Metabolic engineering of Corynebacterium glutamicum strain ATCC13032 to produce L-methionine

Tianyu Qin1,2 Xiaoqing Hu1 Jinyu Hu2 ∗ Xiaoyuan Wang1,3

1 State

Key Laboratory of Food Science and Technology, Jiangnan University, Wuxi, People’s Republic of China

2 School

of Biotechnology, Jiangnan University, Wuxi, People’s Republic of

China 3 Synergetic

Innovation Center of Food Safety and Nutrition, Jiangnan University, Wuxi, People’s Republic of China

Abstract L-Methionine–producing strain QW102/pJYW-4homm -lysCm -brnFE was developed from Corynebacterium glutamicum strain ATCC13032, using metabolic engineering strategies. These strategies involved (i) deletion of the gene thrB encoding homoserine kinase to increase the precursor supply, (ii) deletion of the gene mcbR encoding the regulator McbR to release the transcriptional repression to various genes in the L-methionine biosynthetic pathway, (iii) overexpression of the gene lysCm encoding feedback-resistant aspartate kinase and the gene homm encoding feedback-resistant homoserine dehydrogenase to further

increase the precursor supply, and (iv) overexpression of the gene cluster brnF and brnE encoding the export protein complex BrnFE to increase extracellular L-methionine concentration. QW102/pJYW-4-homm -lysCm -brnFE produced 42.2 mM (6.3 g/L) L-methionine after 64-H fed-batch fermentation. These results suggest that L-methionine–producing strains can be developed from wild-type C. glutamicum strains by rationally metabolic C 2014 International Union of Biochemistry and Molecular engineering.  Biology, Inc. Volume 00, Number 00, Pages 1–11, 2014

Keywords: ATCC13032, Corynebacterium glutamicum, fermentation, metabolic engineering

L-methionine,

1. Introduction Methionine is an essential amino acid required in the diet of human and livestock [1], and its deficiency links to

Abbreviations: AK, aspartate kinase; amp, ampicillin-resistant gene; ASD, aspartyl semialdehyde dehydrogenase; CL, cystathionine-β-lyase; CS, cystathionine-γ –synthase; DCW, dry cell weight; DS, dihydrodipicolinate synthase; HAT, homoserine acetyltransferase; HD, homoserine dehydrogenase; HK, homoserine kinase; kan, kanamycin-resistant gene; LB medium, Luria–Bertani medium; MS, methionine synthase; OAHS, O-acetylhomoserine sulfhydrylase; OD, optimal density; OPA, O-phthaldialdehyde. ∗ Address for correspondence: Professor Xiaoyuan Wang, State Key Laboratory of Food Science and Technology, Jiangnan University, 1800 Lihu Avenue, Wuxi 214122, People’s Republic of China. Tel.: +86 510 85329239; Fax: +86 510 85329239; e-mail: [email protected]. Received 15 July 2014; accepted 1 September 2014

DOI: 10.1002/bab.1290 Published online in Wiley Online Library (wileyonlinelibrary.com)

various diseases [2]. Methionine is commercially produced mainly by chemical synthesis as a racemic mixture, and used as additives in animal feed. Because chemical production requires hazardous chemicals [3] and l-methionine is better than d-methionine as the source of sulfur amino acids, l-methionine production by bacterial fermentation is becoming more attractive [4]. l-Methionine could be synthesized in diverse microorganisms including Corynebacterium glutamicum, Escherichia coli, Saccharomyces cerevisiae, Brevibacterium flavum, and Leptospira meyeri [5], among which C. glutamicum and E. coli are the most promising strains. Because E. coli produces endotoxins [6], C. glutamicum seems to be the best choice for l-methionine production. C. glutamicum has been widely used for industrial production of various amino acids such as l-lysine, l-threonine, l-isoleucine, and l-histidine [7–9], but l-methionine–producing C. glutamicum strains need to be developed. In C. glutamicum, l-methionine biosynthesis is initiated by acetylation of l-homoserine [10] (Fig. 1). l-Homoserine

1

Biotechnology and Applied Biochemistry

FIG. 1

Biosynthetic pathway of L-methionine in C. glutamicum. The dashed arrows indicate feedback inhibition of enzymes by L-threonine or L-lysine. Bold arrows indicate the reactions were enhanced by overexpressing the enzymes. Arrows with a cross mark indicate that the reaction was blocked by gene deletion. Solid triangles indicate the genes repressed by McbR. AK, aspartate kinase; ASD, aspartyl semialdehyde dehydrogenase; HD, homoserine dehydrogenase; HK, homoserine kinase; DS, dihydrodipicolinate synthase; HAT, homoserine acetyltransferase; OAHS, O-acetylhomoserine sulfhydrylase; CS, cystathionine-γ -synthase; CL, cystathionine-β-lyase; MS, methionine synthase.

is synthesized from l-aspartate by three enzymes: aspartate kinase (AK) encoded by the gene lysC, aspartate semialdehyde dehydrogenase encoded by the gene asd, and homoserine dehydrogenase (HD) encoded by the gene hom. The activity of AK can be inhibited by l-lysine and l-threonine, but the inhibition can be released by a point mutation Thr311Ile in the enzyme [11]; the activity of HD can be inhibited by l-theronine, but the inhibition can be released by the point mutation Gly377Glu [10]. In addition, there are two competing branches in the biosynthetic pathway of l-methionine: one synthesizes l-lysine and the other synthesizes l-threonine [12, 13]. The first reaction in the l-lysine biosynthetic branch is catalyzed by dihydrodipicolinate synthase (DS) encoded by the gene dapA, whereas the first reaction in the l-threonine biosynthetic

