SHOCK, Vol. 41, No. 2, pp. 123Y129, 2014
MESENCHYMAL STEM CELLS AMELIORATE SEPSIS-ASSOCIATED ACUTE KIDNEY INJURY IN MICE Cong-juan Luo, Fu-jian Zhang, Li Zhang, Yan-qiu Geng, Qing-gang Li, Quan Hong, Bo Fu, Fei Zhu, Shao-yuan Cui, Zhe Feng, Xue-feng Sun, and Xiang-mei Chen State Key Laboratory of Kidney Diseases, Department of Nephrology, Chinese PLA General Hospital and Medical School of Chinese PLA, Beijing, People’s Republic of China Received 26 Aug 2013; first review completed 11 Sep 2013; accepted in final form 23 Oct 2013 ABSTRACT—Objective: Significant progress has been made in critical care medicine during the past several decades. However, the mortality rate is still high in patients with sepsis, especially with acute kidney injury (AKI). Mesenchymal stem cells (MSCs) possess an ability to ameliorate renal injury from ischemia-reperfusion, but it is still unknown whether they have the ability to reduce sepsis-associated AKI. Methods: Male C57BL/6 mice underwent cecal ligation and puncture operation to induce sepsis and then received either normal saline or MSCs (1 106 cells intravenously) 3 h after surgery. Results: Within 24 h after cecal ligation and puncture operation, the septic mice developed kidney injury and exhibited a higher mortality. Treatment with MSCs decreased serum creatinine and blood urea nitrogen levels and improved recovery of tubular function. mRNA levels of interleukin 6 (IL-6), IL-17, tumor necrosis factor !, interferon +, CXCL1, CXCL2, CXCL5, CCL2, and CCL3 in kidney tissue were dramatically decreased after MSC treatment. Neutrophil infiltration in kidney and blood bacterial loads were attenuated after MSC injection. Moreover, mice treated with MSCs had a higher survival rate than the saline treatment group. Injected MSCs were mainly localized in the lungs, spleen, and abdominal cavity lymph node, but not in the kidneys. Conclusions: Treatment with MSCs can alleviate sepsis-associated AKI and improve survival in mice with polymicrobial sepsis. These effects may be mediated by the inhibition of IL-17 secretion and balance of the proinflammatory and anti-inflammatory states. Mesenchymal stem cells may be a potential new therapeutic agent for the prevention or reduction of sepsis-associated AKI. KEYWORDS—Cecal ligation and puncture, mesenchymal stem cells, sepsis, acute kidney injury, interleukin 17
INTRODUCTION
volved in neutrophil recruitment via the production of several cytokines and CXC chemokines, such as CXCL1, CXCL5, and macrophage inflammatory protein 2 (CXCL2) (5Y8). The receptor for IL-17 is expressed in various types of cells, such as endothelial cells, macrophages, and stromal cells. These cells produce diverse proinflammatory cytokines and chemokines in response to IL-17, which mediates inflammation and induces neutrophil recruitment to inflammatory sites (8). This suggests that IL-17 plays a uniquely powerful role in the inflammatory system. Thus, it is not surprising that the IL-17 family has been shown to be involved in various physiological and pathophysiological processes including sepsis (9, 10). The level of IL-17 gradually increases in serum during the inflammatory responses to sepsis, further suggesting that IL-17 could be an important pathogenic factor in SA-AKI. Inhibition of the action of IL-17 may therefore be a new direction for the treatment of SA-AKI. However, little is known about the proinflammatory effect of IL-17 in SA-AKI. Mesenchymal stem cells (MSCs) have been shown to secretion of paracrine-acting angiogenic, trophic, anti-inflammatory, and immunomodulatory factors. Accordingly, MSC-based therapies are being evaluated for treatment of ischemic, inflammatory, and immunological disorders (11). Previous studies indicated that injection of MSCs both ameliorates renal injury and accelerates repair, such as ischemia-reperfusion (IR) or cisplatin-induced damage (12, 13). Several lines of evidence suggest that MSCs may also exhibit immunosuppressive or immunomodulatory properties, such as inhibition of !"T-cell and natural killer cell proliferation induced by mitogens or cognate peptides (14, 15). Mesenchymal stem cells also inhibit the differentiation and maturation of dendritic cells (16, 17). Moreover, MSCs are potent
