metal(s) mediated by nucleic acids and their properties.

Review pubs.acs.org/CR

Biotemplated Inorganic Nanostructures: Supramolecular Directed Nanosystems of Semiconductor(s)/Metal(s) Mediated by Nucleic Acids and Their Properties Anil Kumar* and Vinit Kumar Department of Chemistry, Indian Institute of Technology Roorkee, Roorkee-247667, India 4.3. Nucleobase-Mediated Semiconducting Nanostructures 4.3.1. Purine/Adenine/Guanine−CdS 4.3.2. Adenine−β-FeOOH 4.4. Integrated Nanosystems 4.4.1. DNA-Templated Au/Fe2O3 Nanostructures 4.4.2. Adenine-Templated Ag/CdS 4.4.3. GMP-Templated Binary (Ag/CdS, βFe2O3/CdS) and Ternary (β-Fe2O3/Ag/ CdS) Nanohybrids 4.4.4. GMP-Templated Binary (β-Fe2O3/CdS) (SG) and Ternary (β-Fe2O3/Ag/CdS) (SI) Nanohybrids 5. Biologically Synthesized Quantized Semiconductor Nanostructures: CdS and ZnS 6. General Discussion 6.1. Future Prospects and Challenges Author Information Corresponding Author Notes Biographies Acknowledgments References

CONTENTS 1. Introduction 1.1. Nanosized Semiconductors and Metals: Their Synthetic Protocols 1.1.1. Physicochemical Methods 1.1.2. Inorganic Templates 1.1.3. Organic and Bioorganic Templates 2. DNA-Based Nanoarchitectures 2.1. Nanostrucures of DNA 2.2. DNA-Templated Inorganic Nanostructures 2.2.1. DNA-Templated Semiconductor Nanostructures 2.2.2. DNA-Templated Metal Nanosystems 3. RNA-Mediated Nanosystems 3.1. RNA-Templated Semiconductor Nanostructures 3.1.1. RNA−CdS 3.1.2. RNA−PbS 3.1.3. RNA−PbSe 3.1.4. RNA−CdS/ZnS 3.1.5. RNA−Iron Oxide 3.2. RNA-Templated Metal Nanostructures 3.2.1. RNA−Au 4. Nucleotide- and Nucleobase-Templated Nanostructures 4.1. Nucleotide-Templated Semiconductors 4.1.1. Nucleotide Triphosphate (GTP, ATP, CTP, UTP) Mediated Semiconducting Nanostructures 4.1.2. Nucleotide Monophosphate (GMP, AMP, UMP, CMP) Mediated Semiconducting Nanostructures 4.2. Nucleotide-Templated Metals: NucleotideTemplated Au Nanostructures

7044 7045 7045 7046 7046 7047 7047 7047 7047 7053 7060

7066 7066 7067 7068 7068 7068

7068

7070 7071 7071 7074 7075 7075 7075 7075 7076 7076

1. INTRODUCTION Nature is among the foremost architects for the design and synthesis of nanomaterials using biological components of nanoscale dimensions. Biological systems such as proteins, lipids, nucleic acids, antibodies, antigens, and enzymes, having nanodimensions of their different component(s),1−5 constitute the fundamental building blocks of natural systems. Diverse functionality and highly specific inter- and intramolecular noncovalent interactions among these building blocks are elegantly used by nature for the fabrication of various nanostructures and assemblies.5−7 Several natural materials and most of the organisms represent highly sophisticated hierarchical nanocomposites consisting of individual inorganic or organic components or a mixture of these materials, which are grown spontaneously using supramolecular interactions and self-assembly principles.8,9 A large number of biominerals such as teeth, shells, and bone, demonstrating functional utilities in human and animals, are among such nanocomposites exhibiting higher hierarchical

7060 7060 7060 7060 7062 7063 7063 7064 7064 7064

7065

7065 7066

Received: January 10, 2013 Published: June 4, 2014 © 2014 American Chemical Society

7044

dx.doi.org/10.1021/cr4007285 | Chem. Rev. 2014, 114, 7044−7078

Chemical Reviews

Review

structure with varied shape and functional specificity.10 Unlike bulk materials, the interfacing of organic and inorganic components at nanoscale levels also imparts them the varied physicochemical and mechanical properties as is observed in abalone shell, spider silk, and bone.11 These aspects have fascinated biologists and chemists to mimic such a bottom-up approach in the laboratory for the design/fabrication of new materials with varied morphology and tunable properties. Biopolymers, namely, nucleic acids, proteins, and polysaccharides, constitute the major bioorganic constituents of living things. Nucleic acids, being water-soluble, stable, and structurally diverse, allowing easy custom synthesis, and having various constituent units providing coordinating sites to interact with metal ions and fairly high flexibility due to rotation around bonds in the sugar−phosphate backbone, could serve as an interesting template for the fabrication of nanoscale assemblies.12 The polymers of nucleic acid are of two types deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) differing in their structure of the sugar and nucleotides. The sugar component is 2′-deoxyribose in DNA and 2′- ribose in RNA, and the nucleotides consist of the heterocyclic bases, the purines and pyrimidines. DNA contains four bases: substituted purines (adenine and guanine) and pyrimidines (cytosine and thymine) (Figure 1). Three of these bases (adenine, guanine, and cytosine) are common in RNA, but thymine is replaced by uracil. Furthermore, RNA is composed of smaller subunits of nucleotide monomers. Among the above biopolymers, DNA encodes organism hereditary information controlling the growth and division of cells. The genetic information stored in DNA is transcribed into RNA, which is eventually translated for the synthesis of proteins needed for cellular functions. In DNA two nucleotide nanowires are twisted around each other with a replicate unit every 3.4 nm with a diameter of 2 nm.13 The RNA in its “A” form helix consists of replicate units every 2.9 nm with a diameter of 2.6 nm.14,15 In this unit t-RNA, which is essential for protein synthesis, exhibits well-defined three-dimensional secondary and tertiary structures with an average size of about 5 nm. The biological organisms in the living system assemble the molecular building blocks of these biopolymers into organized nanostructures called nanoscale machines. Thus, DNA and RNA have long-range hierarchical order, large functionalities, and nanodimensions, making them attractive templates and scaffolds for integration with nanosized inorganics such as semiconductors and metals for designing new synthetic nanomaterials. 1.1. Nanosized Semiconductors and Metals: Their Synthetic Protocols

Figure 1. Structures of nucleic acids (DNA and RNA), ribonucleotides (AMP, GMP, CMP, and UMP), and nucleobases (A, G, C, T, and U).

Semiconductor nanoparticles (NPs) have attracted a great amount of interest for more than last two decades because of their multidisciplinary applications in the areas of solar energy conversion,16−18 sensing,19−21 optics,22,23 electronics,24−27 photonics,1,28−31 magnetism,32−35 and biomedicine.36−38 The most fascinating observations about these materials are their size- and shape-dependent novel properties, such as optical, electronic, photochemical, and magnetic, which have demonstrated tremendous potential in the above-mentioned areas.16−38 Metal nanoparticles (MNPs), having dimensions approaching the Fermi wavelength of electrons, also exhibit discrete electronic transitions and display unique optical and electrical

properties.39−45 A distinctive feature of MNPs is their characteristic localized surface plasmon resonance (LSPR) band, which largely governs their physicochemical properties. Precise control of the SPR band and its intensity can be manipulated by a change in the size, shape, dimensionality, and arrangement of the MNPs and the refractive index of the medium. Owing to these characteristics, MNPs are finding wide-ranging applications from biosensing to small-molecule detection, optical data storage, and in vivo tissue imaging.46−49 1.1.1. Physicochemical Methods. In the literature a large number of techniques comprising both physical and chemical methods have been employed for the synthesis of semi7045


Chemical Reviews

Review

conductor and metal nanostructures.50−58 The applications of physical methods, however, remains limited, as quite often the nanomaterial(s) thus produced remain attached to the matrix and may not allow their bulk preparation.59 Chemical methods, including chemical precipitation and sol−gel, solvothermal, microwave, photochemical, and radiolysis techniques, have been used more extensively. Synthesis of colloids using wet chemistry has provided an interesting methodology to grow different nanostructures in solution using the bottom-up approach, which provides greater flexibility and reproducibility for their synthesis with tunable properties. Excellent reviews on a number of colloidal approaches have been contributed from the groups of Henglein,56 M. A. ElSayed,57 and Alivisatos.58 Moreover, they offer convenient means for nanofabrication of integrated materials for applications in the areas of catalysis, light-emitting diodes (LEDs), solar cells, lasers, photodetectors, sensors, biology, and medicine.57−61 For the preparation of colloidal materials of II−VI and IV− VI semiconductors, the commonly used method is chemical precipitation. It is performed either in the presence of a suitable stabilizer(s) or employing an organized medium such as Langmuir−Blodgett films, polymers, surfactants, micelles, vesicles, and glasses, which not only allow control of the size of the colloidal materials but also improve upon their characteristic properties, such as solubility, optical, and magnetic properties. Another popular synthetic route, utilizing the pyrolysis of organometallic precursors by injecting them into the hot coordinating solvent, for their preparation with narrow size distribution was developed by Murray et al.62 For the preparation of colloidal metal oxides, hydrolysis of metal salts in the absence and presence of surfactants, hydrothermal and sol−gel methods are generally employed.51,54 Colloidal MNPs of different sizes and shapes have been synthesized largely by the chemical reduction of metal salts in an aqueous or organic medium employing a number of reducing agents such as citric acid, sodium borohydride, hydrazine, ascorbic acid, poly(ethylene glycol), and formaldehyde/sugars.51,52,55,57,63,64 Some other popular reducing agents which serve binary functions as both reducing and stabilizing agents used for the preparation of MNPs are poly(vinylpyrrolidone) (PVP) and ethylene glycol.63,64 In the absence of a suitable stabilizer(s), the colloidal nanostructures either grow at the expense of smaller particles to gain thermodynamic stability through Ostwald ripening or undergo aggregation to reduce their surface free energy. In the absence of any functionality of the capping agent, the above methods though lack control of the architecture and programmability of the synthesized nanosystems. 1.1.2. Inorganic Templates. In recent years several novel metal−organic frameworks (MOFs) comprising mainly transition-metal ions (Cu2+, Zn2+, Co2+, and Mn2+) and organic ligands (bidentate and tridentate carboxylic acids, squaric acid) and zeolites have drawn considerable attention as templates for generating NPs within their cavities or by encapsulation of the presynthesized NPs in their framework.65−68 This allows simultaneous observation of the properties of NPs and that originating from the framework materials.65,66 These templates though provide tunable pore size and a rigid frame for the growth of nanomaterials, but due to their nonmanipulative microenvironment they restrict the reorganization of the nanomaterials to form self-assemblies and limit their use for

controlling the shape, size, and three-dimensional distributions of growing NPs within the templates.69 The colloidal nanocrystals with a large solid/liquid interface are quite vulnerable to the surrounding chemical environment. The presence of a large number of unsaturated atomic species and dangling bonds on their surface make their surface reactive and highly sensitive to their surroundings.53,58,69−71 Therefore, the treatment of the surface of the colloids through surface passivation makes it feasible to produce new materials with enormous flexibility, reproducibility, and enhanced properties. 1.1.3. Organic and Bioorganic Templates. Recently, the interfacing of quantized colloidal nanomaterials with organics/ bioorganics as templates has emerged as a challenging area of research to generate new materials with controlled dimensions and morphology. The ligation prevents their aggregation by reducing their surface energy besides reducing their size and inducing new transitions to display different physicochemical properties. Unlike inorganic templates, specific interaction(s) between the functional group(s) of organic/bioorganic ligand(s) with metal ion centers may provide a tool to assemble their 1D, 2D, and 3D nanoarchitectures.72,73 Specifically, the synthesis of metal/semiconductor nanohybrids consisting of an inorganic core coated by an organic/ bioorganic shell having the same dimensions might be exploited to enhance the physicochemical properties of the core.53,59,70,74 The functionalization of the inorganic core has been achieved through a variety of interactions, such as electrostatic adsorption by anionic ligands or positively charged functional groups and chemisorption, and by specific interactions such as affinity binding of biomolecules.57,58 In this synthesis the functionality of the organic shell due to its differing interaction with the core would play a key role in determining the size and shape of the nanohybrids. A variety of biocompatible organics, such as dendrimers75 and thiols,76,77 and biological molecules have been used as matrix or capping agents to synthesize metal chalcogenides/metal oxides,78−81 MNPs,82 and metal/semiconductor nanocomposites.83 These investigations have added a new dimension to NP research with respect to their biological applications.84 Although different templates have their specific uses in regard to stabilization and precise control of the architecture of nanocrystallites, capping by nucleic acids provides greater programmable capability due to their characteristic structural features and molecular recognition properties. 1.1.3.1. Nucleic Acid-Mediated Nanostructures. Nucleic acids with long-range nanoscale order can control the nucleation and growth of nanocolloids effectively by binding of metals/metal ions or the metals of semiconductors to the specific sites of biomolecules.6,7,84−90 These materials will not only provide chemical functionality for integration but also make it possible to modify and manipulate the structure, morphology, and properties of the biomolecules conveniently through reorganization and self-assembly. Besides this, the capping of the inorganic core by bioorganics may impart them several additional features, such as enhanced solubility and surface properties. The synthesis of functional nanomaterials requires judicious consideration and applications of these features for designing the building blocks and converting them further into multicomponent systems with an appropriate potential gradient and synergic effect to achieve the effective charge separation and enhanced optoelectronic properties. A systematic organization of metal/semiconductor nanostructures is drawing considerable attention because of their potential 7046


Chemical Reviews

Review

nanotubes. The circular DNA was modified with amine and thiol functionalities, the modified DNA was then reacted with bismaleimide-functionalized nucleic acid to yield circular DNAbridged long nanowires with an average height of about 0.6 nm, indicating they contain single-stranded DNA (Scheme 1).

applications for the fabrication of new materials required for advanced technology (vide ut supra). The colloidal nanocrystals of semiconductors and metals offer attractive and promising building blocks for the fabrication of advanced materials. For the preparation of nucleic acid-templated nanostructures, the wet chemical precipitation and reduction method(s) have largely been adopted. In general, two types of protocols have been used. In the first approach, metal ions bound supramolecularly to different functionalities of the template are converted chemically to yield the desired nanostructures.2,85 More specifically, metal cations at physiological pH or pH > 7 initially bind the nucleic acid scaffold through the phosphate backbone and the functionalities of the nucleotides. In the case of semiconductors, their subsequent reaction(s) with the reagents furnishing sulfide/selenide/telluride ions then initiates the nucleation of the respective semiconducting NPs. For the synthesis of oxides, generally hydrolysis of metal ions coordinated to the nucleic acid or its components forms the respective capped metal oxides. These small clusters tend to aggregate in the growth process, which is prevented by the capping with the nucleic acid and its components. For the synthesis of metallic nanostructures, metal ion-bound templates/scaffolds are reduced chemically or photochemically (as discussed in section 1.1.1). In another method, presynthesized nanostructures with similar dimensions and structural compatibility with biomolecular templates are interacted to form nanohybrids by exploring their supramolecular interactions.2 These methods avoid extensive heat and radiation, which cause degradation/denaturation of the nucleic acids. The present review outlines the recent status of the synthesis of nanohybrids/nanostructures of semiconductors and metals templated by nucleic acids (DNA and RNA) and their components using mainly the wet/colloidal approach. It also highlights changes in their optical, electronic, magnetic, and electrical properties based on their morphology and selfassembly and envisages their potential for the synthesis of advanced materials for technological applications.

Scheme 1. Synthesis of Covalently Linked DNA Nanotubes through the One-Step Cross-Linking of Tetraaminated Circular DNAsa

a

Reprinted from ref 105. Copyright 2010 American Chemical Society.

These wires could be subsequently cross-linked by bisthiolated nucleic acid to yield fairly stable DNA nanotubes. In an alternative approach, circular DNA consisting of four amines functionalized on its pole upon cross-linking with bisthiolated nucleic acid also yields nanotubes.