2

branch is catalyzed by homoserine kinase (HK) encoded by the gene thrB. The two-component protein complex BrnFE encoded by the gene cluster brnF and brnE could export l-methionine, l-leucine, l-isoleucine, and l-valine in C. glutamicum [14]. There are two major pathways for l-methionine biosynthesis in microorganisms: the transsulfuration pathway and the direct sulfhydrylation pathway (Fig. 1). The transsulfuration pathway involves cystathionine as an intermediate and utilizes cysteine as the sulfur source, but the direct sulfhydrylation pathway bypasses cystathionine and utilizes inorganic sulfur instead of cysteine. Most microorganisms synthesize methionine via either one of these pathways, but C. glutamicum utilizes both [15]. The final step of the l-methionine biosynthesis is the methylation of l-homocysteine (Fig. 1). The transcriptional regulator McbR encoded by the gene mcbR represses the transcription of almost all genes in the l-methionine biosynthetic pathway [16] and restricts the levels of the corresponding proteins [17] in C. glutamicum. Therefore, deletion of mcbR should lead more metabolic pool to the l-methionine biosynthesis in C. glutamicum. So far, only a couple of l-methionine–producing C. glutamicum strains have been developed [10, 18] from l-lysine– producing strains, but no l-methionine–producing strains have been developed directly from wild-type C. glutamicum. In this study, we developed an l-methionine–producing strain QW102/pJYW-4-homm -lysCm -brnFE from wild-type C. glutamicum ATCC13032 by deleting two genes and overexpressing four genes. QW102/pJYW-4-homm -lysCm -brnFE could produce more l-methionine than the strain MH20–22B derived from l-lysine–producing C. glutamicum strain [10]. Because QW102/pJYW-4-homm -lysCm -brnFE was derived from wildtype C. glutamicum with a clear genetic background, it could be further improved for more l-methionine production.

2. Materials and Methods 2.1. Strains and growth conditions Strains and plasmids used in this study are listed in Table 1. E. coli was grown in Luria–Bertani (LB) medium (5 g/L yeast extract, 10 g/L tryptone, and 10 g/L NaCl) at 37◦ C, and C. glutamicum was grown at 30◦ C in LBG medium (LB medium supplemented with 5 g/L glucose). CGXII minimal medium (20 g/L (NH4)2 SO4 , 5 g/L urea, 1 g/L KH2 PO4 , 1 g/L K2 HPO4 , 0.25 g/L MgSO4 ·7H2 O, 42 g/L MOPS, 10 mg/L MnSO4 ·1H2 O, 10 mg/L FeSO4 ·7H2 O, 1 mg/L ZnSO4 ·7H2 O, 0.2 mg/L CuSO4, 0.02 mg/L NiCl2 ·6H2 O, 40 g/L glucose, 1 mg/L sodium citrate, and 0.2 mg/L biotin) was used for auxotroph selection [19]. Modified Epo medium (10 g/L trypton, 5 g/L yeast extract, 10 g/L NaCl, 30 g/L glycine, and 0.1% Tween 80) was used for preparing competent cells of C. glutamicum [20]. LBHIS medium (5 g/L trypton, 5 g/L NaCl, 2.5 g/L yeast extract, 18.5 g/L Brain Heart Infusion powder, and 91 g/L sorbitol) was used for C. glutamicum transformation [20]. When necessary, 30 mg/L kanamycin or 15 mg/L chloramphenicol was added in the medium.

L-Methionine–Producing

C. glutamicum Strain

Bacterial strains and plasmids used in this study

TABLE 1 Strain or plasmid

Description

Source

Strains DH5α

Wild-type E. coli

Novagen

ATCC13032

Wild-type C. glutamicum

ATCC

QW101

ATCC13032thrB

This work

QW102

ATCC13032thrBmcbR

This work

QW101/pJYW-4-homm -lysCm

QW101 expressing homm and lysCm

This work

QW102/pJYW-4-homm -lysCm

QW102 expressing homm and lysCm

This work

QW102/pJYW-4-homm -lysCm -brnFE

QW102 expressing homm , lysCm , and brnFE

This work

pBluescript II SK(+)

Cloning vector

Stratagene

pJYW-4

Shuttle vector between C. glutamicum and E. coli

[24]

pDTW-109

Vector carrying cre

Plasmids

[22] r

pDTW-202

pBluescript II SK(+) carrying the segment loxp-kan-loxp, Amp

[22]