Sepsis is one of the leading causes of death in the worldwide, particularly in the developing countries, and the costs to health care systems are huge (1). Sepsis is the most common cause of death in the intensive care unit, and sepsis-associated acute kidney injury (SA-AKI) is an independent risk factor for mortality. Its occurrence increases the complexity and costs of treatment (2). Currently, there are no effective methods to treat or prevent SA-AKI. Therefore, new ways to prevent SA-AKI are urgently needed. The pathophysiology of sepsis includes interactions between the microbial pathogen and the host immune system, as well as inflammatory and coagulation responses (3). However, our understanding of the pathogenesis of SA-AKI is still limited. In the past few years, most related studies have focused on hemodynamic factors after bacterial invasion. Recently, new mediators, such as interleukin 17 (IL-17), have been discovered in sepsis. Interleukin 17 is mainly produced by T cells known as TH17, +%T cells (4). It has been demonstrated that IL-17 is inAddress reprint requests to Li Zhang, No. 28 Fuxing Rd, Beijing, 100853, People’s Republic of China. E-mail: [email protected]. Co-correspondence: Xiang-mei Chen, No. 28 Fuxing Rd, Beijing, 100853, People’s Republic of China; E-mail: [email protected]. Luo and F. Zhang contributed equally to this study. This research was supported by a grant from the National Basic Research Program of China (2011CB944000), the Fund of Chinese PLA 12th Five-Year Plan for Medical Sciences (BWS11J027), National Natural Science Foundation of China (81170643), the Fund of National Key Technology R&D Program (2011BA110B00), and the Fund of Beijing Municipal Science & Technology Commission (Z131107002213011). The authors declare no conflicts of interest. DOI: 10.1097/SHK.0000000000000080 Copyright Ó 2013 by the Shock Society
123
Copyright © 2013 by the Shock Society. Unauthorized reproduction of this article is prohibited.
124
SHOCK VOL. 41, NO. 2
LUO ET
suppressors of +%T-cell proliferation, cytokine production, and cytolytic responses in vitro (18). Previous studies have shown that MSCs can ameliorate experimental sepsis and sepsis-induced acute lung injury (19, 20). Because acute lung injury, SA-AKI, and sepsis are all associated with an exaggerated inflammatory response, we hypothesized that MSCs would exert a beneficial effect in polymicrobial model of sepsis and SA-AKI. This study was designed to examine the beneficial effect of MSCs in SAAKI mice. To investigate the mechanism by which MSCs exert their therapeutic effect in SA-AKI mice, we examined the inflammatory status of serum and kidney tissue, specifically the levels of the cytokine IL-17 and its related chemokines. MATERIALS AND METHODS Animals Male C57Bl/6 mice weighing 25 to 30 g were housed in an animal facility with 12-h light-dark cycle at 22-C and free access to food and water. They were acclimated for 1 week before conducting experiments. All experimental procedures were approved by the Ethics Committee of The General Hospital of the People’s Liberation Army.
Culture of MSCs C57Bl/6 mouse bone marrowYderived MSCs/red fluorescent protein (RFP) were purchased from Cyagen Biosciences (Sunnyvale, Calif). The culture process was initiated according to the manufacturer’s instructions. The sixth, eighth, and tenth passage MSCs were used for experiments.
Mouse model of cecal ligation and puncture Cecal ligation and puncture (CLP)Yinduced sepsis was generated as described previously (21). Mice were anesthetized with 2% pentobarbital, and a 1- to 2-cm midline incision was made along the linea alba of the abdominal muscle to isolate and exteriorize the cecum. Seventy-five percent of the cecum was ligated with a 4-0 silk suture, and the cecum was punctured twice with a 21-gauge needle. A small amount (droplet) of feces was gently extruded from the penetration holes to ensure patency. The cecum was then returned to the peritoneal cavity, and the abdominal incision was closed with 4-0 silk sutures. After the operation, 1 mL prewarmed normal saline was administered into the peritoneal cavity. In the sham group, mice underwent the same procedure but were neither ligated nor punctured. After 3 h of CLP, mice were injected 1 106 MSCs in 0.2 mL normal saline by tail vein (22). As a control, the CLP mice were administered only 0.2 mL normal saline. Mice were divided into three groups: sham, CLP, and CLP + MSCs.