2. DNA-BASED NANOARCHITECTURES DNA-mediated assemblies of NPs have attracted a large amount of attention for the organization of both metallic and semiconducting NPs to yield well-defined 1D, 2D, and 3D nanoarchitectures with control of their geometry and functionalities.91,92 In several nanotechnological applications of DNA-linked materials, their hybridization has mainly been exploited. Self-assembly of such integrated materials may lead to the fabrication of new nanostructures with controlled dimensions and tunable properties for applications in devices.93−99

2.2. DNA-Templated Inorganic Nanostructures

DNA due to its stability, mechanical rigidity, nanodimensions of the repeating unit, manipulative length, selective interaction of single strands, and multifunctionality is extremely suited to nanotechnological manipulation.106,107 Its remarkable molecular recognition properties, complementary base-pairing, and structural features further make it appropriate as a programmable “smart” building block for the construction of organized materials by interfacing with the synthetic inorganic colloidal materials. In several nanotechnological applications of DNAlinked materials, their hybridization has been exploited for making nanohybrids/assemblies. Self-assembly of such integrated materials may lead to the fabrication of new nanostructures with controlled dimensions and tunable properties for applications in bionanoelectronics and computingrelated devices.101,108,109 The possibility of manipulating the DNA-templated nanostructures mainly takes place through the negative charge on its phosphate backbone and multifunctionality through four nucleobases, which may allow its interaction with metals/metal ions. 2.2.1. DNA-Templated Semiconductor Nanostructures. DNA-mediated growth of semiconductors generally

2.1. Nanostrucures of DNA

Because of the importance of DNA as an important biotemplate, a variety of nanostructures of different DNA strands alone have been synthesized by using DNA origami technology, developed by Paul Rothemund.100 The DNA origami structures have been successfully used as programmed templates for the assembly of NPs, small molecules, and proteins, in single-molecule analysis, and as containers for delivery of small to large molecules such as proteins.101−104 Apart from the well-established origami technology, Wilner et al.105 have developed a chemical approach by using circular DNA as a building block for the construction of DNA 7047


Chemical Reviews

Review

luminescence behavior was observed for Q-CdS stabilized by poly(adenylic acid) and poly(uridylic acid) in terms of pressure-induced changes in the luminescence. The coating of the surface of each type of Q-CdS with Cd(OH)2 resulted in a leveling effect whereby only a steady decrease in emission intensity was observed for each of these systems. A model involving pressure-induced perturbation of anionic sulfur hole traps at the CdS surface is suggested to explain these findings (Scheme 2).113

makes use of the bottom-up approach. A number of methodologies have been tried to enhance the physicochemical properties of different semiconductors using various DNA sequences.110−114 Some of these studies based on templating of the fluorescing quantum dots by different DNA sequences and their modified analogues have been discussed and may find applications in medicine, sensing, and imaging. 2.2.1.1. DNA−CdS/PbS/CdSe/CdTe. DNA−CdS. Coffer et al.78,110−113 in their pioneering work for the first time demonstrated that calf thymus (CT) DNA could be used as an effective stabilizer for the synthesis of CdS NPs.110 The adenosine-containing polynucleotide was observed to be unique in generating small CdS clusters of average diameter of about 35 Å and the corresponding 520 nm peak maximum in their steady-state fluorescence spectrum. CdS particles, stabilized by poly[C], poly[C]·poly[G], poly[U], and poly[G], exhibit prominent photoluminescence (PL) maxima at 590, 605, 630, and 640 nm, respectively, indicating the structural influence of the polynucleotide on cluster formation (Figure 2).

Scheme 2. Cartoon Representation of the Possible Modes of Interaction of Anionic Surface Sulfide Sites of Nonpassivated Q-CdS with Amino Moieties of the Pyrimidine Bases of Poly[A]a

a


Coffer et al.114a for the first time demonstrated the use of circular plasmid DNA, anchored to the derivatized substrate (polylysine-coated glass slide) for templating of CdS to produce the Q-CdS nanostructure assembly. They also pointed out the application of this method for producing the diverse range of semiconductor nanostructures by employing plasmids of varied size, shape, and composition. Gao and Ma114b have demonstrated the application of DNA plasmid-templated luminescing CdS NPs as a facile strategy for gene delivery. The synthesis of a CdS nanoparticle on the DNA template was carried out in five consecutive precipitations for complete shielding of the negative charge on the backbone on plasmid DNA (Scheme 3). The concentrations of CdS nanocrystals (NCs) employed in this work were 4 and 15 nM, which were fairly low to cause severe cytotoxicity compared to the previously reported 70−200 nM concentrations, which were even reported to be nontoxic to a variety of cell lines. The growth of quantized nanosized semiconductors in low dimensionality, specifically nanowire-, nanorod-, and nanotubelike morphologies, could be explored for wide-ranging applications in the areas of nanoelectronics/nanocircuitry, optoelectronics, fluorescence imaging, drug delivery, and sensing.115−117 Dong et al.118 reported a DNA-templated chain of NPs with an average size of NPs of 14.2 nm ± 10% but decreasing to 12.0 nm ± 0.67% upon standing. These onedimensional structures exhibited emission maxima at 540 nm in a thin film and at 520 nm in solution and upon integration with a simple two-terminal electrical device bridging about a 7 μm gap demonstrated charge transport (Figure 3). The photo-

Figure 2. Absorption and photoluminescence spectra of nonactivated and activated Q-CdS stabilized by (a) CT DNA, (b) poly[A], (c) poly[A,U], and (d) poly[U]. Reprinted from ref 113. Copyright 1999 American Chemical Society.

Thermolysis of Q-CdS (Q = quantized) stabilized by the polynucleotide results in an increase in the particle size associated with a shift in the photoluminescence maximum, and the extent of the shift was found to be nucleotide dependent. The photoluminescence spectrum of Q-CdS−DNA exhibits broad trap emission ranging from 480 to 720 nm with a maximum at 620 nm. This emission has been attributed to the sulfur vacancies.78 An interaction between Cd(OH)2-layered QCdS and the polynucleotide has been examined by using emission spectroscopy. The addition of either of the polynucleotides, Escherichia coli DNA or poly[A], quenches the emission of these particles. The observed quenching fits into a Perrin-type model.112 A marked difference in the 7048


Chemical Reviews

Review

Scheme 3. Schematic Illustration of DNA Plasmid-Templated CdS NC Growtha

a

Key: (a) CdS NC growth along the DNA plasmid induced DNA packing and GSH-mediated DNA unpacking, (b) schematic illustration of the double-stranded DNA−CdS NC hybrid nanostructure, (c) electrostatic interaction between the phosphate backbone and surface Cd2+ ions. Reprinted from ref 114b. Copyright 2012 American Chemical Society.

luminescent image of this device exhibited bright emission in the region of the nanowires, confirming that the CdS nanowires are coated with λ-DNA strands.

Figure 3. Luminescence image of the device illustrating the emission of the CdS nanowire. Scale bar = 20 μm. Reprinted with permission from ref 118. Copyright 2007 Wiley.

In another approach, the fabrication of a CdS wire on a DNA scaffold (average length ∼3−4 μm and diameter ∼40−50 nm) from salmon testes adopted the photochemical route exhibiting an excitonic band at about 350 nm.119 The wires were found to be electrically conducting, and the ohmic resistance for the linear fit was calculated to be 742 Ω, thus demonstrating their application as a tool for electronic devices (Figure 4). From the same laboratory the synthesis of λ-phase DNA (48500 bp) templated CdS nanowires of 8−12 μm length and 140−170 nm average diameter using microwave irradiation has been reported.120 These nanowires were observed to be fairly stable for more than three months, retaining their optical properties (Figure 5), and also exhibited a linear ohmic behavior, from which their resistance was calculated to be 115.78 Ω. DNA−PbS. Patel et al.121 reported the synthesis of DNAtemplated PbS quantum dots (QDs) with a fairly well-defined

Figure 4. (A) Field emission scanning electron microscopy (FE-SEM) image of a single DNA−CdS nanowire stretched across a 20 μm gap on a Si chip. The inset shows the corresponding higher magnification image. (B) Current−voltage characteristics of a single DNA−CdS bridge spanning from electrode to electrode as shown in part A. According to the linear fit of the experimental data, the ohmic resistance of the single bridge has a value of 742 Ω. (C) I−V characteristics of three different nanowires showing good reproducibility of the experiments. Reprinted with permission from ref 119. Copyright 2008 Wiley.

absorption band at 538 nm having an average size between 4 and 6 nm with no detectable fluorescence at room temperature. In a subsequent work, Levina et al.122 reported the synthesis of 7049


Chemical Reviews

Review

nanorods (length exceeding 1 μm and diameter ∼100 nm) and negatively charged phosphate groups of DNA.123 The selforganized complexes of CdSe nanorods and DNA were observed to have filamentary, netlike, or spheroidal morphology upon incubation for 7 min. These filaments were found to possess strong linearly polarized photoluminescence due to the unidirectional orientation of the nanorods. DNA−CdTe. The synthesis of chimeric DNA-functionalized CdTe results in the formation of nanocrystals having excitonic absorption at 520 nm and emission in the visible range (λemmax = 560 nm) with a fairly high quantum yield of emission (17%) and fwhm of 50 nm (Figure 6).124 The hydrodynamic size of these nanocrystals was estimated by gel filtration chromatography. Phosphorothioate−phosphate-modified CdTe is produced in the size range of 6−6.5 nm, whereas glutathionemodified particles have a diameter ranging from 4.3 to 4.5 nm. These nanocrystals exhibit highly specific binding to nucleic acids, proteins, and cell targets. Having a small hydrodynamic diameter, these particles could find applications in bioimaging, but their toxicity observed in recent years raises concerns about their physiological applications.125 In recent years several sensors based on QDs and dye-labeled biomolecules have been developed. The detection of DNA hybridization based on fluorescence resonance energy transfer (FRET) between blue luminescent CdTe QDs and cyanine 3 (Cy3) labeled ssDNA (ss = single-stranded) and dsDNA (ds = double-stranded) has been reported.126 In this system Cy3− DNA acts as an acceptor, the cationic polymer acts as an electrostatic linker, thus causing an FRET from the QD donor to the dye acceptor (Scheme 4). The differential interaction of ssDNA and dsDNA with CdTe+ results in differential changes in the FRET efficiency, which has been used to recognize the hybridization (Figure 7). Core−shell fluorescent semiconducting nanosystems have been studied widely because of their high quantum yield and photostability at room temperature, making them useful for biological applications such as biological labeling, imaging, and detection as fluorescent materials.60,127 Some of the DNAtethered core−shell CdSe@ZnS systems used for sensing and FRETs are discussed below.

Figure 5. UV−vis absorption spectra of a DNA−CdS nanowire at different stages of synthesis: (A) DNA strand itself in water, (B) DNA−Cd2+ complex, and (C) mixture of DNA, Cd salt, and t-NH2 after microwave irradiation for 60 s. The absorption band at 340−420 nm corresponds to the excitonic peak of the CdS nanowire. Reprinted from ref 120. Copyright 2009 American Chemical Society.

efficient infrared-emitting QDs grown on a DNA template in solution. These particles are produced with face-centered cubic (fcc) structure having an average size of about 4 nm and exhibit a featureless electronic spectrum having an absorption threshold in the NIR region. Under 830 nm irradiation these particles show a strong band edge luminescence peaking at 1100 nm with a fluorescence quantum efficiency of 11.5%. The solid thin film prepared by the deposition of these DNA-grown NPs exhibited a photoluminescence quantum efficiency of 8 ± 1% compared to PbS NPs grown by the organometallic route, which exhibited a much reduced quantum efficiency of luminescence of 0.5−1.5%. DNA−CdSe. DNA molecules have also been used as building blocks for templating of CdSe by exploiting its recognition capability, tunable sequence, and length. This has been carried out by depositing a colloidal aqueous solution of cationic CdSe nanorods on a planar DNA−PVPy-20 (poly(4-vinylpyridine)) complex by short incubation of DNA−PVPy-20. This resulted in the formation of a highly luminescent DNA−CdSe nanorod complex via electrostatic interaction between cationic CdSe

Figure 6. DNA-functionalized CdTe nanocrystals: (a) emission spectrum and absorption spectrum (inset) of DNA-functionalized CdTe QDs, (b) sizing of ps−po DNA and all po DNA-passivated CdTe QDs using gel filtration chromatography. ps−po: (5'TCCGCTGCAGAAAAAT*C*G*G*G*C*G*T*A*C3' (* indicates phosphorothioate linkage); po: 5'TCCGCTGCAGAAAAATCGGGCGTAC3'. Reprinted with permission from ref 124. Copyright 2010 Nature Publishing Group. 7050


Chemical Reviews

Review

Scheme 4. Principle of DNA Detection Based on QD/Cy3Labeled DNA FRETa

a


Figure 8. Detection of target DNA with QD−DNA (p25) complexes. (A) QD PL spectra: (a) initial QD PL without TAMRA-labeled DNA, (b) QD PL quenched on complexation with TAMRA-modified DNA, (c) significant recovery of QD fluorescence at 530 nm was observed after hybridization with complementary DNA (DNA/QD molar ratio of 5), (d) weak recovery of QD fluorescence was observed with noncomplementary DNA. (B) Photograph of the corresponding QD− DNA complexes illuminated with a UV lamp (340 nm). The concentrations of QD and target DNA are 100 nM and 5 μM in phosphate-buffered saline (1× PBS, pH 7.2), respectively. Reprinted with permission from ref 128. Copyright 2009 Wiley.

Figure 7. Normalized spectra of (a) emission of CdTe+ excited at 360 nm, (b) absorption of Cy3−DNA, (c) emission of Cy3−DNA excited at 488 nm, and (d) emission of CdTe+/Cy3−DNA excited at 360 nm. All spectra were recorded in saline−sodium citrate (SSC) buffer. Reprinted from ref 126. Copyright 2007 American Chemical Society.

is defined as a “False” output, or “0”. In the presence of the two inputs, Ag+ and Hg2+ ions, fluorescence quenching of luminescence at both emissions is defined as a “True” output, or “1” (Figure 9). The “OR” gate was designed by

2.2.1.2. DNA−CdSe/ZnS. Lee et al.128 have prepared stable cationic DNA−CdSe@ZnS complexes using electrostatic interaction between poly(ethylene glycol) (PEG5000) conjugated amine-functionalized CdSe@ZnS QDs and DNA. PEG conjugation leads to enhanced stability, increased solubility, and reduced nonspecific adsorption of DNA on the surface of the QDs. The hydrodynamic size of the QD−DNA (1:1) complex was estimated to be 16.5 ± 1 nm, which is increased to 20 ± 1.8 nm for the 1:5 complexes. The fluorescence of these QDs was quenched up to 90% on complexation with carboxytetramethylrhodamine (5′-TAMRA) modified oligonucleotide through FRET (Figure 8). The quenching of fluorescence could be reversed by binding of unlabeled DNA, which allowed the complementary target to be detected selectively. Its detection capability for pathogenics, specifically the synthetic 100-mer oligonucleotide derived from H5N1 influenza virus, is at 200 nM in the solution. Freeman et al.129 synthesized CdSe@ZnS (d = 3.8 nm)/ CdSe@ZnS (d = 5.8 nm) QDs modified with thymine (T) rich nucleic acid (1)/cytosine (C) rich nucleic acid (2), respectively, using bis(sulfosuccinimidyl) suberate (BS3) as a bifunctional coupling reagent. T-rich- or C-rich-nucleic acid-modified QDs having λem = 560 nm and λem = 620 nm, respectively, were found to be selective for the analysis of Hg2+ or Ag+ ions using an electron-transfer-quenching path by monitoring the quenching of luminescence. The detection limits for analyzing Hg2+ and Ag+ were found to be 2 and 200 ppb, respectively. Besides, using them as optical transducers for sensing, these QDs have also been employed as optical labels to follow logic gate operations using Hg2+ and Ag+ as inputs. The mixture of the two QDs yielded an “AND” gate upon interaction with Ag+ and Hg2+ ions as inputs. Fluorescence quenching of the luminescence of the system at either λ = 560 nm or λ = 620 nm

Figure 9. Time-dependent fluorescence changes of the AND logic gate system depicted in Scheme 2 and activated by the following inputs: (a) no Hg2+, no Ag+ (0, 0); (b) no Hg2+, 30 μM Ag+ (0, 1); (c) no Ag+, 30 μM Hg2+ (1, 0); (d) 30 μM Hg2+, 30 μM Ag+ (1, 1). Inset: truth table of the AND gate logic system. Reprinted with permission from ref 129. Copyright 2009 Wiley.

functionalization of these QDs with either nucleic acid 1 or nucleic acid 2. In this case the quenching of luminescence by either Hg2+ or Ag+ provided the OR logic gate. Recenly, Wang et al.130 have achieved QD−DNA bioconjugation in a one-step reaction using DNA oligomers with a single thiol modification for the conjugation. They have synthesized CdSe/ZnS core−shell QDs by surface capping with two capture strands, strand 1 with 34 bases (C1) and strand 2 with 27 bases (C2). The CdSe core particles with C1 and C2 strands are fairly monodisperse with sizes of 4.9 ± 0.2 and 6.9 ± 0.3 nm and exhibit emission peaks at 548 and 670 nm, respectively (Figure 10). After the formation of the ZnS shell, the quantum yield (QY) of emission due to these particles is significantly increased from 8.6% to 41.3% for a 7051


Chemical Reviews

Review

Scheme 5. DNA/Peptide Sequences and Peptide−DNA Chemoselective Ligationa

Figure 10. (a) One-step in situ DNA functionalization of CdSe@ZnS core−shell QDs. (b) PL spectra of CdSe core QDs and the DNAcapped CdSe@ZnS core−shell QDs. Both the green and red QDs show a significant increase of the QY after growth of the ZnS shell and DNA capping simultaneously. The intensities were normalized by green CdSe@ZnS core−shell QDs. (c, d) TEM images of green and red core−shell QDs, respectively. Higher magnification images of individual dots are shown in the insets. Reprinted with permission from ref 130. Copyright 2008 Wiley.