pMD18-T

Cloning vector, Ampr

Takara

m

m

pMD18-T-hom

pMD18-T carrying hom

pMD18-T-lysCm

pMD18-T carrying lysCm

m

pJYW-4-hom -lysC

m

m

This work This work m

r

pJYW-4 carrying hom and lysC , Km

This work

pJYW-4-homm -lysCm -brnFE

pJYW-4 carrying homm , lysCm , and brnFE, Kmr

This work

pWTQ1

pBluescript II SK(+) carrying the segment thrBU-loxp-kan-loxp-thrBD

This work

pWTQ2

pBluescript II SK(+) carrying the segment mcbRU-loxp-kan-loxp-mcbRD

This work

2.2. Construction of plasmids and gene deletions in C. glutamicum ATCC 13032 Plasmids constructed in this study are listed in Fig. 2. The primers used in this study (Table 2) were designed according to the genome sequence of C. glutamicum ATCC13032 [21]. Gene disruption in C. glutamicum was performed according to the published method [22]. Fragment thrBU, located upstream on the gene thrB, was amplified from the genomic DNA of C. glutamicum ATCC13032 using primers thrBU-F and thrBU-R; fragment thrBD, located downstream on the gene thrB, was amplified using primers thrBD-F and thrBD-R; fragment loxp-kan-loxp was amplified from plasmid pDTW202 [22] using the primers kan-loxp-F and kan-loxp-R. The three DNA fragments were ligated into plasmid pBluscriptII SK(+), resulting in the plasmid pWTQ1. Similarly, the plasmid pWTQ2, in which fragments thrBU and thrBD were replaced by mcbRU and mcbRD, was constructed. Fragment mcbRU, located upstream on the gene mcbR, was amplified by primers mcbRU-F and mcbRU-R; fragment mcbRD, located downstream on the gene

Biotechnology and Applied Biochemistry

mcbR, was amplified by primers mcbRD-F and mcbRD-R. Plasmid pWTQ1 was transformed into C. glutamicum ATCC13032 to let the loxp-kan-loxp fragment replace the thrB gene through homologous recombination. The recombinant strain was selected by growing on LBHIS plates supplemented with 30 mg/L kanamycin. After incubated at 30◦ C for 24 H, the colonies grown on the plate containing kanamycin were picked and streaked on CGXII plates with or without 3 mM l-threonine, respectively. Colonies grown only on the plates with 3 mM l-threonine were further confirmed by the PCR technique, using primers thrBU-F and thrBD-R. After the target gene was replaced by the loxp-kan-loxp fragment on the chromosome, the inserted kanamycin selection marker was removed through loxp-based site-specific recombination catalyzed by Cre. Cre was expressed by the temperature-sensitive plasmid pDTW-109 [22], which was transformed into the recombinant strain and selected on LBHIS agar containing 10 mg/L chloramphenicol. After incubation at 25◦ C for 36 H, colonies were transferred into the liquid LBG medium and cultivated at 37◦ C

3

Biotechnology and Applied Biochemistry To perform the site-directed mutation, the gene hom was amplified from the genomic DNA of C. glutamicum ATCC13032 using primers hom-F and hom-R, and ligated into the vector pMD18-T (TaKaRa, Dalian, People’s Republic of China). The plasmid pMD18-T-hom was used as the template for PCR amplification, using primers homint-F and homint-R. The PCR product was digested by DpnI at 37◦ C for 1 H, and then transformed into E. coli DH5α. The mutant plasmid pMD18T-homm was confirmed by DNA sequencing. Similarly, the mutant plasmid pMD18-T-lysCm was constructed. Primers lysC-F and lysC-R were used for amplifying the gene lysC; primers lysCint-F and lysCint-R were used for the site-directed mutagenesis. The mutant gene homm was amplified from pMD18-T-homm using the primers hom-SD-F and hom-R, and the mutant gene lysCm was amplified from pMD18-T-lysCm using the primers lysC-SD-F and lysC-R. Both PCR products were ligated into the vector pJYW-4 [24], resulting in the plasmid pJYW-4-homm lysCm . Plasmid pJYW-4-homm -lysCm was transformed into C. glutamicum QW101 and QW102, resulting in QW101/pJYW4-homm -lysCm and QW102/pJYW-4-homm -lysCm , respectively. The gene cluster brnFE was amplified from the genomic DNA of C. glutamicum ATCC13032 using primers brnFE-SD-F and brnFE-R, and ligated into the plasmid pJYW-4-homm -lysCm , resulting in the plasmid pJYW-4-homm -lysCm -brnFE. The plasmid pJYW-4-homm -lysCm -brnFE was transformed into C. glutamicum QW102, resulting in QW102/ pJYW-4-homm -lysCm brnFE.

2.4. Fermentation of different C. glutamicum strains

FIG. 2

(A) Maps of plasmids pJYW-4-homm -lysCm , pJYW-4-homm -lysCm -brnFE, pWTQ1, pWTQ2. (B) The process for deleting genes thrB and mcbR. oriE, the origin of E. coli plasmid pBR322; repA and per, origin of the plasmid pGA1; Ptac, the tac promoter; amp, ampicillin-resistant gene; kan, kanamycin-resistant gene.

for 12 H to remove pDTW-109. Then the cells were streaked on an LBG agar plate without antibiotics, with kanamycin, or with chloramphenicol, respectively, and grew at 30◦ C for 24 H. The cells grew on the plate without antibiotics but not on the plates with kanamycin or chloramphenicol were chosen as the mutant strain ATCC13032thrB, renamed as QW101. Similarly, the mcbR gene in the genome of QW101 was deleted, using the plasmid pWTQ2, resulting in the strain QW101mcbR, renamed as QW102 (Fig. 2B).

2.3. Site-directed mutations in genes hom and lysC and their overexpression in C. glutamicum QW101 and QW102 The shuttle vector pJYW-4 between E. coli and C. glutamicum was constructed, based on the plasmid pEC-XK-99E [23], and used for gene overexpression in C. glutamicum strains.