AL.
Plates were incubated for 24 h at 37-C under aerobic conditions; colony enumeration was then counted and multiplied by the dilution factor.
Assessment of kidney injury Kidney injury was assessed by measuring the levels of serum creatinine and blood urea nitrogen and calculating the changes in levels. Blood samples were collected from the vena cava at the indicated time points (n = 10 in each group), and the serum was separated by centrifugation at 3,000 revolutions/min for 15 min at 4-C and then stored at j20-C until use.
Histopathology Kidneys were harvested at 24 h after CLP. Specimens were fixed in 10% formaldehyde for at least 24 h. After dehydration in a series of ascending concentrations of ethanol, the samples were embedded in paraffin and then sectioned at 3-mm thickness for staining with periodic acidYSchiff. Stained sections were observed by light microscopy (Olympus IX71, Tokyo, Japan) at a magnification of 400 and were evaluated by three independent pathologists. Histological examinations for acute tubular necrosis were semiquantified using the following scoring system as described previously (22): 0 = none, 1 = less than 10%; 2 = 11% to 25%, 3 = 26% to 45%, 4 = 46% to 75%, and 5 = greater than 76%.
Enzyme-linked immunosorbent assay Animals were anesthetized and killed at 24 h (n = 6 per group). Specific detection of IL-6, IL-17, tumor necrosis factor ! (TNF-!), interferon + (IFN-+), and IL-10 was accomplished by sandwich enzyme-linked immunosorbent assay according to the manufacturer’s instructions (R&D Systems, Minneapolis, Minn).
Real-time polymerase chain reaction Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, Calif) following the manufacturer’s instructions. The TaqMan Reverse Transcription Kit (Applied Biosystems, Foster City, Calif) and a Gene Amp polymerase chain reaction (PCR) System 9700 (Applied Biosystems) were used for generation of cDNA. Polymerase chain reaction was performed with the SYBR Green Mastermix and a 7500 Real-time PCR System (Applied Biosystems). Results were analyzed by the 2j$$CT method with normalization to glyceraldehyde 3-phosphate dehydrogenase expression (n = 6 for each group). The primers used are listed in Table 1.
Immunofluorescence studies of kidney samples For use in immunofluorescence studies, 4-Hm-thick sections were cut and then incubated overnight with rat anti-Ly6G (1:100; Santa Cruz Biotechnology, Santa Cruz, Calif) antibody in a humidified chamber. After washing with phosphatebuffered saline, secondary antibodies conjugated with fluorescein isothiocyanate goat antiYrat immunoglobulin G (1:50; Jackson ImmunoResearch Laboratories; West Grove, Pa) were applied for 1 h at room temperature in a darkened humidified chamber. Nuclei were stained with DAPI (Zhongshan Goldenbridge Biotechnology, Beijing, China). Each tissue section was observed with light microscopy at a magnification of 400 (n = 6 for each group).
Survival study Survival after surgery was assessed every 24 h for 7 days with n = 20 in each group.
Bacterial load determination Blood was obtained from the vena cava at 24 h after CLP surgery (n = 6 in each group). Following 1:3 dilution in sterile phosphate-buffered saline, 100 HL samples were plated on 5% sheep blood agar plates (Remel, Lenexa, Kans).
Two-photon fluorescence confocal imaging of MSCs after injection We traced the distribution of MSCs after injection with a Leica two-photon fluorescence confocal imaging TCS SP5 system (Leica Microsystems, Mannheim, Germany). Mice were killed at 3, 6, 12, 18, and 24 h (n = 3 in each group at each time point; experiments repeated three times). Fresh, thick tissues of the right lung, right lower liver, spleen, and peritoneal cavity lymph node were sampled.