Key: (1) The terminal amine group on the “backbone” DNA is activated to a formylbenzoic acid and chemoselectively ligated to an HYNIC-modified (His)6-peptide sequence. Individual dye-labeled DNA strands are (2) hybridized to their complementary sequence on the (His)6-modified DNA backbone and (3) self-assembled to the QDs via metal-affinity coordination. The resulting structure consists of a central QD with multiple, rigid dye-labeled DNAs centrosymmetrically arrayed on its surface as designated by the QD1:DNAn ratio. UV excitation of the system results in an energy transfer cascade from the central QD through the sequential aligned dye acceptors which emit from the visible to the near-IR portion of the spectrum. 1−4 indicate sequential dyes and are used to indicate the dye position relative to the QD in subsequent experiments. Reprinted from ref 131. Copyright 2010 American Chemical Society. a

green QD (G-QD-C1) and from 4.4% to 21.7% for a red QD (R-QD-C2) due to the passivation of the core. The surface capping by ZnS enhanced the water solubility of these particles significantly. To examine the FRET from QDs to fluorescent dyes, Cy3 and Cy5 having good spectral overlap with green and red QDs, respectively, the dyes were conjugated with the 3′ end of DNA reporter strands R1 and R2, which were complementary to the C1 and C2 capture strands. Green QDs were hybridized to reporter strands R1 and R3 to yield G-QD-C1-R1 (11.2 nm) and G-QD-C1-R3 (7.5 nm), respectively. In these strands Cy3 is present at the 3′ and 5′ ends, respectively, of R1 and R3, and the FRET in this hybridized system was observed to increase with decreasing donor−acceptor distance in line with the Förster equation. For G-QD-C1-R3, the FRET efficiency was observed to increase drastically from 66% to 95%. This thus indicates it to arise from the sequence-specific binding of DNA strands on the surface of the QDs. Boeneman et al.131 have reported CdSe@ZnS core−shell QD-sensitized DNA-mediated photonic nanowires employing the self-assembly approach based on polyhistidine-driven coordination to metal ions. The primary amine on the backbone DNA was modified to an aldehyde and then was covalently coupled to 2-hydrazinonicotinoyl (HYNIC) modified (His)6-peptide using aniline-catalyzed chemoselective ligation. The different dye-labeled strands were then hybridized to their complementary sequence on the (His)6-peptidemodified DNA backbone and ratiometrically self-assembled to QDs to produce QD−DNA photonic nanowires with varied photophysical capabilities. DNA fragments prelabeled with different dye acceptors such as Cy3, Cy5, Cy5/Cy5.5, and Cy5/ Cy7 were hybridized to a complementary DNA template as shown in Scheme 5.

These labeled dye acceptors were then excited by the CdSe@ ZnS core−shell QDs via FRET. The efficiencies of QD−Cy3 and QD−Cy3−Cy5 were found to be 65% and 18%, respectively. The average fluorescence lifetimes of dye−DNA when hybridized in different positions (shown in italics), QD− Cy3, QD−Cy3−Cy5, QD−Cy3−Cy5, and QD−Cy3−Cy5− Cy5.5, were observed to be 4.70, 3.84, 4.08, and 2.85 ns, respectively. These lifetimes were much higher compared to those of the individual dyes Cy3 and Cy5, which were found to be the same, 1.33 ns. Such nanowire formation has been suggested to have potential for the fabrication of a nanosystem for harvesting light in the UV range and obtaining emission in the visible and NIR ranges. Integration of such a DNA-based photonic structure with QDs could help in the generation of a biophotonic wire assembly with potential in nanotechnology. CdSe@ZnS core−shell QDs stabilized by mercaptopropionic acid (MPA) produced water-soluble highly luminescent QDs with a diameter of about 3 nm.132 These QDs and Au electrode were bridged through the mercapto (−SH) and amino (−NH2) ends of i-motif DNA molecules. Electron transfer from the photoexcited QDs to the Au electrode is modulated by a motor DNA conformation change, which is driven by a change in the pH of the electrolyte. By changing the pH from 8 to 5, motor 7052


Chemical Reviews

Review

DNA molecules folded from the stretched state to the quadruplex i-motif structure, which shortened the distance between the QDs and the Au electrode to 3 nm from 10 nm (Scheme 6). The dynamic response of switching the photoScheme 6. Scheme of the QD−Motor DNA−Au Conjugated Electrodea

a

Not to scale. The electron transfer process from the photoexcited QDs to the Au electrode is modulated by the motor DNA’s conformation change, which is driven by changing the pH value of the electrolyte. Reprinted with permission from ref 132. Copyright 2009 Royal Society of Chemistry.

current of the motor is understood by the tunneling of the photoexcited electron from the QDs to the Au electrode. The rate of electron transfer is found to be inversely proportional to the distance between the donor and acceptor and is considered to have occurred by a change in pH. On this basis, a dynamic pH-driven modulation system of photoelectric conversion has been realized. FRET and fluorescence enhancement studies indicate that the detection limit and sensitivity of these nanohybrids for different target DNAs or other metal ions do not show any specific correlation with the number of base pairs. They are likely to depend upon the nature and charge carrier dynamics of the metal/semiconducting QDs. 2.2.1.3. DNA−Iron Oxides: Magnetic Properties. Byrne et al.133 have synthesized largely denatured herring sperm DNA (present substantially as single-stranded DNA) templated Fe3O4 nanowires in an aqueous suspension. A marked difference in the morphological alignment between duplex DNA (entangled chains) and denatured DNA (randomly distributed chains) has been attributed to the efficient binding of the magnetic NPs through the phosphate backbone in the latter case. This creates a long-range-ordered chain with an increased number of magnetic NPs along the chain. These nanowires exhibit remarkably high relaxivity at low field and have been suggested to have a potential application in MRI. In regard to the contribution of the phosphate binding to the observed behavior, it may be added that the simple polyphosphates, having a negatively charged monomer unit (PO3−), would also stabilize iron oxide nanostructures by binding to the surface iron (Fe2+/Fe3+) through an ionic bond and may influence their magnetic properties due to a change in spin. However, unlike biopolymers, they are not expected to produce varied nanoarchitectures such as a long-range-ordered/ organized chainlike morphology to demonstrate the enhanced magnetic behavior. Kinsella and Ivanisevic134,135 reported the synthesis of DNA-templated magnetic nanowires with Fe2O3 (average height 4.1 ± 0.9 nm) and CoFe2O3 (3.4 ± 0.8 nm) NPs by exploiting the electrostatic interaction between positively charged NPs and the negatively charged backbone of DNA. Both iron oxide and cobalt iron oxide were found to be superparamagnetic at room temperature, but at 10 K the cobalt iron oxide particles displayed weak ferromagnetic behavior (Figure 11). At 300 K CoFe2O3 exhibited a higher

Figure 11. SQUID (superconducting quantum interference device) magnetometry of the magnetic NPs at 300 and 10 K. (A) Iron oxide nanoparticles. The room-temperature data are plotted in blue and the data obtained at 10 K in red. (B) SQUID data of the cobalt iron oxide nanoparticles. Room-temperature data are shown in pink and data obtained at 10 K in blue. The inset in both plots shows an enlarged region at zero applied field. Reprinted from ref 135. Copyright 2007 American Chemical Society.

value of saturation magnetization, 89 emu/g, compared to 66 emu/g at 10 K. The magnetic force microscopy exhibited the DNA templated structures to be strongly magnetic at room temperature. 2.2.2. DNA-Templated Metal Nanosystems. DNAtemplated synthesis of metal nanostructures has been investigated extensively for a number of metals, such as silver,136 gold,137 platinum,138 palladium,139 cobalt,140 nickel,141 and copper.142 Most of these reports explored the formation of one-dimensional nanostructure-like nanowires because of their potential in the development of functional nanoelectronic, optoelectronic, and magnetic storage devices. Gold and silver in the form of salts and their compounds, and as nanoparticles have been used as therapeutic agents since medieval times for treating a variety of diseases.61,143 Nanostructures of Au and Ag have recently drawn great attention for their increased medical applications because of their inertness and biocompatibility.63,144−148 Although both Au and AgNPs have been considered largely to be nontoxic within a specific dose limit,146−148 several contradictory reports have appeared specifically on the toxicity aspects of Au and AgNPs.145,148a,149,150 In a biological system, NPs interact with the cellular components (nucleus, membrane, mitochondria) and may influence their overall functioning.148,150,151 Recent investiga7053


Chemical Reviews

Review

tions have indicated that the toxicity of metal NPs depends strongly on the chemical properties of the ligands/capping agent attached to their surface along with their size, shape, dose, and charge. An analysis of clinical data available on AuNPs indicates a peculiar correlation of toxicity with their size, shape, and biocompatible coating.145,146,149,152,153 For the same particle size, capping of NPs with certain biocompatible ligands has been found to have the least toxicity.152 In particular, DNA-functionalized Au nanostructures have been extensively explored for their various chemical and biological applications.136,154−174 In this area a large number of investigations have been carried out on the synthesis of nanohybrids with control of their morphology and analysis of their characteristic optical properties (surface plasmon absorption), melting temperature (Tm), and surface-enhanced Raman scattering. The organization of different noble NPs with control of their interparticle distance also remains a challenge for applications in nanotechnology. Because of their large functionality and biocompatibility, they are important for biomedical applications. 2.2.2.1. DNA−Au. Recently, a new DNA-encoding scheme for the precise controlled synthesis of Au−DNA nanomaterials of varied novel shapes has been reported.156 Different DNA sequences, such as oligo-dA30 (A30), oligo-dT30 (T30), oligodC30 (C30), or oligo-dG20 (G20), were added to a solution containing a gold nanoprism, hydroxylamine (NH2OH), and hydrogen tertrachloroaurate(III) (HAuCl4). The morphologies of the resulting NPs were found to be varied with different DNA sequences. The sequences A30, T30, C30, and G20 yielded round nanoplates with a rough surface, six-pointed nanostars, round plates with a smooth surface, and hexagonal nanoplates, respectively. These authors have found that the morphologies of the resulting nanostructures are independent of the lengths of the nucleotides, and therefore, it was concluded that it is the sequence and not the length of the DNA that dictates the morphologies of the NPs. Zhang et al.157 used a self-assembled 2D DNA nanogrid as a template consisting of short ssDNA oligonucleotides of an A15 base sequence, which hybridize with 5 nm gold NPs functionalized with an oligo-T15 sequence to yield a periodic square lattice. Each gold NP sits only on a single DNA tile in which the center-to-center interparticle spacing between neighboring particles could be controlled to nearly 38 nm in linear repeat and 25−27 nm in diagonal repeat, indicating the absence of a AuNP at the center of each possible square (Figure 12). This peculiar organization is understood to arise due to the strong electrostatic repulsion between highly negatively charged surfaces of nearby AuNPs. Such a system may be explored to generate more complex NP patterns through self-assembly, which may find applications in the fabrication of nanoelectronic and nanophotonic devices. Nanotubes of various 3D nanostructures have been designed by the modification of single-stranded DNA by gold NPs of different sizes, which provided 3D architectures of different shapes ranging from stacked rings to a single spiral, double spirals, and nested spirals with different distributions of the tube conformation.158 For AuNPs of 5 nm, stacked ring and single spiral tubes were observed to form at 55% and 45%, respectively, which changed to 92% and 7% for AuNPs of 10−15 nm size. By engineering the DNA tile structures, it could thus become possible to add different sizes and types of NPs inside or outside the tube, which may substantially advance the production of nanodevices.

Figure 12. (A, B) Comparison of the AFM images before and after gold NPs were assembled onto the DNA nanogrids. (C) Schematic drawing of the assembly representing the scenarios if all sites are occupied and the observed case. The expected distances are 25−27 nm (blue-to-blue-tile diagonal repeat) and 38 nm (blue-to-blue-tile linear repeat). Reprinted from ref 157. Copyright 2006 American Chemical Society.

The DNA-directed self-assembly of gold NPs into binary and ternary nanostructures has been performed using two strategies.159 In the first strategy, gold particles were functionalized with alkanethiol-capped ssDNA and then hybridization was carried out with complementary ssDNA-labeled NPs. In this approach, each Au nanoparticle may become attached to many such particles, thereby leading to extensive aggregation as shown in Figure 13 C. However, the second approach involved hybridization between complementary alkanethiol-capped oligonucleotides with dsDNA containing a thiol group attached at the end first followed by attachment of a AuNP to the scaffolding through a gold−sulfur bond to give a binary particle assembly (Figure 13 E). TEM and UV−vis studies suggest that the size of the assemblies did not change significantly upon modification with an oligonucleotide. By using a similar approach, AuNP trimers could also be synthesized. Kim and Lee160 described a simple method for the reversible assembly of DNA−Au nanoclusters in an aqueous medium using dithiothreitol (DTT) and monothiol DNA as stabilizers by exploiting the cross-linking of DTT with Au due to strong gold−sulfur bond formation. The hydrodynamic diameter of these particles could be easily controlled by adjusting the stoichiometry of DTT and DNA, and the solutions of the AuNP nanoclusters showed varied colors ranging from purple (42 nm) to violet (49 nm) and blue (115 nm) due to their surface plasmon resonance (SPR) (Figure 14). In the absence of DTT, the SPR of DNA−AuNPs alone exhibits a red color (∼520 nm) and indicates the hydrodynamic diameter is 35 nm. These nanoassemblies upon heating dehybridize in a highly cooperative manner, exhibiting an extremely sharp melting temperature. Above the melting temperature the color of the sample turned back to red (47 °C), purple (48.9 °C), violet 7054


Chemical Reviews

Review

Figure 13. (A) Illustration of strategy 1 to prepare binary assemblies. (B, C) TEM images of Au nanoparticle dimers synthesized by strategy 1. (D) Illustration of strategy 2 to prepare binary assemblies. (E) TEM images of Au nanoparticle dimers synthesized by strategy 2. Reprinted with permission from ref 159. Copyright 2007 IOP Publishing.