4

l-Methionine production in strains ATCC13032, QW101, QW102, QW101/pJYW-4-homm -lysCm , QW102/pJYW-4-homm lysCm , and QW102/pJYW-4-homm -lysCm -brnFE was evaluated by fermentation. The seed medium contains 25 g/L glucose, 20 g/L corn steep liquor, 1 g/L KH2 PO4 , 5 g/L MgSO4 and 1.25 g/L urea. The fermentation medium contains 100 g/L glucose, 20 g/L corn steep liquor, 20 g/L (NH4)2 SO4 , 1 g/L KH2 PO4 , 0.5 g/L MgSO4 , 0.01 g/L MnSO4 , 0.01 g/L FeSO4 , 1 mg/L thiamine, 6 mg/L pyridoxine, 0.1 mg/L biotin, and 0.2 g/L cobalamine, and 20 g/L CaCO3 was added to balance the pH of the medium. For flask cultivation, strains were streaked out from frozen glycerol stocks onto LBG plates and incubated at 30◦ C for 36 H. One loop of colonies was inoculated into 50 mL seed medium in a 500-mL flask. After 18 H, the seed culture was inoculated into 50 mL fermentation medium in a 500-mL flask, and the initial optical density at 562 nm (OD562 ) was adjusted to 0.2. The culture was incubated at 30◦ C and stirred at 200 rpm for 72 H. Different concentrations of l-cysteine or lisoleucine were added in the fermentation medium to optimize the growth medium. Different buffers such as MES (for pH 6 and 6.5), MOPS (for pH 7 and 7.5), and Tris–HCl (for pH 8, 8.5 and 9) were used to optimize the pH of the growth medium. The dry cell weight (DCW) and l-methionine concentration were determined every 4 H during fermentation.

L-Methionine–Producing

C. glutamicum Strain

Primers used in this study

TABLE 2 Primer

Sequence (5 –3 )

Restriction site

mcbRU-F

GCTCTGCAGTGAAGCTCGTGGCGCCGAACT

PstI

mcbRU-R

TAGGATCCATAGACAAACCGGTTCGTATAGT

BamHI

mcbRD-F

GCATCTAGATCTTGTTCGCGATTTCTTTG

XbaI

mcbRD-R

GCCTCGAGGTGTGTTTTTAGATCTTCGGTT

XhoI

thrBU-F

ATCTCGAGGGCAAGTCTGTTGTTA

XhoI

thrBU-R

ACCTCTAGATTAGTCCCTTTCGAG

XbaI

thrBD-F

ACGGATCCCAGTCAAGGTTGAAGTT

BamHI

thrBD-R

ATCCTGCAGCTACGTGGTCTATCGC

PstI

hom-F

GCGAATTCATGACCTCAGCATCT

EcoRI

hom-SD-F

GCGAATTCAGAAGGAGACTAGTAATGACCTCAGCATCT

EcoRI

hom-R

GATGAGCTCTTAGTCCCTTTCGAG

SacI

homint-F

TGGAAGATCGCGTGGGAGTTTTGGCTGAATTGGC

homint-R

GCCAATTCAGCCAAAACTCCCCACGCGATCTTCCA

lysC-F

GCTGAGCTCGTGGCCCTGGTCGTAC

SacI

lysC-SD-F

GCTGAGCTCAGAAGGAGAGATGTTAGTGGCCCTGGTCGTAC

SacI

lysC-R

GCCTCGAGTTAGCGTCCGGT

XhoI

lysCint-F

AGGCTGATGTGCTGATCACCGAGCGC

lysCint-R

GCGCTCGGTGATCAGCACATCAGCCT

brnFE-SD-F

TAAGGATCCAGAAGGAGATATACCGTGCAAAAAACGCAAG

BamHI

brnFE-R

TACTCTAGATTAGAAAAGATTCAC

XbaI

kan-loxp-F

ATGGATCCAATACGACTCACTATAGGGCG

BamHI

kan-loxp-R

ACCTCTAGAGCGCAATTAACCCTCACTAAAG

XbaI

metXF

TACCACCAGCAAGAACACCTCTC

metXR

AGTTCCTCACGATGCGATCCATT

metYF

CAGATGCTGCTTACCACGGATT

metYR

ATGCGTTGAATGCGGAGAGG

metBF

CCAATCTATGCCTCCACCACCTT

metBR

CGGTCTGCTCTAATGCCACGAT

metCF

CGATATTGCGGCGAAGTACGAT

metCR

TTAGAAGTTGCGGTGATGGTGATG

metHF

GGTTGGAGTATCGGTGGAGACAT

metHR

CTATTGAGCAGGCGAAGAAGAAGG

metEF

CTTGGCGAACTGAACGATACGAT

Biotechnology and Applied Biochemistry

5

Biotechnology and Applied Biochemistry

Continued

TABLE 2 Primer

Sequence (5 –3 )

metER

GCTTCCTGAAGGCTCTGTTATCTAC

dapAF

GACCGACCAGGAATGTCATAGA

dapAR

TATTACTCCAAGCCGAGCCAAG

Restriction site

The restriction sites are underlined.

For fed-batch fermentation, 50 mL seed culture was first prepared in a 500-mL flask at 30◦ C for 18 H, and then transferred to a 3-L fermentor (New Brunswick Scientific BioFlo 110, Edison, NJ, USA) containing 1.2 L fermentation medium, and the initial OD562 was adjusted to 0.2. The fermentation medium was supplemented with 2 mM l-isoleucine. The pH was controlled at 6.5 by automatically adding 50% NH4 OH solution. The temperature was kept at 30◦ C. The dissolved oxygen level was controlled at 30% by adjusting agitation speed (400 rpm in the first 4 H and 600 rpm thereafter) and the aeration rate (1.5 vvm). The level of glucose was kept around 20 g/L by adding 10 g/L glucose at 48, 56, and 64 H for QW102/pJYW-4-homm -lysCm -brnFE, and 6 g/L glucose at 44, 52, and 64 H for ATCC13032, respectively. Samples were taken every 4 H for the determination of residual glucose, biomass, and amino acids.