TABLE 1. Primers used for real-time PCR Gene
Forward primers (5¶-3¶)
Reverse primer (5¶-3¶)
IL-17
TGGACTCTCCACCGCAATG
TGGGGGTTTCTTAGGGGTCA
IL-6
AGTCAATTCCAGAAACCGCTATG
ACAGGTCTGTTGGGAGTGGT
CTACTGAACTTCGGGGTGAT
CAGGCTTGTCACTCGAATT
TNF-! IL-10 CXCL1
AGGCAGCCTTGCAGAAAAGA
GCTCCACTGCCTTGCTCTTA
TGGCTGGGATTCACCTCAAGAACA
TGTGGCTATGACTTCGGTTTGGGT
CXCL2
GAAGTCATAGCCACTCTCAAGG
TTCCGTTGAGGGACAGCA
CXCL5
CGTAACTCCAAAAATTAATCCCAAA
CGAGTGCATTCCGCTTAGCT
CCL2
AGCACCAGCCAACTCTCACT
CGTTAACTGCATCTGGCTGA
CCL3
CATCGTTGACTATTTTGAAACCAG
GCCGGTTTCTCTTAGTCAGGAA
Copyright © 2013 by the Shock Society. Unauthorized reproduction of this article is prohibited.
SHOCK FEBRUARY 2014
SEPSIS AND AKI TREATMENT WITH MSCS
125
vacuolization in the proximal tubules. Treatment with MSCs ameliorated the morphological damage and reduced the tubular injury score (P G 0.05; Fig. 3, CYF). Taken together, our data showed that CLP-induced polymicrobial sepsis resulted in AKI, and treatment with MSCs reduced the degree of AKI. Effect of treatment with MSCs on the expression of cytokines in plasma
The CLP surgery led to significant increases in plasma levels of proinflammatory cytokines, including IL-6, IL-10, IL-17, IFN-+, and TNF-! (Fig. 4), which are all indicators of the immune inflammatory status. Treatment with MSCs significantly decreased the level of IL-17, IL-6, IFN-+, and TNF-! in plasma at 24 h (P G 0.05) compared with the CLP group. However, the level of IL-10 was significantly increased (P G 0.05) compared with that in the CLP group. FIG. 1. Mesenchymal stem cells improve the survival rate of CLP model mice. Each group consisted of 20 animals. Kaplan-Meier curves represent the survival rate in each group. The survival rate at 7 days was significantly higher in the MSC group than the normal saline (NS) group; *P G 0.05.
Effect of treatment with MSCs on renal mRNA expression of cytokines and chemokines
In the absence of antibiotic therapy, we attempted to investigate whether the mice injected with MSCs show any improvement in terms of survivability. The survival rate of the CLP group was only 30% at 7 days, whereas it increased by nearly 100% in the MSC treatment group (58% mice surviving) (Fig. 1). Treatment with MSCs significantly improved the survival rate compared with that in septic mice that received normal saline (P G 0.05).
To investigate whether MSC treatment could directly affect local renal production of cytokines and chemokines, we examined the renal level of these cytokines using reverse transcriptaseYPCR. Our results showed that the mRNA expression levels of IL-17, IL-6, IFN-+, TNF-!, and IL-10 were significantly increased in both the CLP and MSC treatment groups at 24 h (Fig. 5). Compared with the untreated CLP group, treatment with MSCs decreased the expression levels of IL-17, IL-6, IFN-+, and TNF-! (P G 0.05), but increased the expression level of IL-10 (P G 0.05; Fig. 5). Previous studies showed that IL-17 in peritoneal fluid plays a critical role during severe polymicrobial sepsis. We speculated that IL-17 might play an important role in SA-AKI. We examined the mRNA expression levels in the kidney of the chemokines related to IL-17 function using reverse transcriptaseYPCR. The levels of CXCL1, CXCL2, CXCL5, CCL2, and CCL3 were dramatically increased in the CLP group and were significantly decreased by treatment with MSCs (P G 0.05; Fig. 5).
Effect of treatment with MSCs on bacterial load of CLP-induced septic mice
Effect of treatment with MSCs on the infiltration of inflammatory cells
To understand the mechanism of intravenous injection of MSCs on CLP-induced septic mice, we examined blood bacterial load in CLP mice at 24 h after CLP injury. Mice that received MSCs 3 h after CLP surgery exhibited significantly lower blood bacterial load compared with mice that received normal saline (P G 0.05; Fig. 2).
To test whether neutrophil infiltration plays a role in our model, we examined the degree of neutrophil infiltration in the
Statistical analyses Data are expressed as mean T SEM. Multiple comparisons of parametric data were performed using one-way analysis of variance followed by Student-NewmanKeuls post hoc tests. Expression levels of mRNA were calculated using the 2j$$CT method. Survival of the two subgroups was estimated using a Kaplan-Meier analysis. Analyses were completed using SPSS for Windows (version 10.1; SPSS, Chicago, Ill). Statistical significance was defined as P G 0.05.