Different deoxynucleoside-modified AuNPs exhibit sequence-dependent stability and also a significant change in the surface plasmon band frequency and intensity. dA, dG, and dC caused the surface plasmon band due to the pure gold NPs to red shift from 520 to 650, 667, and 693 nm, respectively, whereas dT did not show any appreciable change in the intensity or the frequency of the absorption.161 Furthermore, the gold NP solution containing dA, dG, and dC precipitated out after 4 h, whereas neither gold NPs alone nor the dTcontaining AuNPs precipitated. The kinetics of the particle agglomeration indicated that the solution containing dC/dG agglomerated at the fastest rate followed by dA. These experiments demonstrate that the binding of a deoxynucleotide to the gold NPs follows the order dC/dG > dA > dT. This indicates that the interaction between the oligonucleotide and NP surface is detected by a nuclear surface plasmon, which affects the nucleotide surface coverage. This shows that gold nanoparticles functionalized with 5S(T)x (5S = 5' thiolmodified oligonucleotide) exhibit enhanced stability toward the electrolyte compared with NPs functionalized with the oligonucleotides 5S(A)x and 5S(C)x. Furthermore, an increase in the oligonucleotide length from 5 to 15 base pairs also enhanced the stability of gold NPs functionalized with 5S(T)x particles compared to those functionalized with 5S(A)x or 5S(C)x particles. The enhanced stability 5S(T)x found in the electrolyte has been explained due to an increase in the surface coverage, which increased the surface charge and steric stability. These nanosystems have been suggested to have significant importance in the designing of a DNA-modified gold probe for sensing purposes. In most of the study the detection of the target DNA sequence was achieved by the hybridization of the ssDNA with complementary ssDNA-functionalized AuNPs (GNPs). Krpetić et al.162 have reported a new concept for the direct detection of dsDNA using pyrole−imidazole polyamide (PA) functionalized gold NPs (Figure 15). The method works on the basis of the selective recognition of the dsDNA sequence by PAs; the latter

Figure 14. (A) Scheme depicting reversible assembly and disassembly of the DNA−AuNP cluster conjugates. (B) Normalized melting transitions of the assembled DNA−AuNPs (B1) and the assembled DNA−AuNP clusters with various sizes (B2, B3, B4). The insets show solutions of unhybridized DNA−AuNPs and DNA−AuNP clusters (U), hybridized DNA−AuNPs and DNA−AuNP clusters (H), and redehybridized DNA−AuNPs and DNA−AuNP clusters after the melting experiments (M) for red, purple, violet, and blue. The melting temperatures (Tm) and fwhm’s were determined by the first derivative of the melting transitions (see the insets). Reprinted from ref 160. Copyright 2009 American Chemical Society.

(46.9 °C), and blue (48.9 °C) depending on the size of the clusters. The reversible optical behavior suggested these clusters to be fairly stable after melting at high temperature (>60 °C). This method provides a quantitative measurement of the target DNA concentration from 1 to 50 nM with a detection limit of 1 nM. 7055


Chemical Reviews

Review

Figure 15. (a) Sequence of PA 1. (b) Scheme of PA 1- and ssDNA-functionalized GNPs and their subsequent aggregation upon addition of DNA matching sequences (oligodeoxynucleotides, ODNs). (c) Aggregation of the PA−GNPs in the presence of DNA-functionalized GNPs followed by UV−vis spectroscopy (scanning kinetics at 10 °C) upon addition of the fully matched target DNA sequence ODN1 over 120 min for 15 nm GNPs. Reprinted from ref 162. Copyright 2012 American Chemical Society.

conducting silver nanowire was developed by the reduction of silver ion on silver ion-exchanged DNA. This wire regained the lost fluorescence image due to the DNA skeleton, and the electric current is carried solely by the silver deposited on the DNA bridge (Figure 16). The recognition capabilities of DNA

induce the controlled aggregation of the ssDNA-functionalized GNPs in the presence of the target DNA. This aggregation was evidenced by TEM. For 15 nm GNPs, aggregation followed by UV−vis spectroscopy exhibited a less intense red-shifted SPR band due to AuNPs. This method could be utilized for the selective recognition of unique and biologically relevant dsDNA sequences. Xu et al.163 have investigated the stability of ssDNA−GNPs and citrate-protected GNPs against salt-induced aggregation using a ζ probe and UV−vis spectroscopy. ζ potential values for all the GNPs were negative, but these values were higher for all the ssDNA−GNPs compared to citrate-protected GNPs. A similar effect was noted on the values of the ζ potential upon increasing the length of the oligonucleotide. In UV−vis spectroscopy the addition of NaCl to GNPs caused their aggregation as could be observed by a red-shifted plasmon band of absorption due to Au and by a change in the color from yellow-red to blue at all concentrations ≥50 mM NaCl, whereas for dGNP and dG6−GNPs and dG12−GNPs the red shift and change in the color could be observed only at concentrations ≥400 mM NaCl. The higher salt tolerance of ssDNA−GNPs suggested their better stability and biological utilization without any further stabilization. Fluorescence measurement was carried out to explain the presence of ssDNA on the surface of goldfunctionalized DNA NPs. By employing fluorophore-labeled oligonucleotides, the intensity of 5- carboxyfluoroscein (FAM) labeled DNA was observed to increase by approximately 5-, 7-, and 10-fold after hybridization with dGMP−, dG6−, and dG12− GNPs, respectively, compared to bare FAM−DNA. The fluorescence due to FAM−DNA was found to be more prominently enhanced for dGNPs with increasing mers in the order dGNP < dG6 < dG12 at 518 nm. Similarly, the energy of the ssDNA−GNP plasmon (529 nm) and FAM exciton (518 nm) has been suggested to result in a resonance condition in the hybrid complex of GNPs and FAM. Since the plasmon energy is very similar to the exciton energy, the observed increase in fluorescence intensity might have been induced by the plasmon. 2.2.2.2. DNA−Ag. The preparation of AgNPs, nanorods, and nanowires on the surface of DNA could be directly achieved by the reduction of the adsorbed Ag+ ions on its network.136,164 In a classic work of Braun et al.,136 DNA-templated assembly of a

Figure 16. Experimentally observed I−V curves. (a) Two terminal I− V curves of the silver wire. Arrows indicate the voltage scan direction. The two curves in each direction present repeated measurements, thus demonstrating the stability of a given wire. Note the different asymmetries pertaining to the two scan directions. (b) I−V curves of a different silver wire in which the silver growth was more extensive than in (a). Extensive growth resulted in a narrower current plateau (solid curve), on the order of 0.5 V, and a lower differential resistance (7 MΩ versus 30 MΩ in (a)). By applying 50 V to the wire, the plateau has been permanently eliminated to give an ohmic behavior (dashed− dotted line) over the whole measurement range. I−V curves of a DNA bridge with no silver deposition and silver deposition without a DNA bridge are depicted in the bottom and top insets, respectively. In both cases, the sample is insulating. Reprinted with permission from ref 136. Copyright 1998 Nature Publishing Group.

identified in this work have also been explored to produce wires in other studies. In another report the dimensions and morphology of silver NPs were determined by the diameter of the pores on the DNA network.164 At relatively lower concentration of DNA (∼50 ng/μL), AgNPs were formed on tDNA with a size distribution of about 6.79 ± 0.61 nm. When the concentration of DNA was increased to 100 and 150 ng/ μL, the diameter of the pores was observed to decrease from 19 to about 12 nm, which changed the morphology of these nanostructures to nanorods and nanowires, respectively. Thus, an increase in [DNA] was observed to reduce the diameter of the pores. Such control of the morphology of these 7056


Chemical Reviews

Review

Figure 17. Fluorescence emission spectra of the silver nanoclusters bound to the oligonucleotide. For these spectra, [oligonucleotide] = 10 μM, [Ag+] = 60 μM, and [BH4−] = 60 μM. In the left panel, a series of emission spectra were acquired using 240, 260, 280, and 300 nm excitation. A broad emission band is observed between 400 and 550 nm, and a peak is observed at 632 nm. In the right panel, excitation at 540, 560, and 580 nm results in emission bands with maxima at 629, 638, and 642 nm, respectively. Reprinted from ref 165. Copyright 2004 American Chemical Society.

nanostructures has been suggested to find applications in nanoelectronics. The optical properties of Ag nanocrystals were controlled by binding them with a DNA template,165 which upon reduction by NaBH 4 produced Ag bound to different mers of oligonucleotide. Time-dependent formations of clusters ranging in size from Ag1− to Ag4−oligonucleotide were observed with characteristic absorption and fluorescence spectral features (Figure 17). The chemical shift in NMR spectra indicated the base-specific interaction. Gwinn et al.166 have reported the fluorescence properties of few-atom Ag nanoclusters attached to ssDNA by employing a sequence of 19-base DNA oligomers, viz., complementary C and G strands and 7 base pair stem hairpin oligomers having 5base A, T, G, and C loops attached to Ag nanoclusters (Scheme 7). Both the G and C strands produced brightly visible Scheme 7. Cartoons of the 19-Base DNA Oligomers Used in This Worka Figure 18. Contour maps of fluorescence from DNA−Ag solutions: (a) C strand, (b) G strand, (c) C loop, (d) G loop. The black contour lies at half the maximum intensity. Upper legend: contour interval and peak intensity. Lower legend: wavelengths of the primary peak, derived from three independent data sets. Shaded regions along λex = λem: scattered light prevents detection of fluorescence. Reprinted with permission from ref 166. Copyright 2008 Wiley.

intensities of the C and G strands were roughly 3 and 5 times higher than those of the C and G loop hairpins, respectively, and have been ascribed to the geometrical restriction imposed by the hairpin loop, which makes it difficult for Ag to be incorporated. These findings suggest the fluorescence characteristics of few-atom Ag−ssDNA nanohybrids are susceptible to the sequence and secondary structure of the bases comprising the strand. Sengupta et al.167 have made use of DNA as a scaffold for the synthesis of Agn nanoclusters (where n = 2−10) and observed sequence specificity involving cytosine and thymine in oligonucneotides. They also studied the influence of the bases and the base sequence on the formation of the blue/greenemitting Ag clusters using thymine-containing oligonucleotides dT12, dT4C4T4, and dC4T4C4. dT12 showed a pH-dependent green emission peaking at 540 nm for λex = 350 nm with the maximum emission intensity for a DNA:Ag stoichiometry of

a

Key: blue, cytosine (C); green, thymine (T); red, guanine (G); yellow, adenine (A). Black dots represent base pairing and solid lines the sugar−phosphate backbone. Top: the C-strand and G-strand form the duplex when annealed together. Bottom: hairpin C, G, T, and A loops. Reprinted with permission from ref 166. Copyright 2008 Wiley.

fluorescence having λem = 573.6 ± 0.1 nm with λex = 509.2 ± 0.6 nm and λem = 647.6 ± 2.4 nm with λex = 572.2 ± 2.3 nm, respectively, whereas the duplex did not fluoresce. For DNA with A, G, and C loops, fluorescence peaks centered at 534.9 ± 2.8, 614 ± 2.6, and 646.3 ± 2.6 nm, respectively, were observed (Figure 18). The fluorescence intensity of the A loop was almost 10 times lower than that of the C and G loops, whereas the T loop did not exhibit any fluorescence. The fluorescence 7057


Chemical Reviews

Review

Synthesis of DNA-origami-directed self-assembly of silver NPs has been reported using the bottom-up approach.168 In this work a well-ordered AgNP architecture on self-assembled DNA origami structures of triangular shape were obtained using 20 nm AgNPs conjugated with chimeric phosphorothioated DNA (9ps-T15) strands as building blocks. The nine sulfur atoms on the ps domain of the DNA backbone provide the DNA strand with high affinity for the surface of AgNPs. Different AgNPs and Ag−Au hybrid architectures were then assembled with the required number of staple strands mixed with three, six, or nine capture strands, each of which has a single-stranded overhang of approximately 15 bases that is complementary to the DNA sequence on the AgNP surface. The center-to-center distance between adjacent AgNPs could be precisely controlled from 94 to 29 nm (Figure 20). Such control of the spatial distance of AgNPs is suggested to have significant potential in photonic applications. Park et al.169 have synthesized polyvalent plasmonic DNA− Ag hybrids using silver nanocubes and thiol-modified DNA sequences. These DNA−Ag conjugates exhibited reversible assembly properties similar to those of the usual DNA−AuNPs. The bare AgNCs exhibit an SPR band at 426 nm which becomes slightly blue-shifted after conjugation with DNA due to the change in the morphology of the AgNCs from nanocubes to truncated. The authors have used this system to detect the target DNA concentration at 1 nM, and it could find applications in diagnostics for detecting target DNA strands. In a simple approach, detection of DNA hybridization has been sensed by Au islands deposited on a glass slide by employing transmission surface plasmon resonance spectroscopy.170 ssDNA was self-assembled onto Au nanoislands on a glass slide with the subsequent introduction of mercaptohexanol as a spacer molecule and then hybridized by complementary DNA functionalized by Au/AgNPs. From the density of the gold and silver NPs (approximately 400 particles in 1 μm2 in both the cases), the detection limit of DNA

2:1 (Figure 19). At the midpoint, the green emission observed at 540 nm showed dependence on the pH. The intensity of this

Figure 19. Composite fluorescence spectrum of 15 μM dT12 with 90 μM Ag+ and 90 μM BH4− in a pH 10.5 buffer. The emission wavelengths are on the bottom axis, and the excitation wavelengths are incremented by 20 nm on the right axis. The spectra were acquired 16 h after addition of BH4−. The inset excitation spectrum was acquired using λem = 540 nm. The excitation maximum is 350 nm, and weaker transitions are observed at 295 and ∼420 nm. Reprinted from ref 167. Copyright 2008 American Chemical Society.

band could be enhanced by 100-fold by a variation in pH from 8 to 11 with a midpoint at pH 9.3, which is almost similar to the pKa (9.7) corresponding to N3 of the thymine base. For the dT4C4T4−Ag cluster the fluorescence peak was noted at 475 nm with λex = 370 nm, similar to the trend observed with dT12. Among these bases, the sequences and the concentration of dC4T4C4 were found to influence the fluorescence properties of the cluster. The higher concentrations favor a red-emitting species and interestingly the lower concentrations a blue/greenemitting cluster.