2.5. Analysis of residual glucose, biomass, and amino acids The concentration of residual glucose was determined according to the dinitrosalicylic acid method using a SBA-40C biosensor. The biomass was determined by measuring the OD562 using the UV-1800 spectrophotometer (Shimadzu, Tokyo, Japan). The DCW was calculated according to the following formula: DCW (g/L) = 0.6495·OD562 – 2.7925 [25]. The extracellular amino acid was determined by highperformance liquid chromatography (HPLC) (Agilent Technologies 1200 series, Palo Alto, CA, USA) according to the published method [26]. The culture was centrifuged at 14,800g for 5 Min, and the supernatant was diluted by 5% TDA and incubated overnight. The solution was centrifuged at 14,800g for 10 Min, and the supernatant was filtered by filter membrane (0.22 μm). The sample was treated with 0.4 M boric acid solution containing OPA (O-phthaldialdehyde) (100 mg OPA, 9 mL boric acid solution, 1 mL acetonitrile, and 30 μL mercaptopropanoic acid). HPLC can separate 18 types of amino acids using a C18 reversed phase column. Samples were eluted with different proportions of solution A (3 g/L sodium acetate, 0.5% tetrahydrofuran, and 0.02% triethylamine, pH 7.2) and solution B (3 g/L sodium acetate, 40% methanol, and 40% acetonitrile). For the determination of intracellular amino acids, cells were grown in the fermentation medium, harvested, and disrupted by ultrasonication. Then,

6

the level of amino acids in the sample was measure by HPLC; 1 mg DCW was considered as 1.6 μL intracellular volume of cells [14].

2.6. Quantification of mRNA using RT-PCR Total RNA was extracted from the cells harvested at the late-exponential growth phase, using the Simply P Total RNA Extraction kit (BioFlux, Beijing, People’s Republic of China), and digested by DNase I to remove the contaminated DNA. The purified RNA was used as the template for synthesizing cDNA. First-strand cDNA was synthesized using the RevertAidTM First Strand cDNA Synthesis kit (Fermentas, Shanghai, People’s Republic of China). Primers of genes for RT-PCR analysis are listed in Table 2. The RT-PCR reaction was carried out by an ABI StepOne real-time PCR system (Applied Biosystems, SanMateo, CA, USA) using the Real Master Mix kit (Tiangen, Beijing, People’s Republic of China). The program for RT-PCR was 94◦ C for 1 Min, followed by 40 cycles of 94◦ C for 10 Sec, 55◦ C for 30 Sec, and 68◦ C for 15 Sec. The data were analyzed by using the 2−CT model [9].

3. Results and Discussion 3.1. Deleting thrB and overexpressing feedback-resistant genes homm and lysCm increased the precursor supply of L-methionine There are two competing biosynthetic branches downstream of l-asparate that influence the accumulation of l-methionine in C. glutamicum: one synthesizes l-lysine and the other synthesizes l-theronine (Fig. 1). Because mesodiaminopimelate produced in the biosynthetic pathway of l-lysine is involved in cell wall synthesis in C. glutamicum, disruption of this branch could be lethal. Therefore, the biosynthetic branch of lthreonine becomes the target for genetic manipulation. QW101 was constructed from C. glutamicum ATCC13032 by deleting thrB, the gene encoding HK that catalyzes the first reaction in the biosynthetic pathway of l-threonine (Fig. 2B). QW101 cells grew slower than ATCC13032 cells did (Fig. 3A); however, it accumulated more l-methionine (2.5 mM) than ATCC13032 after 72 H cultivation (Fig. 3B). l-Methionine was usually not accumulated in ATCC13032 cells, and its accumulation in QW101 indicates that some metabolic flux flew toward the l-methionine biosynthetic pathway. Meanwhile, even more increased levels of l-lysine (14 mM) and l-aspartate (18 mM)

L-Methionine–Producing

C. glutamicum Strain

FIG. 3

(A) Growth comparison of C. glutamicum strains ATCC13032, QW101, QW101/pJYW-4-homm -lysCm , QW102, QW102/pJYW-4-homm -lysCm , and QW102/pJYW-4-homm -lysCm -brnFE. (B) Extracellular concentration of several amino acids in six different C. glutamicum strains after 72 H flask cultivation. Asp, L-aspartate; Met, L-methionine; Lys, L-lysine. (C) Transcriptional analysis of the key genes in the biosynthetic pathways of L-methionine and L-lysine in C. glutamicum strain QW102. The strain QW101 was used as a control. (D) Intracellular and extracellular pools of L-methionine in strains QW102/pJYW-4-homm -lysCm and QW102/pJYW-4-homm -lysCm -brnFE. All the experiments were repeated three times and standard deviations were determined.

suggest that some metabolic flux has been consumed by the competing pathways. Therefore, the metabolic flux toward the l-methionine biosynthetic pathway needs to be further enhanced. Overexpressing the key enzymes AK and HD should draw the metabolic flux from l-lysine and l-aspartate toward the biosynthetic pathway of l-methionine (Fig. 1). AK and HD are encoded by the genes lysC and hom, respectively, but their activities could be feedback inhibited. The feedback inhibition could be released by the point mutation (T311I) in the AK encoded by lysCm and the point mutation (G377E) in the HD encoded by homm . To direct more metabolic flux to the l-methionine biosynthetic pathway, genes homm and lysCm were

Biotechnology and Applied Biochemistry

overexpressed in QW101. In flask cultivation, QW101/pJYW4-homm -lysCm showed the similar growth pattern to QW101 (Fig. 3A), but produced more l-methionine (Fig. 3B). Compared with QW101, levels of both l-lysine and l-aspartate were decreased in QW101/pJYW-4-homm -lysCm (Fig. 3B). These data indicate that deletion of thrB and overexpression of the feedback-resistant homm and lysCm could increase lmethionine production in C. glutamicum.