RESULTS Effect of treatment with MSCs on the survival of CLP-induced septic mice
Effects of treatment with MSCs on SA-AKI
Sepsis-associated AKI was determined by measuring biochemical indicators in blood samples taken at 24 h. Levels of blood urea nitrogen and serum creatinine increased in mice with CLP-induced sepsis (269 T 46 and 0.82 T 0.16 mg/dL, respectively) compared with the sham group (25.2 T 3.83 and 0.11 T 0.01 mg/dL, respectively), indicating the development of AKI. Mesenchymal stem cell treatment dramatically reduced serum creatinine and blood urea nitrogen levels (P G 0.05; Fig. 3, A and B), compared with mice that received normal saline. Morphological changes in the CLP group were scored 24 h after MSC treatment by brush border loss, tubular degeneration, and
FIG. 2. Mesenchymal stem cells inhibit CLP-induced blood bacterial load. Blood samples were taken 24 h after CLP operation and cultured on 5% sheep blood agar plates. The numbers of bacterial colonies were counted after 24 h of incubation. Data are presented as means T SEM. *P G 0.01 vs. sham; #P G 0.05 vs. CLP + NS.
Copyright © 2013 by the Shock Society. Unauthorized reproduction of this article is prohibited.
126
SHOCK VOL. 41, NO. 2
LUO ET
AL.
FIG. 3. Mesenchymal stem cells ameliorate SA-AKI. Treatment with MSCs significantly reduced serum creatinine (SCr) and blood urea nitrogen (BUN) levels 24 h after CLP injury compared with levels in sepsis mice treated with NS. Moreover, MSC therapy improved tubular injury and reduced acute tubular necrosis (ATN) scores 24 h after CLP. For SCr, BUN, and ATN scores, values are means T SEM; n = 10 in each group. *P G 0.05 vs. CLP + NS; #P G 0.05 vs. sham.
kidney using immunofluorescence. In the sham group, there was no detectable Ly-6GYpositive cell infiltration (Fig. 6A). In the CLP group, there were many Ly-6GYpositive cells in the renal tissue (Fig. 6B). These cells were mainly detected in the renal cortex, including the glomerulus and tubulointerstitium. Compared with the CLP group, the MSC-treated group exhibited less neutrophil infiltration (Fig. 6, C and D). Distribution of intravenously infused MSCs
The location of MSCs should aid in the elucidation of the molecular mechanism by which MSCs alleviate the damage that occurs during SA-AKI. Two-photon microscopy was used to evaluate the distribution of RFP-labeled MSCs after injection into the mice with CLP surgery. Images were acquired at 3, 6, 12, and 24 h after cell injection. Mesenchymal stem cells were mainly found in the spleen, lymph nodes, and lung after injection and persisted for at least 24 h with nearly no signal detected in the kidney throughout this period (Fig. 7). These results suggest that MSCs perform their protective function through paracrine secretions rather than cell-to-cell contacts. DISCUSSION The results from the present study show that bone marrowYderived MSCs moderate SA-AKI and reduce mortality in a clinically relevant model of polymicrobial sepsis induced by CLP. The improvement in SA-AKI was associated
with an overall reduction in the inflammatory response, specifically a reduced production of IL-17. Mesenchymal stem cells have been shown previously to preserve renal function after CLP in mice when administered up to 24 h before CLP (23). Those studies were extended here by determining the effects of MSCs when administered 3 h after the onset of CLP. Mesenchymal stem cells injected 3 h after CLP injury still have beneficial effects. Because treatments for septic patients usually begin after the onset of symptoms, Therefore, our results might be more relevant in guiding the clinical treatment of sepsis and SA-AKI. In our study, we found that MSCs significantly reduced CLPinduced blood bacterial load, consistent with previous findings that MSCs have the ability to reduce bacterial burden in inflammation model. Mei et al. (24) showed that MSCs have the ability to reduce organ and peritoneal space bacterial burden in CLP model. Krasnodembskaya et al. (25) reported that MSCs as well as their conditioned medium possess direct antimicrobial activity in Escherichia coli pneumonia mice model, which is mediated in part by the secretion of LL-37. Although we did not examine the change of phagocytic capacity after MSC injection in CLP mice, we found reduced neutrophil infiltration in kidney and protective effect of SA-AKI after MSC treatment. Therefore, we speculated that MSCs might secrete antimicrobial peptides to reduce circulating bacterial loads in CLP mice model. The pathogenesis of SA-AKI is not well understood. The inflammatory response inherent to sepsis has been examined as a
FIG. 4. Mesenchymal stem cells reduce the production of proinflammatory cytokines and increase the release of anti-inflammatory cytokines in plasma. Enzyme-linked immunosorbent assay was used to quantify the proinflammatory cytokines IL-17, IL-6, IFN-+, and TNF-! and the anti-inflammatory cytokine IL-10 in the plasma of each group at 24 h after CLP injury. n = 6 for each group. Data are presented as means T SEM. *P G 0.01 vs. sham and #P G 0.05 vs. CLP.