Figure 20. Left: illustration of individual designs I−IV with different center-to-center distances. Middle: in the first four columns are enlarged TEM images of individual structures after negative staining of the samples with uranyl formate. The shape of the triangular DNA origami can be clearly seen; the dark balls are the AgNPs. The fifth column shows STEM images of the samples without staining. Again, the shape of the triangular DNA origami is clearly visible; the AgNPs appear as bright spots. Scale bars = 100 nm. Right: yield distribution of the formed structures. Reprinted with permission from ref 168. Copyright 2010 Wiley. 7058


Chemical Reviews

Review

hybridization has been estimated to be 4 × 107 oligonucleotides. 2.2.2.3. DNA−Ag/Au. DNA-modified Ag/Au171 and Au/ Ag172 core−shell nanosystems have also been developed. Ag/ Au-modified DNA has made use of the plasmonic characteristics of silver. The excitonic coefficient of the surface plasmon resonance of Ag is 4 times larger than that of Au, which could be utilized to tailor the optical properties and could be explored for SPR and surface-enhanced Raman scattering (SERS) detection systems. The monolayer shell on the gold NPs has been functionalized with an oligonucleotide to produce gold oligonucleotide conjugates (Figure 21). In another approach,

Scheme 8. Schematic Illustration of the Synthesis of DNAEmbedded Au/Ag Core−Shell Nanoparticlesa

a

Reprinted with permission from ref 172. Copyright 2008 Royal Society of Chemistry.

dimers. Nanosized silver shells of varied thickness were then grown using 1% poly(N-vinyl-2-pyrrolidine) as the stabilizer and sodium ascorbate as the reductant for different concentrations of silver as could be observed by the characteristic surface plasmon resonance band at 400 nm. AFM-correlated Raman measurement demonstrated that the characteristic Raman peaks for Cy3-modified oligonucleotides observed at 1470 and 1580 cm−1 were enhanced by a factor of about 2.7 × 1012 using Au/Ag core−shell nanodumbbells with a 5 nm Ag shell, which is large enough for single-molecule detection. In an interesting work, Lee et al.174 have carried out the directional assembly of Ag−Au bimetallic nanostructures with DNA which were found to have a strong salt concentration dependent on the reaction kinetics by using DNA−AuNPs as the seed and Ag−PVP complexes. At high salt concentration salt passivates DNA−AuNPs by uniformly distributing itself around the gold NP surface, which makes it difficult for the Ag−PVP complex to penetrate through the salt. In contrast, at a low concentration of salt a relatively less uniform DNA structure is formed at the surface of the gold NPs, which allows Ag−PVP to interact through a certain direction to approach the gold NP surface readily. The Ag center acts as a nucleation site for the deposition of more Ag−PVP complex, resulting in a faster and directional growth at the silver nanostructure on the gold NP surface as is evidenced by HR-TEM images of the particles under different experimental conditions. This growth was also evidenced by UV−vis spectroscopy, which demonstrates a change in the SPR band, a spherical shape at high salt concentration and a rod (dimeric shape) at lower salt concentration. Timper et al.175 developed a novel strategy for the construction of conducting nanowires by designing a bifunctional DNA template consisting of a 300 base pair immobilization sequence and a 900 base pair metallization sequence. The alkyne-functionalized immobilization DNA sequence was covalently linked to azide-functionalized Si surfaces using click chemistry through copper-catalyzed alkyne−azide cycloaddition (CuAAC), while the long metallization sequences contained diol-modified nucleobases. The diol groups on the DNA sequence were cleaved into mono- and dialdehyde groups using periodate, which then reduced the Ag+ into Ag0 in a Tollens reaction along the DNA wire. These Ag0 nucleation sites act as seeds for subsequent deposition of gold. These DNA wires exhibited ohmic behavior depicting the metallic conductivity, for which the resistivity varied from 2.3 × 10−5 to 11.3 × 10−5 Ω m. This method presents a promising

Figure 21. (A) TEM image of Ag/Au core−shell nanoparticles. (B) Energy-dispersive X-ray (EDX) spectra of Ag core particles (dotted line) and Ag/Au core−shell particles (solid line). L and M signify electron transitions into the L and M shells of the atoms, respectively, from higher states. (C) UV−vis spectra of the Ag core (dotted line) and Ag/Au core−shell (solid line). The inset shows the calculated extinction spectra of Ag particles (dotted line) and Ag/Au core−shell particles (solid line). (D) Thermal denaturization curve of aggregates formed from hybridized oligonucleotide-modified Ag/Au core−shell particles in buffer solution (0.3 M NaCl and 10 mM phosphate buffer, pH 7). The inset shows the UV−vis spectra of dispersed oligonucleotide-modified Ag/Au core−shell particles (solid line) and aggregated oligonucleotide-modified Ag/Au core−shell particles formed via hybridization (dotted line). Reprinted from ref 171. Copyright 2001 American Chemical Society.

gold NPs are used as the core and silver particles are employed as the shell, which provides high stability to Au/Ag core−shell NPs (Scheme 8). These particles exhibit silver-shell-thicknessbased optical properties, which are distinctively different from those of a Ag and Au mixture or Ag/Au alloy. Lim and co-workers173 have developed plasmonic DNAtethered heterodimeric gold−silver core−shell Raman-active nanodumbbells for imaging and sensing applications. The AuNPs used as the probe for their fabrication were modified with two different DNA sequences, a protecting sequence (5′CACGCGTTTCTCAAA-PEG18-A10-(CH2)3-SH-3′) and a target-capturing sequence (5′-TAACAATAATCCCTC-PEG18A10-(CH2)3-SH-3′), preconjugated with Raman-active dye (Cy3) so that the dye could be located at the junction of the single-DNA interconnected probes. Upon target DNA hybridization, this produces single-DNA-tethered AuNP hetero7059


Chemical Reviews

Review

resolution TEM. The mobilities of WT and MT tRNA were strikingly different as observed with gel filtration chromatography. However, extensive structural characterization of these materials was not carried out. RNA from torula yeast containing a mixture of RNA sequences has also been reported to serve as an effective template for the synthesis of fluorescing water-soluble quantized CdS NPs and mediates their growth to create novel assemblies.185 Chelation of Cd2+ with RNA restricts the nucleation of CdS. Their aging results in increased networking through supramolecular interactions in the process of selfassembly (Figure 23). Unlike DNA-stabilized particles in an aqueous medium, these particles display a prominent excitonic band at 380 nm and a relatively strong emission band (Φem = 0.02) at 2.34 eV. Aging of these particles further enhances their emission efficiency by more than 2.5-fold with a blue shift in the emission band to 2.39 eV. 3.1.2. RNA−PbS. The multifuctionality of RNA has been exploited for the designing of nanomaterials with tailored optical and electronic properties of IV−VI semiconducting NPs.80,186 Kumar and Jakhmola80 have synthesized RNAmediated red fluorescing quantized PbS (∼5 nm) having a facecentered cubic structure. These particles displayed prominent excitonic peaks at 350 and 570 nm and a strong narrow fluorescence band exhibiting an emission maximum in the visible range at 675 nm with an emission quantum yield of UTP (0.1%) > CTP (0.0%), whereas at pH 10.0 the order changed to ATP (6.9%) > UTP (6.1%) > GTP (3.6%) > CTP (3.5%). In this study guanosine diphosphate (GDP) was found to display properties very similar to those of GTP. GMP was, however, reported to be ineffective in regard to passivation, producing a marginally luminescent product. GTP having a maximum luminescing efficiency was observed to stabilize CdS NPs through N7 electrons of guanine primarily through the interaction of N7 with the CdS surface, which was evidenced by the use of 7-methylated GTP and inosine triphosphate (ITP), as the latter ligands yielded CdS with limited emission efficiency comparable to that of ATP. 4.1.1.2. GTP/ATP/CTP/UTP−PbS. Hinds et al.197 in other study synthesized ATP-, CTP-, GTP-, and UTP-directed PbS NPs. Among these, only GTP produced water-soluble PbS NPs having an average size of 4 nm. These particles exhibited the onset of absorption in the near-IR region, and the electronic spectrum did not exhibit any excitonic features. The excitation of these particles by 831 nm laser light exhibits poor NIR emission (Φem = 0.01−0.02) peaking at 1300 nm. The binding of N7 of GTP influences the size of the NPs and its luminescent properties, which was evidenced by the use of 7methyl-GTP exhibiting blue-shifted emission and is understood by a change in the binding mode of GTP. On the other hand, ITP and guanosine produced nonluminescing particles. The exocylic N2 of GTP appears crucial for binding to the surface of PbS, whereas phosphate participated in the growth of PbS by binding Pb2+ from the solution initially, but it reverts to the unbound state after the addition of S2−, suggesting the primary role of phosphate is to bind to Pb2+ and N2 as a ligand for PbS nanocrystals (Figure 30). In the presence of ATP, CTP, and

Figure 30. Effect of specific chemical functionalities present on GTP on PbS quantum dot synthesis: (A) luminescence spectra obtained when GTP, G, ITP, and 7-CH3-GTP were used for PbS synthesis, (B) proposed roles of phosphate and base functionalities on GTP in nanoparticle nucleation, growth, termination, stabilization, and passivation. Reprinted from ref 197. Copyright 2006 American Chemical Society.

AMP, GMP, CMP, and UMP and their mixtures have also been employed to stabilize PbS NPs.80,186 None of these as individuals or their mixture produced PbS with the optical properties recorded with RNA.186 These ligands exhibited negligible emission in the wavelength range observed with the RNA−PbS system. 4.1.2. Nucleotide Monophosphate (GMP, AMP, UMP, CMP) Mediated Semiconducting Nanostructures. 4.1.2.1. GMP/AMP/CMP/UMP−CdS. In recent studies, different nucleotide monophosphates have been employed to mediate the synthesis of CdS. Among these, GMP, AMP, and UMP were able to stabilize CdS particles.198 In the case of GMP and AMP, the best conditions under which the strong excitonic absorption and emission bands could be observed correspond to 0.015 g/100 mL nucleotide with an excess of 1 × 10−4 mol dm−3 Cd2+ at pH 9.2. However, for UMP a relatively higher concentration (0.025 g/100 mL) has to be employed. In the case of CMP, it was not possible to stabilize CdS NPs even at higher or lower concentrations. A comparison of the optical absorption and emission spectra for GMP-, AMP-, and UMPmediated CdS indicates a red shift of the excitonic absorption and emission maxima along with a significant decrease in the fluorescence intensity and broadening of the fluorescence band for AMP and UMP as compared to that of GMP (Figure 31). Thus, it is GMP which effectively mediates the synthesis of CdS. Its concentration-dependent change in optical and photophysical properties suggests these particles are produced in the quantum-confined region. CdS is observed to bind 7065


Chemical Reviews

Review

In the presence of GMP, the interfacial FeO component of Fe3O4 NPs reacts with the monophosphate group to form a thin layer of water-soluble NaFePO4. These particles exhibit superparamagnetic behavior with magnetic responsiveness (18.2 emu g−1). The authors have also proposed a plausible reaction mechanism for the synthesis of nucleotide-capped γFe2O3 on the basis of an FTIR, XRD, and XPS study. Owing to their stability, water dispersibility, affinity for surfaces, and superparamagnetic properties, these NPs could be utilized as in vivo computed tomography (CT) contrast agents. 5′-GMP-mediated β-FeOOH nanostructures of varied morphology ranging from nanorods to porous nanostructures via the formation of spherical NPs have recently been reported.200 Colloidal β-FeOOH NPs upon aging result in the formation of a hydrogel associated with a change in pH involving supramolecular interactions (Figure 32). Interactions of β-FeOOH through different functionalities of 5′-GMP, specifically involving N and P centers, are indicated by IR spectroscopy and also supported by XPS studies. The roomtemperature superparamagnetic behavior of the hydrogel with a magnetization of 4.8 emu/g, a fairly high stability at about pH 7, low toxicity, and biocompatibility suggests the potential of these nanostructures in biomedical applications.

Figure 31. Electronic and emission spectra of CdS mediated by GMP [fresh (red), aged (orange)], AMP (blue), and UMP (green) (λex = 380 nm). Reprinted from ref 198. Copyright 2009 American Chemical Society.

through >CO, N7, and imidazole moieties of GMP and influence the vibrational frequencies due to imidazole, pyrimidine (N7), >CO, and the P−O-5′-sugar, unlike the interaction with GTP, which was reported to take place through N7 and PO22− (Scheme 10). The optical properties of CdS capped with GMP, AMP, and UMP were markedly different compared to those of RNA−CdS as the latter system displayed blue-shifted electronic and emission bands. The aging of GMP-mediated Q-CdS for about three months caused a change in its morphology from QDs to nanorods with an average length and diameter of 73 and 21 nm, respectively, and aspect ratio of 3.5 as was also evidenced by an increase in fluorescence anisotropy from 0.05 to 0.25. An analysis of the relaxation kinetics of charge carriers showed these particles to have an average lifetime of 48 ns, which, however, decreased upon aging to 43 ns. 4.1.2.2. GMP−Iron Oxide. In a simple hydrothermal dephosphorylation approach, Gao et al.199 have synthesized highly stable and water-soluble nucleotide-templated γ-Fe2O3 NPs with an average diameter of 5 nm. The addition of Na2CO3 to an FeSO4 solution containing GMP initially produced FeCO3. FeCO3 then undergoes hydrothermal decomposition to give Fe3O4 (FeO·Fe2O3), which upon prolonged heating (10 h) produces GMP-templated Fe2O3.

4.2. Nucleotide-Templated Metals: Nucleotide-Templated Au Nanostructures

Water-soluble nucleotide-capped gold NPs with tunable size ranging from 2 to 5 nm having narrow monodispersity have been prepared.201 Among different nucleotides, the efficiency of the nucleotide in controlling the size and stability of AuNPs was found to follow the order ATP > CTP > GTP > TTP. The sizes of the gold particles synthesized in the absence and presence of ATP were found to be 7.85 ± 2.31 and 3.75 ± 0.60 nm, respectively (Figure 33). The authors have also used adenosines bearing different numbers of phosphate groups as capping ligands, i.e., from ATP to ADP, AMP, and adenosine. However, with decreasing number of phosphate groups, more aggregated and fused AuNPs were obtained. These nanomaterials are suggested to act as novel building blocks for bioconjugation, nanodevices, biosensors, and biolabels. 4.3. Nucleobase-Mediated Semiconducting Nanostructures

4.3.1. Purine/Adenine/Guanine−CdS. Purines being the important constituents of nucleotides, Kumar and Mital

Scheme 10. GMP-Templated CdSa

a

Reprinted from ref 198. Copyright 2009 American Chemical Society. 7066


Chemical Reviews

Review

Figure 32. TEM image of aged GMP-mediated β-FeOOH (a). Magnetic hysteresis loops for 5′-GMP-mediated colloidal β-FeOOH NPs (black) and the hydrogel (red) at 300 K (b). Gelation of GMP-mediated colloidal β-FeOOH with a change in pH (c). Reprinted with permission from ref 200. Copyright 2013 Royal Society of Chemistry.

nanoclusters with an average diameter of 2.7 nm were produced. The excitonic absorption and emission maxima due to these particles are blue-shifted to 350 nm (3.54 eV) and 530 nm (2.34 eV), respectively, compared to those of purinecapped particles. The quantum efficiency of emission of these particles is increased to 0.02. Capping of CdS by 6-DMAP caused a further blue shift in the onset of the absorption and excitonic (sharp) bands to 475 nm (2.61 eV) and 340 nm (3.65 eV), respectively. These particles were relatively much smaller (average diameter 2 nm) having a narrow size distribution. For these particles the fluorescence band is now moved to still higher energy at 2.36 eV (525 nm), and the Φfl for these particles is now improved to about 0.03.204 The appearance of a sharp excitonic peak in the optical absorption and band gap emission with a high quantum yield clearly indicate 6-DMAP to be acting as a better capping agent compared to purine and adenine. In a control experiment adenosine was also observed to stabilize CdS particles with a poor excitonic absorption band and a fairly broad emission peak at 420 and 560 nm, respectively. The intensity of adenosine-capped CdS was about 10 times smaller compared to that of adenine-mediated CdS. Moreover, these particles were fairly unstable and coagulated after a day. Other bases, such as guanine and guanosine, though stabilized CdS particles, but these particles did not exhibit any fluorescence. Purine in purine-capped Q-CdS becomes weakly bound through Cd2+ attached to CdS with the N9 of purine, whereas the protonated N7−H may bind another purine molecule through H-bonding. In these nanosystems the CdS particles interact via Cd(OH)2 with different functionalities of purines through H-bonding (Scheme 11). In the case of adenine and 6DMAP, this interaction occurs through the amino group as was indicated by both IR and NMR spectroscopy, and the secondary interaction with other adenine molecules takes place through N9−H. The observation that guanine poorly stabilizes CdS despite the availability of the N9 proton and amino group has been understood by the poor complexing properties of guanine to Cd2+ compared to those of adenine. Photocatalytic investigations indicate that the particles stabilized by strongly bound molecules are not suitable to initiate photocatalysis, whereas a weakly bound purine molecule channelizes the charge carriers effectively to the bound solute. Thus, the nature of the surface capping agent was found to play an important role in controlling the photophysics and photocatalytic properties. 4.3.2. Adenine−β-FeOOH. Capping by adenine provides a synthetic control to manipulate the size, morphology, and optical and magnetization properties of β-FeOOH nanostructures in an aqueous medium.205 An increasing concentration of adenine brings a regular change in the morphology from

Figure 33. (A) Representative TEM image of AuNPs prepared in the absence of ATP. The average size is 7.85 ± 2.31 nm. (B, C) Representative TEM and HRTEM images, respectively, of ATPcapped AuNPs. The HAuCl4:ATP:NaBH4 molar ratio in this experiment is 1:1:16.7. The size of the ATP-capped AuNPs is 3.75 ± 0.60 nm. The insets in (A) and (B) are size distributions. The inset in (C) shows the fast Fourier transform (FFT) of the selected area. The discrete dots in the FFT pattern illustrate the crystalline nature of the as-prepared AuNPs. (D) UV−vis absorption spectra of AuNP solutions prepared in the presence (capped) or absence (unprotected) of ATP. Reprinted with permission from ref 201. Copyright 2007 Wiley.

