment for the Southwest. University of Arizona. http:// www.climas.arizona.edu/sw-climate/monsoon. Accessed 30 Nov 2012 6. Seager R, Ting M, Held I, Kushnir Y, Lu J, Vecci G et al (2007) Model projections of an imminent transition to a more arid climate in southwestern North America. Science 316:1181–1184 7. Southwest Climate Change Network. Institute of the Environment, University of Arizona. http://www.southwestclimatechange.org/ climate/southwest/precipitation-changes. Accessed 15 Jan 2013 8. Harris RF (1981) Effect of water potential on microbial growth and activity. In: Parr JF, Gardner WR, Elliott LF (eds) Water potential relations in soil microbiology. Soil Science Society of America, Madison, pp 23–95 9. Lynch JM, Whipps JM (1990) Substrate flow in the rhizosphere. Plant Soil 129:1–10 10. Griffin DM (1981) Water and microbial stress. Adv Microb Ecol 5: 91–136 11. Schimel JP, Balser TC, Wallenstein M (2007) Microbial stressresponse physiology and its implications for ecosystem function. Ecology 88:1386–1394 12. Griffin DM (1981) Water potential as a selective factor in the microbial ecology of soils. In: Parr JF, Gardner WR, Elliott LF (eds) Water potential relations in soil microbiology. Soil Science Society of America, Madison, pp 141–151 13. Castro HF, Classen AT, Austin EE, Norby RJ, Schadt CW (2010) Soil microbial community responses to multiple experimental change drivers. Appl Environ Microbiol 76:999–1007 14. Cregger MA, Schadt CW, McDowell NG, Pockman WT, Classen AT (2012) Response of the soil microbial community to changes in precipitation in a semiarid ecosystem. Appl Environ Microbiol 78: 8587–8594 15. Griffiths RI, Whiteley AS, O’Donnell AG, Bailey MJ (2003) Physiological and community responses of established grassland bacterial populations to water stress. Appl Environ Microbiol 69: 6961–6968 16. Williams MA (2007) Response of microbial communities to water stress in irrigated and drought-prone tallgrass prairie soils. Soil Biol Biochem 39:2750–2757 17. Cruz-Martinez K, Suttle KB, Brodie EL, Power ME, Andersen GL, Banfield JF (2009) Despite strong seasonal responses, soil microbial consortia are more resilient to long-term changes in rainfall than overlying grassland. ISME J 3:738–744 18. Landesman WJ, Dighton J (2010) Response of soil microbial communities and the production of plant-available nitrogen to a two-year rainfall manipulation in the New Jersey Pinelands. Soil Biol Biochem 42:1751–1758 19. Fierer N, Schimel JP, Holden PA (2003) Influence of dryingrewetting frequency on soil bacterial community structure. Microb Ecol 45:63–71 20. Allison SD, Martiny JBH (2008) Resistance, resilience, and redundancy in microbial communities. Proc Natl Acad Sci 105:11512– 11519 21. Taylor DR (1983) Soil survey of Coconino County Area Arizona, central part. United States Department of Agriculture, Soil
Minor Changes in Soil Bacterial and Fungal Communities Conservation Service in Cooperation with Arizona Agricultural Experiment Station, Washington 22. Dowd SE, Callaway TR, Wolcott RD, Sun Y, McKeehan T, Hagevoort RG et al (2008) Evaluation of the bacterial diversity in the feces of cattle using 16S rRNA bacterial tag-encoded FLX amplicon pyrosequencing. BMC Microbiol 8:125 23. Acosta-Martinez V, Dowd S, Sun Y, Allen V (2008) Tag-encoded pyrosequencing analysis of bacterial diversity in a single soil type as affected by management and land use. Soil Biol Biochem 40:2762– 2770 24. Brookes PC, Landman A, Pruden G, Jenkinson DS (1985) Chloroform fumigation and the release of soil nitrogen, a rapid direct extraction method to measure microbial biomass nitrogen in soil. Soil Biol Biochem 17:837–842 25. Haubensak KA, Hart SC, Stark JM (2002) Influences of chloroform exposure time and soil water content on C and N release in forest soils. Soil Biol Biochem 34:1549–1562 26. Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello EK et al (2010) QIIME allows analysis of high-throughput community sequencing data. Nat Methods 7:335–336 27. Fierer N, Hamady M, Lauber CL, Knight R (2008) The influence of sex, handedness, and washing on the diversity of hand surface bacteria. Proc Natl Acad Sci 105:17994–17999 28. Lauber CL, Hamady M, Knight R, Fierer N (2009) Pyrosequencingbased assessment of soil pH as a predictor of soil bacterial community structure at the continental scale. Appl Environ Microbiol 75:5111– 5120 29. Evans S, Wallenstein MD (2012) Soil microbial community response to drying and rewetting stress: does historical precipitation regime matter? Biogeochemistry 109:101–116 30. Edgar RC (2010) Search and clustering orders of magnitude faster than BLAST. Bioinformatics 26:2460–2461 31. Caporaso JG, Bittinger K, Bushman FD, DeSantis TZ, Andersen GL, Knight R (2010) PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics 26:266–267 32. Faith DP, Baker AM (2007) Phylogenetic diversity (PD) and biodiversity conservation: some bioinformatics challenges. Evol Bioinformatics Online 2:121–128 33. Lozupone C, Knight R (2005) UniFrac: a new phylogenetic method for comparing microbial communities. Appl Environ Microbiol 71: 8228–8235 34. Hammer O, Harper DAT, Ryan PD (2001) PAST: paleontological statistics software package for education and data analysis. Palaeontol Electron 4:1–9 35. Dai A (2012) Increasing drought under global warming in observations and models. Nat Clim Chang 3:52–58 36. Adair KL, Schwartz E (2008) Evidence that ammonia-oxidizing archaea are more abundant than ammonia-oxidizing bacteria in semiarid soils of Northern Arizona, USA. Microb Ecol 56:420–426 37. Dijkstra P, Menyailo OV, Doucett RR, Hart SC, Schwartz E, Hungate BA (2006) C and N availability affects the 15N natural abundance of
38.