Copyright © 2013 by the Shock Society. Unauthorized reproduction of this article is prohibited.
SHOCK FEBRUARY 2014
SEPSIS AND AKI TREATMENT WITH MSCS
127
FIG. 5. Mesenchymal stem cells reduce proinflammatory and promote anti-inflammatory gene transcriptional activity in the septic kidney. The mRNA expression of the inflammatory cytokines IL-10, IL-17, IL-6, IFN-+, and TNF-! and chemokines CXCL1, CXCL2, CXCL5, CCL2, and CCL3 in kidney tissue 24 h after CLP operation. *P G 0.01 vs. sham and #P G 0.05 vs. CLP.
direct mechanism of AKI. The kidney is particularly sensitive to mediator-induced damage. In this study, we demonstrated that not only the plasma levels of TNF-!, IL-6, IFN-+, IL-17, and IL-10 significantly increased in parallel with the kidney injury, but also the mRNA levels of these cytokines in renal tissue increased at 24 h after CLP injury. These results show that the status of inflammation plays an important role in the pathogenesis of sepsis and SA-AKI. Interleukin 17 has been found to be elevated in a variety of inflammatory conditions. Our results show that the level of IL-17 in serum was significantly increased along with the CLP operation, especially at 24 h after CLP. The mRNA level of IL-17 in the kidney was also significantly increased at this time point. The infiltration of neutrophils in AKI has been demonstrated in previous studies (26, 27). Neutrophil infiltration was increased in the kidneys in our model. Levels of chemokines related to IL-17, such as CXCL1, CXCL2, CXCL5, CCL2, and CCL3, were also increased. Interleukin 17 acts on various cell types, including neutrophils, fibroblasts, epithelial cells, and endothelial cells. It also induces the expression of proinflammatory mediators such as IL-6, CXC chemokines, and matrix metalloproteinases (28, 29). Moreover, IL-17 has been reported to be a major orchestrator of sustained neutrophil mobilization and its associated activity through the induction of specific cytokines and colony-stimulating factors in resident lung cells (30). Collectively, this recruitment of neutrophils by IL-17 seems, in
part, to be regulated by enhanced expression of chemokines (31). In our study, the levels of IL-17 and the recruitment of neutrophils in the kidney were all significantly increased. Therefore, IL-17 may be an important pathogenic factor in SA-AKI, and inhibiting IL-17 could be a new therapeutic target for the treatment of SA-AKI. Interleukin 10 is a potent inhibitory cytokine that downregulates the monocyte inflammatory and procoagulant responses. Elevated levels of IL-10 have been detected in serum of patients with sepsis and after injection of lipopolysaccharide in mice. In our study, we also found increased levels of IL-10. It has been proposed that endogenously produced IL-10 serves a protective function in models of endotoxic shock. Thus, induction of IL-10 may be a protective measure. Treatment with MSCs in an IR injury model resulted in significantly decreased expression levels of proinflammatory cytokines, such as IL-1", TNF-!, and IFN-+ 24 h after IR injury and improved renal function (32, 33). Here we found that injection of MSCs 3 h after CLP led to decreased expression of TNF-!, IFN-+, and IL-6, but increased IL-10 levels in both the plasma and renal tissues. Treatment with MSCs can reduce the serum and kidney tissue expression of IL-17 and IL-17Yrelated chemokines. It can also reduce the infiltration of neutrophils in the CLP kidney. In this regard, our results are in line with previous reports that MSCs decrease proinflammatory cytokines and increase anti-inflammatory cytokines, which may explain their
FIG. 6. Mesenchymal stem cells reduce the infiltration of neutrophils in kidney. Histological sections of kidney from every group were subjected to immunofluorescence staining, and the number of positive cells was counted in five high-power fields per section (original magnification 400). Values represent means T SD (n = 6). #P G 0.05 vs. CLP.