synthesized cadmium sulfide capped with purine,202 adenine,203 6-(dimethylamino)purine (6-DMAP),204 and guanine. In these investigations chelation of Cd2+ with the nucleic bases was observed to restrict the CdS nucleation and control the nanostructure size in a dynamic process. Additional substrate binds to the core structure through H-bonding (Scheme 11). The optimum conditions corresponded to an about 5 × 10−3 mol dm−3 concentration of substrates at pH 11.0. Under optimized conditions, purine-stabilized CdS NPs (average diameter 5 nm) exhibited an excitonic band at 380 nm (3.26 eV) and a broad emission band peaking at 540 nm (2.30 eV). The quantum efficiency of fluorescence due to these particles was observed to be 0.01. 202 Under similar experimental conditions in the presence of adenine, CdS 7067


Chemical Reviews

Review

Scheme 11. Structures of Purine-Capped (a) and Adenine-Capped (b) Q-CdS

nanorods to spherical NPs. At higher [adenine] (>1 × 10−2 mol dm−3), increasing numbers of spherical NPs encapsulating βFeOOH with an average diameter of 2.5 nm in the core and adenine molecules in the shell are obtained. The highest stability with a ζ potential of ∼67 mV was observed for the sample containing 2 × 10−2 mol dm−3 adenine. Increasing [adenine] from 1 × 10−3 to 2 × 10−2 mol dm−3 in nanohybrids enhanced the saturation magnetization due to β-FeOOH gradually from 2.0 to 6.9 emu/g at 300 K and resulted in the reversal of the magnetic nature from superparamagnetic to ferromagnetic at 10 12 in the case of Cy3-modified

Scheme 14. QD-Based FRET Used for the Detection of DNAa

a

Key: row 1, QD-conjugated probe DNA sequence (left) and dyeconjugated analyte DNA sequence (right); row 2, mixing of the probe sequence with the analyte sequence followed by excitation of a QD with blue light, causing green fluorescence from the QD and resulting in the weak fluorescence from the dye due to FRET from the QD; row 3, quenching of fluorescence due to a QD associated with a relatively red shifted stronger fluorescence from the dye after DNA hybridization.

dependent SPR band frequency 160−162 and fluorescing characteristics of DNA-modified Au163 and Ag166,167 probes could also be explored for sensing. The fluorescence from these QDs has been explored for (i) sensing the morphology of nanobiomaterials, (ii) estimation of the concentration of the quencher, and (iii) detection of the complementary target. In some cases semiconducting nanowires formed on DNA scaffolds have been observed to be electrically conducting,118−120 suggesting their application as a tool for electronic

Scheme 15. Different Nanoarchitectures Observed Using an RNA Template

7073


Chemical Reviews

Review

absorption and fluorescence bands involving interband and intraband transitions.218,219 In integrated nanosystems the presence of a metal in the nanohybrid has been observed to bring a change in the morphology associated with a change in the optical and magnetic properties of the semiconducting core NP.83,207,208 In these nanosystems enhanced surface passivation of the core affects its optical absorption as well as fluorescence properties. In biotemplated Ag/CdS nanohybrids, Ag present near the surface of CdS induces a local field and enhances the density of surface states in the fluorophore. The efficiency of fluorescence shows a dependence on the amount of metal in the composite and kinetically controls the relaxation of charge between the shallow and deeper traps interlinked to each other in the interfacial region. At low silver its binding to the different functionalities of the biomolecule introduces more shallow traps located at relatively higher energy in the hybrid, which act as radiative centers by forming a charge transfer complex. At high Ag relatively more deeper traps are generated exhibiting red-shifted emission, most of which are nonradiative centers, causing a decrease in the quantum efficiency of fluorescence (Scheme 16).

oligonucleotides with a 5 nm Ag shell, making it capable of single-molecule detection.173 On the other hand, RNA-based nanostructures, owing to single-stranded-ness, exhibit more flexibility toward folding into rigid and desired nanoarchitectures.179,180,186,187,191 They have emerged as an important tool to design self-assembled superstructures of varied morphologies and dimensionalities, namely, QDs,184−186,191 nanorods/nanowires/nanofibers,186 nanotubes,187,192 and porous190 and honeycomb191 nanostructures involving supramolecular interactions. Such a one-step fabrication of controlled structure through self-organization provides a convenient means of avoiding complex procedure(s). The morphological architectures of these nanohybrids are also obtained by involving similar interaction(s) between RNA strands and inorganics as discussed above with DNA. These syntheses are presented in Scheme 15. Although, among the individual nucleotides (AMP/ATP, GMP/GTP, UMP/UTP, CMP/CTP), only AMP/ATP and GMP/GTP79,196−198 have been found to act as an effective template for inorganic materials, none of them are able to show an effect similar to that of RNA with regard to nanoarchitectures along with the optical and electronic properties. It is thus apparent that these moieties when present in the multifunctional 3D structure of RNA display this effect in a cooperative manner. The specificity of metal−biotemplate interaction in semiconductors further contributes to the control of the nanoarchitecture as well as the nature of the optical absorption/ excitonic band(s) and development of new emissive properties in these nanohybrids. These findings are manifested by the different morphologies and absorption and emission characteristics for the same biomolecule with differing metal chalcogenide(s).184−188,190,191 The pH of the solution plays a crucial role in these interactions. First, it may cause protonation/deprotonation of the binding sites (A, U, G, and C nucleobases, the phosphate group, and 2′-OH) of the biotemplate to different extents in the case of RNA, which affects their coordinating power to influence the growth of nanostructures. In the case of RNA it might induce the secondary and tertiary interactions with different phases as well. Second, it may cause hydroxylation of metal ions to modify the surface of the nanomaterials, which provides additional linking sites for increased H-bonding interactions between the biomolecule and nanomaterial(s). The presence of excess metal ions may also polarize the nanomaterials to enhance the supramolecular interactions with biomolecules. Such increased interactions may attribute to the production of a variety of nanoarchitectures.184−188,190−192,198 Interactions with DNA and RNA influence the nucleation and growth of NPs to exhibit the size quantization effect along with surface passivation to varied extent. This creates both shallow and deep traps on their surface to eventually influence their photophysics.79,185−188,190−192 Under varied experimental conditions the shallow and deeper traps get populated differently to bring a shift in the excitonic absorption and emission bands, thereby influencing the dynamics of the charge carriers. Such an approach could be utilized to achieve charge separation in the irradiated semiconducting systems. Capping of MNPs by biomolecules stabilizes them by arresting their aggregation and modifying their surface by binding to different sites.90 A reduction in the cluster size to subnanodimensions induces in them a molecule-like property creating discrete energy levels displaying new characteristic

Scheme 16. Mechanism Describing the Photophysical Processes Observed in Integrated Biotemplated Metal/ Semiconductor Nanohybrids

The changes in morphology observed in the integrated binary and ternary nanosystems consisting of MNPs and semiconductor(s) might be attributed to the increased functionality and interactions of different phases with various functional groups of biomolecule(s). Besides morphological changes, integration under optimized conditions often results in the modification/enhancement of the physicochemical properties of the core inorganic material(s) due to surface passivation, local field enhancement, and interfacial and surface plasmon− exciton interactions.83,206−208 6.1. Future Prospects and Challenges

On the synthesis and properties of nucleic acid-templated nanostructures, excellent reviews were contributed by Feldheim and Eaton,6 Ma, Sargent, and Kelly,7 and Berti and Burley85 a few years ago. Increasing investigations on these nanosystems in recent years have demonstrated that the supramolecular approach has tremendous potential to design vast varieties of new nanostructures of varied morphologies and dimensionalities mimicking natural systems. It still remains a challenging task to rationalize the chemical approach to predict the morphology/dimensionality and electronic properties of such nanohybrids on the basis of the length/sequence and nature of the biopolymer. The formation of organized structures could 7074


Chemical Reviews

Review

Biographies

provide a basis for controlled fabrication of nanostructures suited for nanodevices. Synthesis of multicomponent nanohybrids consisting of two or more nanoscale components attached supramolecularly to biomolecule(s) is still in its infancy and needs to be explored extensively to induce a synergistic effect to enhance their physical and chemical properties. The enhanced properties of the integrated systems, namely, optical, fluorescence, anisotropy, and magnetic properties, hold immense promise for their utilization in biosensing, fluorescence imaging, extension of the sensitization range, nanoelectronics, MRI, and detection devices. Inorganic NPs functionalized with biomolecules usually undergo self-organization to produce directed assembly of a biological moiety encapsulating the inorganic nanostructure(s). This would thus provide a means to create a synthetic analogue(s) of biologically fabricated nanomaterials with enhanced properties for their effective utilization in biomedical applications. For example, specific and strong complementary interactions of biomolecules could thus be explored for designing functional nanomaterials having applications in medicine, drug delivery, imaging, intracellular monitors, and biological sensing. Since the toxicity of metal ions present in these nanostructures limits their applications in biology and devices, more efforts are needed to develop experimental protocols for their environmentally benign synthesis to give them a nontoxic and biocompatible surface with enhanced physicochemical properties and functional behavior. In summary, the synthetic flexibility and programmability of nucleic acid-templated nanostructures provides an excellent tool to material scientists to construct multimodal supramolecular structures with an engineered surface and fine-tuned optical, electronic, and magnetic properties with nanoscale precision. The fabrication of ordered aggregates with enhanced optical properties may also find tremendous scope in the areas of NIR optical and detection devices and photonic activities. We anticipate a bright future for these nanostructures in modern nanoelectronics, nanophotonics, development of chemical and enzymatic assays, cell biology, medicine, and cancer therapy, providing high physicochemical stability, low toxicity, multiplex detection, and a long circulation time inside the biological system to search, track, fix, and destroy malfunctioning and infected cells.

Anil Kumar completed his doctorate in physical chemistry with fundamental research in the area of kinetics of catalytic reactions. Thereafter, he held the position of Research Associate in the Radiation Laboratory, University of Notre Dame, Indiana, from 1979 to 1982 and collaborated mainly with Prof. P. Neta, a renowned radiation chemist, to investigate the participation of high-valent oxidation states of silver in redox reactions using radiation chemical techniques. In 1983, Dr. Kumar joined the University of Roorkee as Lecturer and initiated work on the photochemistry of inorganic systems. In 1986 he was offered the position of Guest Scientist at Hahn-Meitner-Institut, Germany, where he collaborated with Prof. Henglein, a pioneering radiation chemist, on radiation chemical aspects of nanomaterials until 1988. Subsequently, he initiated work on the photochemistry of metal and semiconductor nanosystems in India mainly through projects funded by the Department of Science & Technology (DST), New Delhi. From his early work on these systems, he received the Khosla Research Award and a silver medal in 1993−94 and the First Khosla Research Prize and a medal in 2002−03. His research contributions on these and earlier systems were also recognized by The National Academy of Sciences, Allahabad, India, and he was elected as a fellow of this prestigious academy in 2003. Recently, Prof. Kumar has been working on biotemplated nanosystems. He was instrumental in starting an M.Tech. program in the area of nanotechnology at the Indian Institute of Technology Roorkee in 2008.

Vinit Kumar received his M.Sc. from the Indian Institute of Technology Roorkee. After receiving his M.Sc. degree, he joined Prof. Anil Kumar’s laboratory at the same institute and received his Ph.D. in 2010 in the field of physical chemistry and nanotechnology. During his Ph.D. studies, he worked on the various aspects of the synthesis of colloidal nanoparticles and their self-assembly using biomolecules as templates. In 2011, he joined Prof. Naoki Sugimoto’s laboratory as a postdoctoral research fellow at the Frontier Institute for

AUTHOR INFORMATION Corresponding Author

*E-mail: [email protected]. Notes

The authors declare no competing financial interest. 7075


Chemical Reviews

Review

(31) Qian, L.; Zheng, Y.; Xue, J.; Holloway, P. H. Nat. Photonics 2011, 5, 543. (32) Kameyama, N.; Suda, M.; Einaga, Y. Phys. Status Solidi A 2009, 206, 2851. (33) Madhu, C.; Sundaresan, A.; Rao, C. N. R. Phys. Rev. B 2008, 77, 201306(R). (34) Laurent, S.; Forge, D.; Port, M.; Roch, A.; Robic, C.; Elst, L. V.; Muller, R. N. Chem. Rev. 2008, 108, 2064. (35) Bogle, K. A.; Ghosh, S.; Dhole, S. D.; Bhoraskar, V. N.; Fu, L.-f.; Chi, M.-f.; Browning, N. D.; Kundaliya, D.; Das, G. P.; Ogale, S. B. Chem. Mater. 2008, 20, 440. (36) Sounderya, N.; Zhang, Y. Recent Pat. Biomed. Eng. 2008, 1, 34. (37) Medintz, I. L.; Stewart, M. H.; Trammell, S. A.; Susumu, K.; Delehanty, J. B.; Mei, B. C.; Melinger, J. S.; Blanco-Canosa, J. B.; Dawson, P. E.; Mattoussi, H. Nat. Mater. 2010, 9, 676. (38) De, M.; Ghosh, P. S.; Rotello, V. M. Adv. Mater. 2008, 20, 4225. (39) Baker, C. C.; Pradhan, A.; Shah, S. I. In Encyclopedia of Nanoscience and Nanotechnology; Nalwa, H. S., Ed.; American Scientific Publishers: Stevenson Ranch, CA, 2004; Vol. 5, p 449. (40) Jain, P. K.; Huang, X.; El-Sayed, I. H.; El-Sayed, M. A. Acc. Chem. Res. 2008, 41, 1578. (41) Rodríguez-Lorenzo, L.; Rica, R. d. l.; Á lvarez-Puebla, R. A.; LizMarzán, L. M.; Stvens, M. M. Nat. Mater. 2012, 11, 604. (42) Cortie, M. B.; McDonagh, A. M. Chem. Rev. 2011, 111, 3713. (43) Murphy, C. J.; Gole, A. M.; Stone, J. W.; Sisco, P. N.; Alkilany, A. M.; Goldsmith, E. C.; Baxter, S. C. Acc. Chem. Res. 2008, 41, 1721. (44) Sau, T. K.; Rogach, A. L. Adv. Mater. 2010, 22, 1781. (45) Peng, S.; Lei, C.; Ren, Y.; Cook, R. E.; Sun, Y. Angew. Chem., Int. Ed. 2011, 50, 3158. (46) Doria, G.; Conde, J.; Veigas, B.; Giestas, L.; Almeida, C.; Assunçaõ , M.; Rosa, J.; Baptista, P. V. Sensors 2012, 12, 1657. (47) Alvarez-Puebla, R. A.; Liz-Marzán, L. M. Angew. Chem., Int. Ed. 2012, 51, 11214. (48) Ditlbacher, H.; Lamprecht, B.; Leitner, A.; Aussenegg, F. R. Opt. Lett. 2000, 25, 563. (49) Sokolov, K.; Tam, J.; Travis, K.; Larson, T.; Aaron, J.; Harrison, N.; Emelianov, S.; Johnston, K. Conf. Proc. IEEE Eng. Med. Biol. Soc. 2009, 2005. (50) Liz-Marzán, L. M., Kamat, P. V., Eds. Nanoscale Materials; Kluwer Academic Publishers: Boston, MA, 2003. (51) Rotello, V., Ed. Nanoparticles, Building Blocks for Nanotechnology; Springer: New York, 2004. (52) Schmid, G. Nanoparticles: From Theory to Application; WileyVCH Verlag GmbH and Co. KGaA: Weinheim, Germany, 2004; Chapter 7. (53) Jayadevan, K. P.; Tseng, T. Y. In Encyclopedia of Nanoscience and Nanotechnology; Nalwa, H. S., Ed.; American Scientific Publishers: Stevenson Ranch, CA, 2004; Vol. 8, p 333. (54) Wang, Q.; Ostafin, A. E. In Encyclopedia of Nanoscience and Nanotechnology; Nalwa, H. S., Ed.; American Scientific Publishers: Stevenson Ranch, CA, 2004; Vol. 5, p 475. (55) Tan, Y.; Li, Y.; Zhu, D. In Encyclopedia of Nanoscience and Nanotechnology; Nalwa, H. S., Ed.; American Scientific Publishers: Stevenson Ranch, CA, 2004; Vol. 8, p 9. (56) Henglein, A. Chem. Rev. 1989, 89, 1861. (57) Burda, C.; Chen, X.; Narayanan, R.; El-Sayed, M. A. Chem. Rev. 2005, 105, 1025. (58) Yin, Y.; Alivisatos, A. P. Nature 2005, 437, 664. (59) Manna, L.; Scher, E. C.; Alivisatos, A. P. J. Cluster Sci. 2002, 13, 521. (60) Chaudhuri, A. G.; Paria, S. Chem. Rev. 2012, 112, 2373. (61) Boisselier, E.; Astruc, D. Chem. Soc. Rev. 2009, 38, 1759. (62) Murray, C. B.; Norris, D. J.; Bawendi, M. G. J. Am. Chem. Soc. 1993, 115, 8706. (63) Dreaden, E. C.; Alkilany, A. M.; Huang, X.; Murphy, C. J.; ElSayed, M. A. Chem. Soc. Rev. 2012, 41, 2740. (64) Grzelczak, M.; Pérez-Juste, J.; Mulvaney, P.; Liz-Marzán, L. M. Chem. Soc. Rev. 2008, 37, 1783. (65) Bétard, A.; Fischer, R. A. Chem. Rev. 2012, 112, 1055.