3.2. Double deletions of thrB and mcbR could direct more metabolic flux to the L-methionine biosynthetic pathway The transcriptional regulator McbR encoded by mcbR is involved in the regulation of l-methionine biosynthesis in C. glutamicum. McbR represses transcriptions of metX, metY, metE, metH, and metB [16] and restricts levels of the corresponding proteins in the cell [17]. Therefore, deletion of mcbR might draw the metabolic flux toward l-methionine. The gene mcbR of QW101 was deleted, resulting in the strain QW102 in which both thrB and mcbR were deleted (Fig. 2B). QW102 showed the similar growth pattern to QW101 (Fig. 3A). After 72 H flask cultivation, the maximum l-methionine production in QW102 reached 4.1 mM. Compared with QW101 (Fig. 3B), QW102 produced more l-methionine but much less l-lysine (Fig. 3B), suggesting that deletion of mcbR released the transcriptional repression of various genes in the l-methionine biosynthetic pathway and led more metabolic pool down toward the l-methionine biosynthesis. The release

7

Biotechnology and Applied Biochemistry

FIG. 4

Optimization of fermentation conditions to increase L-methionine production in QW102/pJYW-4-homm -lysCm -brnFE. (A) The growth pattern of cells in the medium containing different concentrations of cysteine (Cys). (B) The effect of cysteine on L-methionine production. (C) The growth pattern of cells at different pH. (D) The effect of pH on L-methionine production. (E) The growth pattern of cells in the medium containing different concentrations of L-isoleucine (Ile). (F) Comparison of L-methionine production in cells grown in the medium supplemented with different concentrations of L-Ile.

of the transcriptional repression in QW102 was confirmed by RT-PCR analysis, which showed that transcriptional levels of metX, metY, metE, metH, metC, and metB increased, whereas the transcriptional level of dapA encoding the key enzyme DS in the l-lysine biosynthetic pathway decreased (Fig. 3C),

8

consistent with the increased level of l-methionine and the decreased level of l-lysine in QW102 (Fig. 3B). The regulation of McbR to the transcriptional level of dapA could explain why l-lysine–producing C. glutamicum strains are good for developing l-methionine–producing strains [10]. To further induce the metabolic flux toward the l-methionine biosynthetic pathway in QW102, homm and lysCm were overexpressed, resulting in the strain QW102/pJYW-4homm -lysCm . Compared with QW102, the level of l-aspartate significantly decreased, but the level of l-methionine significantly increased in QW102/pJYW-4-homm -lysCm (Fig. 3B). These data indicate that more metabolic flux has been directed from l-aspartate toward l-methionine in QW102/pJYW-4homm -lysCm . Accumulating more l-methionine but less l-lysine in QW102/pJYW-4-homm -lysCm indicates that deletion of thrB and mcbR and overexpression of homm and lysCm are good strategies for developing l-methionine production strains.

L-Methionine–Producing

C. glutamicum Strain

FIG. 5

Fed-batch fermentation of QW102/pJYW-4-homm -lysCm -brnFE to produce L-methionine, using C. glutamicum ATCC13032 as a control. (A) Growth patterns during fermentation. (B) L-methionine productions during fermentation. (C) Glucose consumption during fermentation.

3.3. Overexpressing brnE and brnF further increased the L-methionine production in C. glutamicum The two-component protein complex BrnFE is the export system for branched-chain amino acids and l-methionine in C. glutamicum [14]. To increase the extracellular l-methionine, the gene clusters brnF and brnE encoding BrnFE in C. glutamicum were cloned into the plasmid pJYW-4-homm -lysCm (Fig. 2A) and transformed into QW102, resulting in the strain QW102/pJYW-4-homm -lysCm -brnFE. QW102/pJYW-4homm -lysCm -brnFE grew slightly slower than QW102/pJYW4-homm -lysCm (Fig. 3A), but produce more l-methionine (12.2 mM) after 72-H flask cultivation (Fig. 3B), suggesting that overexpressing BrnFE could increase l-methionine production. The levels of l-aspartate and l-lysine were much lower than l-methionine in QW102/pJYW-4-homm -lysCm -brnFE. Levels of intracellular and extracellular l-methionine in QW102/pJYW4-homm -lysCm and QW102/pJYW-4-homm -lysCm -brnFE were

Biotechnology and Applied Biochemistry

also analyzed (Fig. 3D). QW102/pJYW-4-homm -lysCm and QW102/pJYW-4-homm -lysCm -brnFE produced similar levels of l-methionine, but more l-methionine was exported in the later, indicating that overexpressing the export system BrnFE could increase l-methionine production in C. glutamicum.