Copyright © 2013 by the Shock Society. Unauthorized reproduction of this article is prohibited.
128
SHOCK VOL. 41, NO. 2
LUO ET
AL.
FIG. 7. Distribution of intravenously infused MSCs. Infused RFP-labeled MSCs were not detected in the kidney at any time point but persisted in spleen, peritoneal cavity lymph node, and lung during the entire experimental course, at least for 24 h after CLP.
beneficial effects in SA-AKI. However, the detailed mechanisms of MSCs are unknown. Previous study showed that MSCs were able to suppress the proliferation and activation of CD4+ T cells and suppress CD4+ T cells differentiate into TH1 and TH17 cells. These suppressive effects were associated with the increase in CD4+CD25+Foxp3+ regulatory T cells and IL-10 secretion (34). Mesenchymal stem cells also could inhibit TH17 cell differentiation by IL-10 secretion (35). Duffy et al. (36) showed that MSC inhibition of TH17 cell differentiation is triggered by cell-cell contact. Jung et al. (37) showed that MSCs protected pancreatic function through reducing the infiltration of CD3+ T cells and upregulating Foxp3+ regulatory T cells into the injured pancreatic tissue in pancreatitis rat models. In our study, even though we did not examine the changes of immune cells after the MSC intervention, we found that MSCs could balance the status of inflammation and MSCs mainly homed to lymphoid organs. Therefore, we speculate that MSCs may directly interact with lymphocytes and regulate the secretion of IL-17 and IL-10. Our results may provide new insights into the endogenous immune responses after SA-AKI in mice treated with MSCs. How MSCs exert their beneficial effects is presently poorly understood. Studies suggest that the distribution of MSCs might be essential for its beneficial effect. A previous study reports that MSCs can home to the damaged kidney to protect the kidney from further injury (33). However, recent studies found that intravenously injected MSCs mainly homed to the lungs and liver (22, 23). In this study, intravenously infused MSCs mainly accumulated in the lungs as Bemboli[ and in the spleen and lymph node as Bdebris.[ The reason that the vast majority of intravenously injected MSCs accumulated in the lungs is unknown. We propose that the tissue-specific distribution may be due to the size of MSCs relative to pulmonary capillaries, which may prevent MSCs from passing through the pulmonary circulation. Mesenchymal stem cells accumulated in the spleen and lymph node as Bdebris[ because MSCs were damaged by local macrophages. Although MSCs can protect
against SA-AKI, no MSCs were observed in the injured kidney. In this study, we also demonstrated for the first time that intravenously injected MSCs accumulated in the peritoneal cavity lymph node. Our previous studies found that MSCs attenuated ischemic AKI by inducing regulatory T cells through splenocyte interactions (22). Therefore, we speculate that the protective effect of MSCs in SA-AKI occurs by paracrine secretions, rather than cell-to-cell contacts. This may also occur through interactions with lymphoid organs, including the spleen and peritoneal cavity lymph node, which modulate inflammatory or immune reactions. There are some limitations in our study. Although we observed decreased levels of IL-17 and related cytokines and chemokines in renal tissues after treatment of CLP mice with MSCs, the mechanism through which MSCs regulate IL-17 remains unknown; MSCs did not home to kidney, so it is unclear how they could protect against SA-AKI. Our group has reported that MSCs might interact with splenocytes and protect against ischemic AKI, although the exact crosstalk between MSCs and splenocytes is unclear (22). In summary, our study demonstrates that treatment with MSCs could protect against SA-AKI. Interleukin 17 may be involved in the pathogenesis of SA-AKI. Injection of MSCs can reduce the expression level of IL-17 in the kidneys, which could reduce the infiltration of inflammatory cells and maintain the balance between proinflammatory and anti-inflammatory status. Based on our work, MSCs may be a potentially effective treatment for SA-AKI. REFERENCES 1. Stehr SN, Reinhart K: Sepsis as a global health problemVwhy we need a global sepsis alliance. Shock 39(Suppl 1):3Y4, 2013. 2. Filiponi TC, de Souza Dura˜o M Jr: How to choose the ideal renal replacement therapy in sepsis? Shock 39(Suppl 1):50Y53, 2013. 3. Russell JA: Management of sepsis. N Engl J Med 355(7626):1699Y1713, 2006. 4. Weaver CT, Hatton RD, Mangan PR, Harrington LE: IL-17 family cytokines and the expanding diversity of effector T cell lineages. Annu Rev Immunol 25:821Y852, 2007.