Biomolecular Engineering Research, Konan University, Japan. In Japan he worked on structural and functional analysis of RNA switches under molecular crowding conditions. In September 2012, he moved to the National Cancer Institute, Aviano, Italy, and there he focuses on the development of new nanotechnologies for cancer diagnosis, treatment, and DNA nanotechnology.

ACKNOWLEDGMENTS We thank Dr. Reshma Rani, R.A., Sudhir Kumar Gupta, Ms. Mandeep Kaloti, Bhupender Singh, and other graduate students from our laboratory for going through the manuscript and useful suggestions. REFERENCES (1) Prasad, P. N. Nanophotonics; John Wiley & Sons: Hoboken, NJ, 2004; p 337. (2) Katz, E.; Willner, I. Angew. Chem., Int. Ed. 2004, 43, 6042. (3) Zhou, M.; Ghosh, I. Pept. Sci. 2006, 88, 325. (4) Sun, Y.; Kiang, C.-H. In Handbook of Nanostructured Biomaterials and Their Applications in Nanobiotechnology; Nalwa, H. S., Ed.; American Scientific Publishers: Stevenson Ranch, CA, 2005; Vol. 2, Chapter V. (5) Niemeyer, C. M. Angew. Chem., Int. Ed. 2001, 40, 4128. (6) Feldheim, D. L.; Eaton, B. E. ACS Nano 2007, 1, 154. (7) Ma, N.; Sargent, E. H.; Kelly, S. O. J. Mater. Chem. 2008, 18, 954. (8) Roduner, E. Nanoscopic Materials: Size-Dependent Phenomena; Royal Society of Chemistry: London, 2006; Chapter 1. (9) Mann, S. Angew. Chem., Int. Ed. 2008, 47, 5306. (10) Sanchez, C.; Arribart, H.; Guille, M. M. G. Nat. Mater. 2005, 4, 277. (11) Ji, B.; Gao, H. Annu. Rev. Mater. Res. 2010, 40, 77. (12) Nelson, D. L.; Cox. M. M. Lehninger Principles of Biochemistry, 5th ed.; W.H. Freeman: New York, 2008. (13) Seeman, N. C. Nature 2003, 421, 427. (14) Jaeger, L.; Chworos, A. Curr. Opin. Struct. Biol. 2006, 16, 531. (15) Guo, P. Nat. Nanotechnol. 2010, 5, 833. (16) Nozik, A. J.; Beard, M. C.; Luther, J. M.; Law, M.; Ellingson, R. J.; Johnson, J. C. Chem. Rev. 2010, 110, 6873. (17) Pattantyus-Abraham, A.-G.; Kramer, I. J.; Barkhouse, A. R.; Wang, X.; Konstantatos, G.; Debnath, R.; Levina, L.; Raabe, I.; Nazeeruddin, M. K.; Grätzel, M.; Sargent, E. H. ACS Nano 2010, 4, 3374. (18) Salant, A.; aShalom, M.; Tachan, Z.; Buhbut, S.; Zaban, A.; Banin, U. Nano Lett. 2012, 12, 2095. (19) Thakar, R.; Chen, Y.; Snee, P. T. Nano Lett. 2007, 7, 3429. (20) Dennis, A. M.; Rhee, W. J.; Sotto, D.; Dublin, S. N.; Bao, G. ACS Nano 2012, 6, 2917. (21) Demir, R.; Okur, S.; Seker, M. Ind. Eng. Chem. Res. 2012, 51, 3309. (22) Klimov, V. I.; Mikhailovsky, A. A.; Xu, S.; Malko, A.; Hollingsworth, J. A.; Leatherdale, C. A.; Eisler, H.-J.; Bawendi, M. G. Science 2000, 290, 314. (23) Dang, C.; Lee, J.; Breen, C.; Steckel, J. S.; Coe-Sullivan, S.; Nurmikko, A. Nat. Nanotechnol. 2012, 7, 335. (24) Mauser, C.; Limmer, T.; Como, E. D.; Becker, K.; Rogach, A. L.; Feldmann, J.; Talapin, D. V. Phys. Rev. B 2008, 77, 153303. (25) Talapin, D. V.; Lee, J.-S.; Kovalenko, M. V.; Shevchenko, E. V. Chem. Rev. 2010, 110, 389. (26) Beard, M. C.; Midgett, A. G.; Law, M.; Semonin, O. E.; Ellingson, R. J.; Nozik, A. Nano Lett. 2009, 9, 836. (27) Urban, J. J.; Talapin, D. V.; Shevchenko, E. V.; Kagan, C. R.; Murray, C. B. Nat. Mater. 2007, 6, 115. (28) Noone, K. M.; Ginger, D. S. ACS Nano 2009, 3, 261. (29) Kim, D. Y.; Choudhury, K. R.; Lee, J. W.; Song, D. W.; Sarasqueta, G.; So, F. Nano Lett. 2011, 11, 2109. (30) Yan, R.; Gargas, D.; Yang, P. Nat. Photonics 2009, 3, 569. 7076


Chemical Reviews

Review

(66) Zacher, D.; Schmid, R.; Wöll, C.; Fischer, R. A. Angew. Chem., Int. Ed. 2011, 50, 176. (67) deKrafft, K. E.; Wang, C.; Lin, W. Adv. Mater. 2012, 24, 2014. (68) Jiang, J.; Yu, J.; Corma, A. Angew. Chem., Int. Ed. 2010, 49, 3120. (69) Lu, G.; Li, S.; Guo, Z.; Farha, O. K.; Hauser, B. G.; Qi, X.; Wang, Y.; Wang, X.; Han, S.; Liu, X.; DuChene, J. S.; Zhang, H.; Zhang, Q.; Chen, X.; Ma, J.; Loo, S. C. J.; Wei, W. D.; Yang, Y.; Hupp, J. T.; Huo, F. Nat. Chem. 2012, 4, 310. (70) Alivisatos, A. P. J. Phys. Chem. 1996, 100, 13226. (71) Stroyuk, A. L.; Kryukov, A. I.; Kuchmii, S. Y.; Pokhodenko, V. D. Theor. Exp. Chem. 2005, 41, 67. (72) Joshi, R. K.; Schneider, J. J. Chem. Soc. Rev. 2012, 41, 5285. (73) Xia, Y.; Yang, P.; Sun, Y.; Wu, Y.; Mayers, B.; Gates, B.; Yin, Y.; Kim, F.; Yan, H. Adv. Mater. 2003, 15, 353. (74) Bent, S. F. J. Phys. Chem. B 2002, 106, 2830. (75) Scott, R. W. J.; Wilson, O. M.; Crooks, R. M. J. Phys. Chem. B 2005, 109, 692. (76) Döllefeld, H.; Hoppe, K.; Kolny, J.; Schilling, K.; Weller, H.; Eychmüller, A. Phys. Chem. Chem. Phys. 2002, 4, 4747. (77) Hayashi, K.; Ono, K.; Suzuki, H.; Sawada, M.; Moriya, M.; Sakamoto, W.; Yogo, T. Chem. Mater. 2010, 22, 3768. (78) Coffer, J. L.; Bigham, S. R.; Pinizzotto, R. F.; Yang, H. Nanotechnology 1992, 3, 69. (79) Dooley, C. J.; Rouge, J.; Ma, N.; Invernale, M.; Kelley, S. O. J. Mater. Chem. 2007, 17, 1687. (80) Kumar, A.; Jakhmola, A. Langmuir 2007, 23, 2915. (81) Kang, S.; Jolley, C. C.; Liepold, L. O.; Young, M.; Douglas, T. Angew. Chem., Int. Ed. 2009, 48, 4772. (82) Yeh, H.-C.; Sharma, J.; Han, J. J.; Martinez, J. S.; Werner, J. H. Nano Lett. 2010, 10, 3106. (83) Kumar, A.; Chaudhary, V. Nanotechnology 2009, 20, 095703. (84) Alivisatos, P. Nat. Biotechnol. 2004, 22, 47. (85) Berti, L.; Burley, G. A. Nat. Nanotechnol. 2008, 3, 81. (86) Wengel, J. Org. Biomol. Chem. 2004, 2, 277. (87) Evdokimov, Yu. M.; Zakharov, M. A.; Skuridin, S. G. Herald Russ. Acad. Sci. 2006, 76, 5. (88) (a) Kumar, A.; Hwang, J.-H.; Kumar, S.; Nam, J.-M. Chem. Commun. 2013, 49, 2597. (b) Dickerson, M. B.; Sandhage, K. H.; Naik, R. R. Chem. Rev. 2008, 108, 4935. (89) Sotiropoulou, S.; Sierra-Sastre, Y.; Mark, S. S.; Batt, C. A. Chem. Mater. 2008, 20, 821. (90) Gugliotti, L. A.; Feldheim, D. L.; Eaton, B. E. Science 2004, 304, 850. (91) Simmel, F. C. Angew. Chem., Int. Ed. 2008, 47, 5884. (92) Feldkamp, U.; Niemeyer, C. M. Angew. Chem., Int. Ed. 2008, 47, 3871. (93) Heckel, A.; Famulok, M. Biochemie 2008, 90, 1096. (94) Lin, C.; Liu, Y.; Yan, H. Biochemistry 2009, 48, 1663. (95) Li, H.; Carter, J. D.; LaBean, T. H. Mater. Today 2009, 12, 24. (96) Aldaye, F. A.; Palmer, A. L.; Sleiman, H. F. Science 2008, 321, 1795. (97) Bath, J.; Turberfield, A. J. Nat. Nanotechnol. 2007, 2, 275. (98) Suzuki, K.; Hosokawa, K.; Maeda, M. J. Am. Chem. Soc. 2009, 131, 7518. (99) Aldaye, F. A.; Sleiman, H. F. J. Am. Chem. Soc. 2007, 129, 4130. (100) Rothemund, P. W. K. Nature 2006, 440, 297. (101) Kuzyk, A.; Schreiber, R.; Fan, Z.; Pardatscher, G.; Roller, E.M.; Högele, A.; Simmel, F. C.; Govorov, A. O. Nature 2012, 483, 311. (102) Dohno, C.; Nakatani, K. Chem. Soc. Rev. 2011, 40, 5718. (103) Saccà, B.; Niemeyer, C. M. Chem. Soc. Rev. 2011, 40, 5910. (104) Rajendran, A.; Endo, M.; Sugiyama, H. Angew. Chem., Int. Ed. 2012, 51, 874. (105) Willner, O. I.; Henning, A.; Shlyahovsky, B.; Willner, I. Nano Lett. 2010, 10, 1458. (106) Houlton, A.; Pike, A. R.; Galindo, M. A.; Horrocks, B. R. Chem. Commun. 2009, 1797. (107) Winfree, E. Natl. Acad. Eng. Bridge 2003, 33, 31. (108) Keren, K.; Krueger, M.; Gilad, R.; Ben-Yoseph, G.; Sivan, U.; Braun, E. Science 2002, 297, 72.

(109) Seelig, G.; Yurke, B.; Winfree, E. J. Am. Chem. Soc. 2006, 128, 12211. (110) Bigham, S. R.; Coffer, J. L. Colloids Surf., A 1995, 95, 211. (111) Bigham, S. R.; Coffer, J. L. J. Cluster Sci. 2000, 11, 359. (112) Bigham, S. R.; Coffer, J. L. J. Phys. Chem. 1992, 96, 10581. (113) Li, X.; Coffer, J. L. Chem. Mater. 1999, 11, 2326. (114) (a) Coffer, J. L.; Bigham, S. R.; Li, X.; Pinizzotto, R. F.; Rho, Y. G.; Pirtle, R. M.; Pirtle, I. L. Appl. Phys. Lett. 1996, 69, 3851. (b) Guo, L.; Ma, N. ACS Nano 2012, 6, 689. (115) Barrelet, C. J.; Greytak, A. B.; Lieber, C. M. Nano Lett. 2004, 4, 1981. (116) Chen, N.; Qian, X.; Lin, H.; Liu, H.; Li, Y.; Li, Y. Dalton Trans. 2011, 40, 10804. (117) Patolsky, F.; Zheng, G.; Lieber, C. M. Nanomedicine 2006, 1, 51. (118) Dong, L.; Hollis, T.; Connolly, B. A.; Wright, N. G.; Horrocks, B. R.; Houlton, A. Adv. Mater. 2007, 19, 1748. (119) Kundu, S.; Liang, H. Adv. Mater. 2008, 20, 826. (120) Kundu, S.; Lee, H.; Liang, H. Inorg. Chem. 2009, 48, 121. (121) Patel, A. A.; Wu, F.; Zhang, J. Z.; Torres-Martinez, C. L.; Mehra, R. K.; Yang, Y.; Risbud, S. H. J. Phys. Chem. B 2000, 104, 11598. (122) Levina, L.; Sukhovatkin, V.; Musikhin, S.; Cauchi, S.; Nisman, R.; Bazett- Jones, D. P.; Sargent, E. H. Adv. Mater. 2005, 17, 1854. (123) Artemyev, M.; Kisiel, D.; Abmiotko, S.; Antipina, M. N.; Khomutov, G. B.; Kislov, V. V.; Rakhnyanskaya, A. A. J. Am. Chem. Soc. 2004, 126, 10594. (124) Ma, N.; Sargent, E. H.; Kelley, S. O. Nat. Nanotechnol. 2009, 4, 121. (125) Zayed, J.; Philippe, S. Int. J. Toxicol. 2009, 28, 259. (126) Peng, H.; Zhang, L.; Kjällman, T. H. M.; Soeller, C.; TravasSejdic, J. J. Am. Chem. Soc. 2007, 129, 3048. (127) Li, J.; Zhu, J. J. Analyst 2013, 138, 2506. (128) Lee, J.; Choi, Y.; Kim, J.; Park, E.; Song, R. ChemPhysChem 2009, 10, 806. (129) Freeman, R.; Finder, T.; Willner, I. Angew. Chem., Int. Ed. 2009, 48, 7818. (130) Wang, Q.; Liu, Y.; Ke, Y.; Yan, H. Angew. Chem., Int. Ed. 2008, 47, 316. (131) Boeneman, K.; Prasuhn, D. E.; Blanco-Canosa, J. B.; Dawson, P. E.; Melinger, J. S.; Ancona, M.; Stewart, M. H.; Susumu, K.; Huston, A.; Medintz, I. L. J. Am. Chem. Soc. 2010, 132, 18177. (132) Meng, H.; Yang, Y.; Chen, Y.; Zhou, Y.; Liu, Y.; Chen, X.; Ma, H.; Tang, Z.; Liu, D.; Jiang, L. Chem. Commun. 2009, 2293. (133) Byrne, S. J.; Corr, S. A.; Gun’ko, Y. K.; Kelly, J. M.; Brougham, D. F.; Ghosh, S. Chem. Commun. 2004, 2560. (134) Kinsella, J. M.; Ivanisevic, A. J. Am. Chem. Soc. 2005, 127, 3276. (135) Kinsella, J. M.; Ivanisevic, A. Langmuir 2007, 23, 3886. (136) Braun, E.; Eichen, Y.; Sivan, U.; Ben-Yoseph, G. Nature 1998, 391, 775. (137) (a) Kumar, A.; Pattarkine, M.; Bhadbhade, M.; Mandale, A. B.; Ganesh, K. N.; Datar, S. S.; Dharmadhikari, C. V.; Sastry, M. Adv. Mater. 2001, 13, 341. (b) Nykypanchuk, D.; Maye, M. M.; Lelie, D.; Gang, O. Nature 2008, 451, 549. (138) (a) Ford, W. E.; Harnack, O.; Yasuda, A.; Wessels, J. M. Adv. Mater. 2001, 13, 1793. (b) Polsky, R.; Gill, R.; Kaganovsky, L.; Willner, I. Anal. Chem. 2006, 78, 2268. (139) (a) Fang, C.; Fan, Y.; Kong, J. M.; Zhang, G. J.; Linn, L.; Rafeah, S. Sens. Actuators, B 2007, 126, 684. (b) Itoh, H.; Maeda, H.; Yamada, S.; Hori, Y. ChemCatChem 2012, 4, 1737. (140) Gu, Q.; Cheng, C.; Haynie, D. T. Nanotechnology 2005, 16, 1358. (141) Becerril, H. A.; Ludtke, P.; Willardson, B. M.; Woolley, A. T. Langmuir 2006, 22, 10140. (142) (a) Rotaru, A.; Dutta, S.; Jentzsch, E.; Gothelf, K.; Mokhir, A. Angew. Chem., Int. Ed. 2010, 49, 5665. (b) Watson, S. M. D.; Wright, N. G.; Horrocks, B. R.; Houlton, A. Langmuir 2010, 26, 2068. (143) (a) Finkelstein, A. E.; Walz, D. T.; Batista, V.; Mizraji, M.; Roisman, F.; Misher, A. Ann. Rheum. Dis. 1976, 35, 251. (b) Arvizo, R. 7077