3.4. Optimization of fermentation conditions to increase L-methionine production in QW102/pJYW-4-homm -lysCm -brnFE Among the five recombinant strains we constructed, QW102/pJYW-4-homm -lysCm -brnFE showed the highest level of l-methionine production, but its growth rate was the lowest. Therefore, the effect of sulfur source, pH, and l-isoleucine on the growth rate and l-methionine production of QW102/pJYW4-homm -lysCm -brnFE was investigated (Fig. 4). Because some l-methionine–producing strains preferred organic sulfur to sulfate [17], and cysteine addition to the fermentation medium could increase l-methionine yield in C. lilium mutant strain [27], the effect of cysteine on the growth rate and l-methionine production of QW102/pJYW-4-homm -lysCm -brnFE was investigated (Figs. 4A and 4B). When up to 4 mM cysteine was added in the medium, QW102/pJYW-4homm -lysCm -brnFE showed the similar growth pattern (Fig. 4A)

9

Biotechnology and Applied Biochemistry and l-methionine production (Fig. 4B), indicating that cysteine addition is not a solution to improve the cell growth and l-methionine production in QW102/pJYW-4-homm -lysCm -brnFE. The effect of pH on the growth rate and l-methionine production of QW102/pJYW-4-homm -lysCm -brnFE was investigated (Figs. 4C and 4D). QW102/pJYW-4-homm -lysCm -brnFE grew better at pH > 7 (Fig. 4C), but produced more l-methionine at pH 6.5 (Fig. 4D). At low pH, higher l-methionine production and lower growth rate were also observed in other C. glutamicum strains [28]. Based on the results, pH 6.5 was chosen for the following fermentation of QW102/pJYW-4-homm -lysCm -brnFE. Because no enough l-isoleucine caused the slow growth of l-methionine–producing E. coli strains [29], the effect of l-isoleucine addition on the growth rate and L-methionine production of QW102/pJYW-4-homm -lysCm -brnFE was investigated (Figs. 4E and 4F). QW102/pJYW-4-homm -lysCm -brnFE grew better (Fig. 4E) and produced more l-methionine (Fig. 4F) when up to 2 mM l-isoleucine was added in the medium. When 2, 3, or 5 mM l-isoleucine was added in the medium, the similar growth pattern (Fig. 4E) and l-methionine production (Fig. 4F) in QW102/pJYW-4-homm -lysCm -brnFE were observed. Based on the results, the following fermentation of QW102/pJYW-4-homm -lysCm -brnFE was conducted in the medium supplemented with 2 mM l-isoleucine.

3.5. Fed-batch fermentation of QW102/pJYW-4 -homm -lysCm -brnFE to produce L-methionine QW102/pJYW-4-homm -lysCm -brnFE was further evaluated in fed-batch fermentation (Fig. 5), using the wild-type strain C. glutamicum ATCC13032 as a control. Both strains grew slowly in the first 8 H, and then their growth rates promptly increased until 36 H when the cells entered the stationary phase (Fig. 5A), but the growth rate of QW102/pJYW-4-homm -lysCm brnFE in the log phase was lower than that of ATCC13032. In the first 8 H, l-methionine production in both strains was low; after 8 H, the l-methionine production increased with time in QW102/pJYW-4-homm -lysCm -brnFE, but did not change in ATCC13032 (Fig. 5B). The highest yield of l-methionine was 42 mM (6.3 g/L) after 64 H fermentation (Fig. 5B). Similar patterns of glucose consumption were observed in the fermentation of both strains (Fig. 5C), suggesting that glucose was mainly used to produce l-methionine in QW102/pJYW-4-homm -lysCm -brnFE, but to improve cell growth in ATCC13032. These results demonstrate that QW102/pJYW-4-homm -lysCm -brnFE is a potential C. glutamicum strain for l-methionine production. The major limitation for high yield of l-methionine in C. glutamicum QW102/pJYW-4-homm -lysCm -brnFE was the growth rate of cells (Fig. 5A). This might be improved by careful selection of the nutrient medium [30–32]. Overexpression of metX and metY in QW102 did not significantly increase l-methionine production (data not shown), suggesting that the cell might prefer the transsulfuration pathway to the direct sulfhydrylation pathway (Fig. 1). The gene metY could be strongly repressed and MetY activity dramatically declined by very low concentra-

10

tions of l-methionine, but the transcriptional repression of the gene metB and the inhibition of cystathionine-γ -synthase by methionine might be weak [15]. Cystathionine-γ -synthase also catalyzes O-acetylhomoserine and homocysteine to form homolanthionine, and it has higher affinity to homocysteine than to cysteine, leading more metabolic pool into l-homolanthionine rather than l-methionine [33]. Therefore, improving the conversion rate from l-homocysteine to l-methionine might be important for a further increase in l-methionine production in C. glutamicum QW102/pJYW-4-homm -lysCm -brnFE. In addition, synthesizing 1 mole of l-methionine in C. glutamicum requires 8 mole NADPH and 7 mole ATP [33]; therefore, increasing NADPH level [34] and improving the oxygen usage [35] might facilitate the l-methionine production in C. glutamicum QW102/pJYW-4-homm -lysCm -brnFE.

4. Conclusions l-methionine–producing strain QW102/pJYW-4-homm -lysCm brnFE was developed from C. glutamicum strain ATCC13032, using the following metabolic engineering strategies: (i) deletion of genes thrB and mcbR, (ii) overexpression of genes lysCm and homm , and (iii) overexpression of the gene cluster brnF and brnE. QW102/pJYW-4-homm -lysCm -brnFE could produce 42 mM l-methionine in fed-batch fermentation, suggesting that l-methionine–producing strains can be developed from wildtype C. glutamicum strains by rationally metabolic engineering.