39.
40.
41.
42. 43.
44.
45.
46.
47. 48.
49.
50.
51.
52.
the soil microbial biomass across a cattle manure gradient. Eur J Soil Sci 57:468–475 Schwartz E, Blazewicz S, Doucett R, Hungate BA, Hart SC, Dijkstra P (2007) Natural abundance of δ15N and δ13C of DNA extracted from soil. Soil Biol Biochem 39:3101–3107 Dijkstra P, Thomas SC, Heinrich PL, Koch GW, Schwartz E, Hungate BA (2011) Effect of temperature on metabolic activity of intact microbial communities: evidence for altered metabolic pathway activity but not for increased maintenance respiration and reduced carbon use efficiency. Soil Biol Biochem 43:2023–2031 Cameron RE, Conrow HP (1969) Soil moisture, relative humidity, and microbial abundance in dry valleys of southern Victoria Land. Antarct J US 4:23–28 Austin AT, Yahdjian ML, Stark JM, Belnap J, Porporato A, Norton U et al (2004) Water pulses and biogeochemical cycles in arid and semiarid ecosystems. Oecologia 141:221–235 Schwinning S, Sala OE (2004) Hierarchy of responses to resource pulses in arid and semi-arid ecosystems. Oecologia 141:211–220 Reynolds JF, Kemp PR, Ogle K, Fernandez RJ (2004) Modifying the “pulse-reserve” paradigm for deserts of North America: precipitation pulses, soil water and plant responses. Oecologia 141:194–210 Collins SL, Sinsabaugh RL, Crenshaw C, Green L, Porras-Alfaro A, Stursova M, Zeglin LH (2008) Pulse dynamics and microbial processes in aridland ecosystems. J Ecol 96:413–420 Borken W, Matzner E (2009) Reappraisal of drying and wetting effects on C and N mineralization and fluxes in soils. Glob Chang Biol 15:808–824 Parker SS, Schimel JP (2011) Soil nitrogen availability and transformations differ between the summer and the growing season in a California grassland. Appl Soil Ecol 48:185–192 Clarholm M (1981) Protozoan grazing of bacteria in soil—impact and importance. Microb Ecol 7:343–350 Bernard RL, Osborne CA, Firestone ME (2013) Responses of soil bacterial and fungal communities to extreme desiccation and rewetting. ISME J 7:2229–2241 Placella SA, Brodie EL, Firestone MK (2012) Rainfall-induced carbon dioxide pulses result from sequential resuscitation of phylogenetically clustered microbial groups. Proc Natl Acad Sci 109:10931–10936 Youssef N, Sheik CS, Krumholz LR, Najar FZ, Roe BA, Elshahed MS (2009) Comparison of species richness estimates obtained using nearly complete fragments and simulated pyrosequencing-generated fragments in 16S rRNA gene-based environmental surveys. Appl Environ Microbiol 75:5227–5236 Alvarez HM, Silva RA, Cesari AC, Zamit AL, Peressutti SR, Reichelt R, Keller U, Malkus U, Rasch C, Maskow T, Mayer F, Steinbüchel A (2004) Physiological and morphological responses of the soil bacterium Rhodococcus opacus strain PD630 to water stress. FEMS Microbiol Ecol 50:75–86 LeBlanc JC, Goncalves ER, Mohn WW (2008) Global response to desiccation stress in the soil actinomycete Rhodococcus jostii RHA1. Appl Environ Microbiol 74:2627–2636