Chemical Reviews

Review

(178) Shu, D.; Moll, W.-D.; Deng, Z.; Mao, C.; Guo, P. Nano Lett. 2004, 4, 1717. (179) Afonin, K. A.; Bindewald, E.; Yaghoubian, A. J.; Voss, N.; Jacovetty, E.; Shapiro, B. A.; Jaeger, L. Nat. Nanotechnol. 2010, 5, 676. (180) Severcan, I.; Geary, C.; Chworos, A.; Voss, N.; Jacovetty, E.; Jaeger, L. Nat. Chem. 2010, 2, 772. (181) Sigel, R. K. O.; Sigel, H. Acc. Chem. Res. 2010, 43, 974. (182) Ennifar, E.; Walter, P.; Dumas, P. Nucleic Acids Res. 2003, 31, 2671. (183) Famulok, M.; Ackermann, D. Nat. Nanotechnol. 2010, 5, 634. (184) Ma, N.; Dooley, C. J.; Kelley, S. O. J. Am. Chem. Soc. 2006, 128, 12598. (185) Kumar, A.; Kumar, V. J. Phys. Chem. C 2008, 112, 3633. (186) Kumar, A.; Jakhmola, A. J. Phys. Chem. C 2009, 113, 9553. (187) Kumar, A.; Singh, B. Chem. Commun. 2011, 47, 4144. (188) Kumar, A.; Singh, B. Dalton Trans. 2013, 42, 11455. (189) Berezin, M. Y.; Akers, W. J.; Guo, K.; Fischer, G. M.; Daltrozzo, E.; Zumbusch, A.; Achilefu, S. Biophys. J. 2009, 97, L22. (190) Kumar, A.; Singh, B. RSC Adv. 2012, 2, 9079. (191) Kumar, A.; Singh, B. J. Phys. Chem. C 2013, 117, 5386. (192) Kumar, A.; Kumar, V. Chem. Commun. 2009, 5433. (193) Carter, C. J.; Dolska, M.; Owczarek, A.; Ackerson, C. J.; Eaton, B. E.; Feldheim, D. L. J. Mater. Chem. 2009, 19, 8320. (194) Kim, J. H.; Estabrook, R. A.; Braun, G.; Lee, B. R.; Reich, N. O. Chem. Commun. 2007, 4342. (195) Cao, Y. W. C.; Jin, R.; Mirkin, C. A. Science 2002, 297, 1536. (196) Green, M.; Smyth-Boyle, D.; Harries, J.; Taylor, R. Chem. Commun. 2005, 4830. (197) Hinds, S.; Taft, B. J.; Levina, L.; Sukhovatkin, V.; Dooley, C. J.; Roy, M. D.; MacNeil, D. D.; Sargent, E. H.; Kelley, S. O. J. Am. Chem. Soc. 2006, 128, 64. (198) Kumar, A.; Kumar, V. Inorg. Chem. 2009, 48, 11032. (199) Gao, G.; Wu, H.; Zhang, Y.; Luo, T.; Feng, L.; Huang, P.; He, M.; Cui, D. CrystEngComm 2011, 13, 4810. (200) Kumar, A.; Gupta, S. K. J. Mater. Chem. B 2013, 1, 5818. (201) Zhao, W.; Gonzaga, F.; Li, Y.; Brook, M. A. Adv. Mater. 2007, 19, 1766. (202) Kumar, A.; Mital, S. Photochem. Photobiol. Sci. 2002, 1, 737. (203) Kumar, A.; Mital, S. J. Colloid Interface Sci. 2001, 240, 459. (204) Kumar, A.; Mital, S. Int. J. Photoenergy 2004, 6, 61. (205) Kumar, A.; Gupta, S. K. J. Nanopart. Res. 2013, 15 (1466), 1. (206) Jaganathan, H.; Ivanisevic, A. J. Mater. Chem. 2011, 21, 939. (207) Kumar, A.; Chaudhary, V.; Kumar, V. Eur. J. Inorg. Chem. 2013, 2013, 269. (208) Kumar, A.; Singhal, A. J. Mater. Chem. 2011, 21, 481. (209) Dameron, C. T.; Reese, R. N.; Mehra, R. K.; Kortan, A. R.; Carroll, P. J.; Steigerwald, M. L.; Brus, L. E.; Winge, D. R. Nature 1989, 338, 596. (210) Homes, J. D.; Richardson, D. J.; Saed, S.; Evansgowing, R.; Russell, D. A.; Sodea, J. R. Microbiology 1997, 143, 2521. (211) Kang, S. H.; Bozhilov, K. N.; Myung, N. V.; Mulchandani, A.; Chen, W. Angew. Chem., Int. Ed. 2008, 47, 5186. (212) Shen, L.; Bao, N.; Prevelige, P. E.; Gupta, A. J. Phys. Chem. C 2010, 114, 2551. (213) Ahmad, A.; Mukherjee, P.; Mandal, D.; Senapati, S.; Khan, M. I.; Kumar, R.; Sastry, M. J. Am. Chem. Soc. 2002, 124, 12108. (214) Mao, C.; Solis, D. J.; Reiss, B. D.; Kottmann, S. T.; Sweeney, R. Y.; Hayhurst, A.; Georgiou, G.; Iverson, B.; Belcher, A. M. Science 2004, 303, 213. (215) Lee, S.-W.; Mao, C.; Flynn, C. E.; Belcher, A. M. Science 2002, 296, 892. (216) Mao, C.; Flynn, C. E.; Hayhurst, A.; Sweeney, R.; Qi, J.; Georgiou, G.; Iverson, B.; Belcher, A. M. Proc. Natl. Acad. Sci. U.S.A. 2003, 100, 6946. (217) Sweeney, R. Y.; Mao, C.; Gao, X.; Burt, J. L.; Belcher, A. M.; Georgiou, G.; Iverson, B. L. Chem. Biol. 2004, 11, 1553. (218) Shen, Z.; Duan, H.; Frey, H. Adv. Mater. 2007, 19, 349. (219) Shang, L.; Dong, S.; Nienhaus, G. U. Nano Today 2011, 6, 401.

R.; Bhattacharyya, S.; Kudgus, R. A.; Giri, K.; Bhattacharya, R.; Mukherjee, P. Chem. Soc. Rev. 2012, 41, 2943 and references therein. (c) Chaloupka, K.; Malam, Y.; Seifalian, A. M. Trends Biotechnol. 2010, 28, 580. (144) Thakor, A. S.; Jokerst, J.; Zavaleta, C.; Massoud, T. F.; Gambhir, S. S. Nano Lett. 2011, 11, 4029. (145) Cho, W.-S.; Cho, M.; Jeong, J.; Choi, M.; Cho, H.-Y.; Han, B. S.; Kim, S. H.; Kim, H. O.; Lim, Y. T.; Chung, B. H.; Jeong, J. Toxicol. Appl. Pharmacol. 2009, 236, 16. (146) Chen, H.; Dorrigan, A.; Saad, S.; Hare, D. J.; Cortie, M. B.; Valenzuela, S. M. PLoS One 2013, 8, e58208. (147) Alkilany, A. M.; Murphy, C. J. J. Nanopart. Res. 2010, 12, 2313. (148) (a) Eckhardt, S.; Brunetto, P. S.; Gagnon, J.; Priebo, M.; Giese, B.; Fromm, K. M. Chem. Rev. 2013, 113, 4708. (b) Li, X.; Wang, L.; Fan, Y.; Feng, Q.; Cui, F.-Z. J. Nanomater. 2012, DOI: 10.1155/2012/ 548389. (149) Chen, Y.-S.; Hung, Y.-C.; Liau, I.; Huang, G. S. Nanoscale Res. Lett. 2009, 4, 858. (150) Goodman, C. M.; McCusker, C. D.; Yilmaz, T.; Rotello, V. M. Bioconjugate Chem. 2004, 15, 897. (151) Kim, S. T.; Saha, K.; Kim, C.; Rotello, V. M. Acc. Chem. Res. 2013, 46, 681. (152) Das, S.; Debnath, N.; Mitra, S.; Datta, A.; Goswami, A. Biometals 2012, 25, 1009. (153) Lewinski, N.; Colvin, V.; Drezek, R. Small 2008, 4, 26. (154) Rosi, N. L.; Giljohann, D. A.; Thaxton, C. S.; Lytton- Jean, A. K. R.; Han, M. S.; Mirkin, C. A. Science 2006, 312, 1027. (155) Saha, K.; Agasti, S. S.; Kim, C.; Li, X.; Rotello, V. M. Chem. Rev. 2012, 112, 2739. (156) Wang, Z.; Tang, L.; Tan, L. H.; Li, J.; Lu, Y. Angew. Chem., Int. Ed. 2012, 51, 1. (157) Zhang, J.; Liu, Y.; Ke, Y.; Yan, H. Nano Lett. 2006, 6, 248. (158) Sharma, J.; Chhabra, R.; Cheng, A.; Brownell, J.; Liu, Y.; Yan, H. Science 2009, 323, 112. (159) Yao, H.; Yi, C.; Tzang, C.-H.; Zhu, J.; Yang, M. Nanotechnology 2007, 18, 015102. (160) Kim, J.-Y.; Lee, J.-S. Nano Lett. 2009, 9, 4564. (161) Storhoff, J. J.; Elghanian, R.; Mirkin, C. A.; Letsinger, R. L. Langmuir 2002, 18, 6666. (162) Krpetić, Z.; Singh, I.; Su, W.; Guerrini, L.; Faulds, K.; Burley, G. A.; Graham, D. J. Am. Chem. Soc. 2012, 134, 8356. (163) Xu, L.; Zhu, Y.; Ma, W.; Chen, W.; Liu, L.; Kuang, H.; Wang, L.; Xu, C. J. Phys. Chem. C 2011, 115, 3243. (164) Wei, G.; Zhou, H.; Liu, Z.; Song, Y.; Wang, L.; Sun, L.; Li, Z. J. Phys. Chem. B 2005, 109, 8738. (165) Petty, J. T.; Zheng, J.; Hud, N. V.; Dickson, R. M. J. Am. Chem. Soc. 2004, 126, 5207. (166) Gwinn, E. G.; O’Neill, P.; Guerrero, A. J.; Bouwmeeste, D.; Fygenson, D. K. Adv. Mater. 2008, 20, 279. (167) Sengupta, B.; Ritchie, C. M.; Buckman, J. G.; Johnsen, K. R.; Goodwin, P. M.; Petty, J. T. J. Phys. Chem. C 2008, 112, 18776. (168) Pal, S.; Deng, Z.; Ding, B.; Yan, H.; Liu, Y. Angew. Chem., Int. Ed. 2010, 49, 2700. (169) Park, H.-G.; Joo, J. H.; Kim, H.-G.; Lee, J.-S. J. Phys. Chem. C 2012, 116, 2278. (170) Hutter, E.; Pileni, M.-P. J. Phys. Chem. B 2003, 107, 6497. (171) Cao, Y. W.; Jin, R.; Mirkin, C. A. J. Am. Chem. Soc. 2001, 123, 7961. (172) Lim, D.-K.; Kim, I.-J.; Nam, J.-M. Chem. Commun. 2008, 5312. (173) Lim, D.-K.; Jeon, K.-S.; Kim, H. M.; Nam, J.-M.; Suh, Y. D. Nat. Mater. 2010, 9, 60. (174) Lee, J.-H.; Kim, G.-H.; Nam, J.-M. J. Am. Chem. Soc. 2012, 134, 5456. (175) Timper, J.; Gutsmiedl, K.; Wirges, C.; Broda, J.; Noyong, M.; Mayer, J.; Carell, T.; Simon, U. Angew. Chem., Int. Ed. 2012, 51, 7586. (176) Guo, P. J. Nanosci. Nanotechnol. 2005, 5, 1964. (177) Leontis, N. B.; Lescoute, A.; Westhof, E. Curr. Opin. Struct. Biol. 2006, 16, 279. 7078


Trinitrophenylation of nucleic acids and their constituents.

Antisense and antigene properties of peptide nucleic acids.

Amplification of nucleic acids by polymerase chain reaction (PCR) and other methods and their applications.

Modification of nucleic acids by azobenzene derivatives and their applications in biotechnology and nanotechnology.

Loop-mediated isothermal amplification for detection of nucleic acids.

Presence of human immunodeficiency virus nucleic acids in wastewater and their detection by polymerase chain reaction.

Circulating nucleic acids: An analysis of their occurrence in malignancies.

'Caged' peptide nucleic acids activated by red light in a singlet oxygen mediated process.

Nucleic acids--chemistry and applications.

Vaccines, cells and nucleic acids.

[Vaccines, cells and nucleic acids].

Liposomal spherical nucleic acids.

Spin labeled nucleic acids.

Editorial overview: Nucleic acids and their protein complexes: Progress in nucleic acid structural biology: new technologies and discoveries.

Ribozyme-Spherical Nucleic Acids.

Immunomodulatory spherical nucleic acids.

Nucleic acids nanotechnology.

Binding and cleavage of nucleic acids by the "hairpin" ribozyme.

Directed evolution of nucleic acids by independent replication and selection.

Antifungal properties of 2-alkynoic acids and their methyl esters.

A simple and rapid experimental protocol for studies of nucleic acids metabolism and their base composition.

Circulating nucleic acids and hemostasis: biological basis behind their relationship and technical issues in assessment.

Microsome-mediated transacetylation and binding of N-hydroxy-4-aminobiphenyl to nucleic acids by hepatic and bladder tissues from dog.

Nucleic Acids Research: Editorial Board.