5. Acknowledgements Funding was provided by grants from the National Key Basic Research Program of China (973 Program 2012CB725202), the National Natural Science Foundation of China (NSFC31370131), and the Six Talent Peaks Project of Jiangsu Province (2012SWYY-008).

6. References [1] Kumar, D., and Gomes, J. (2005) Biotechnol. Adv. 23, 41–61. [2] Lee, H. S., and Hwang, B. J. (2003) Appl. Microbiol. Biotechnol. 62, 459–467. ¨ ¨ [3] Kromer, J. O., Wittmann, C., Schroder, H., and Heinzle, E. (2006) Metab. Eng. 8, 353–369. [4] Suda, M., Teramoto, H., Imamiya, T., Inui, M., and Yukawa, H. (2008) Appl. Microbiol. Biotechnol. 81, 505–513. [5] Kim, J. W., Kim, H. J., Kim, Y., Lee, M. S., Lee, H. S. (2001) Mol. Cells 11, 220–225. [6] Wang, X., and Quinn, P. J. (2010) Prog. Lipid Res. 49, 97–107. [7] Malumbres, M., and Martin, J. F. (1996) FEMS Microbiol. Lett. 143, 103–117. [8] Yin, L., Hu, X., Xu, D., and Wang, X. (2012) Metab. Eng. 14, 542–550. [9] Wang, J., Wen, B., Chen, N., and Xie, X. (2013) Appl. Biochem. Biotechnol. 171, 20–30. [10] Park, S. D., Lee, J. Y., Sim, S. Y., Kim, Y., and Lee, H. S. (2007) Metab. Eng. 9, 327–336. [11] Schrumpf, B., Eggeling, L., and Sham, H. (1992) Appl. Microbiol. Biotechnol. 37, 566–571. [12] Dong, X., Quinn, P. J., and Wang, X. (2011) Biotechnol. Adv. 29, 11–23. [13] Kind, S., Becker, J., and Wittmann, C. (2013) Metab. Eng. 15, 184–195. [14] Kennerknecht, N., Sahm, H., Yen, M. R., and Eggeling, L. (2002) J. Bacteriol. 184, 3947–3956.

L-Methionine–Producing

C. glutamicum Strain

[15] Hwang, B. J., Yeom, H. J., Kim, Y., and Lee, H. S. (2002) J. Bacteriol. 184, 1277–1286. [16] Rey, D. A., Nentwich, S. S., Koch, D. J., and Kalinowski, J. (2005) Mol. Microbiol. 56, 871–887. ¨ [17] Rey, D. A., Puhler, A., and Kalinowski, J. (2003) J. Biotechnol. 103, 51–65. [18] Figge, R. M. (2007) In: Amino Acid Biosynthesis: Pathways, Regulation and Metabolic Engineering, Vol. 5 (Wendisch, V. F., ed.). pp. 163–193, Springer, Berlin, Germany. [19] Keilhauer, C., Eggeling, L., and Sahm, H. (1993) J. Bacteriol. 175, 5595–5603. [20] Van der Rest, M. E., Lange, C., and Molenaar, D. (1999) Appl. Microbiol. Biotechnol. 52, 541–545. [21] Kalinowski, J., Bathe, B., Bartels, D., Bischoff, N., and Tauch, A. (2003) J. Biotechnol. 104, 5–25. [22] Hu, J., Tan, Y., Li, Y., Hu, X., Xu, D., and Wang, X. (2013) Plasmid 70, 303–313. [23] Kirchner, O., and Tauch, A. (2003) J. Biotechnol. 104, 287–299 [24] Hu, J., Li, Y., Zhang, H., Tan, Y., Wang, X. (2014) Plasmid 75, 18–26. [25] Yin, L., Shi, F., Hu, X., Chen, C., and Wang, X. (2013) J. Appl. Microbiol. 114, 1364–5072.

Biotechnology and Applied Biochemistry

´ Varga, Z., and Molnar-Perl, } os, ¨ A., ´ [26] Kor I. (2008) J. Chromatogr. 1203, 146–152. [27] Kumar, D., Subramanian, K., Bisaria, V. S., Sreekrishan, T. R., and Gomes, J. (2005) Bioresour. Technol. 96, 287–194. ¨ ¨ ¨ [28] Follmann, M., Ochrombel, I., Kramer, R., Trotschel, C., Poetsch, A., Ruckert, ¨ C., Huser, A., Persicke, M., Seiferling, D., Kalinowski, J., and Marin, K. (2009) BMC Genomics 10, 621–643. [29] Tuite, N. L., Fraser, K. R., and O’Byrne, C. P. (2005) J. Bacteriol. 187, 4362–4371. [30] Banik, A. K., and Majumdar, S. K. (1974) Indian J. Exp. Biol. 12, 363–368. [31] Mondal, S., and Chatterjee, S. P. (1994) Acta Biotechnol. 14, 199–204. [32] Roy, S. K., Biswas, S. R., Nishra, A. K., and Nanda, G. (1989) J. Microb. Biotechnol. 4, 35–41. ¨ ¨ [33] Kromer, J. O., Heinzle, E., Schroder, H., and Wittmann, C. (2006) J. Bacteriol. 188, 609–618. [34] Shi, F., Li, K., Huan, X., and Wang, X. (2013) Appl. Biochem. Biotechnol. 171, 504–521. [35] Xu, M., Rao, Z., Jin, J., and Xu, Z. (2011) Appl. Biochem. Biotechnol. 163, 707–719.

11