Copyright © 2013 by the Shock Society. Unauthorized reproduction of this article is prohibited.
SHOCK FEBRUARY 2014 5. Witowski J, Pawlaczyk K, Breborowicz A, Scheuren A, Kuzlan-Pawlaczyk M, Wisniewska J, Polubinska A, Friess H, Gahl GM, Frei U, et al.: IL-17 stimulates intraperitoneal neutrophil infiltration through the release of GRO chemokine from mesothelial cells. J Immunol 165(10):5814Y5821, 2000. 6. Ye P, Rodriguez FH, Kanaly S, Stocking KL, Schurr J, Schwarzenberger P, Oliver P, Huang W, Zhang P, Zhang J, et al.: Requirement of interleukin 17 receptor signaling for lung CXC chemokine and granulocyte colony-stimulating factor expression, neutrophil recruitment, and host defense. J Exp Med 194(4): 519Y527, 2001. 7. Kawaguchi M, Kokubu F, Matsukura S, Ieki K, Odaka M, Watanabe S, Suzuki S, Adachi M, Huang SK: Induction of CXC chemokines, growth-related oncogene expression, and epithelial cellYderived neutrophil-activating protein-78 by ML-1 (interleukin-17F) involves activation of Raf1Ymitogen-activated protein kinase kinase-extracellular signalYregulated kinase 1/2 pathway. J Pharmacol Exp 307(3):1213Y1220, 2003. 8. Kolls JK, Linden A: Interleukin-17 family members and inflammation. Immunity 20(4):467Y476, 2004. 9. Flierl MA, Rittirsch D, Gao H, Hoesel LM, Nadeau BA, Day DE, Zetoune FS, Sarma JV, Huber-Lang MS, Ferrara JL, et al.: Adverse functions of IL-17A in experimental sepsis. FASEB J 22(7):2198Y2205, 2008. 10. Frangen TM, Bogdanski D, Schinkel C, Roetman B, Kalicke T, Muhr G, Koller M: Systemic IL-17 after severe injuries. Shock 29(4):462Y467, 2008. 11. Boregowda SV, Phinney DG: Therapeutic applications of mesenchymal stem cells: current outlook. BioDrugs 26(4):201Y208, 2012. 12. Morigi M, Introna M, Imberti B, Corna D, Abbate M, Rota C, Rottoli D, Benigni A, Perico N, Zoja C, et al.: Human bone marrow mesenchymal stem cells accelerate recovery of acute renal injury and prolong survival in mice. Stem Cells 26(8):2075Y2082, 2008. 13. Bruno S, Grange C, Collino F, Deregibus MC, Cantaluppi V, Biancone L, Tetta C, Camussi G: Microvesicles derived from mesenchymal stem cells enhance survival in a lethal model of acute kidney injury. PLoS One 7(3):e33115, 2012. 14. Glennie S, Soeiro I, Dyson PJ, Lam EW, Dazzi F: Bone marrow mesenchymal stem cells induce division arrest anergy of activated T-cells. Blood 105(7): 2821Y2827, 2005. 15. Spaggiari GM, Capobianco A, Becchetti S, Mingari MC, Moretta L: Mesenchymal stem cellYnatural killer cell interactions:evidence that activated NK cells are capable of killing MSCs, whereas MSCs can inhibit IL-2Yinduced NKcell proliferation. Blood 107(4):1484Y1490, 2006. 16. Aggarwal S, Pittenger MF: Human mesenchymal stem cells modulate allogeneic immune cell responses. Blood 105(4):1815Y1822, 2005. 17. Nauta AJ, Kruisselbrink AB, Lurvink E, Willemze R, Fibbe WE: Mesenchymal stem cells inhibit generation and function of both CD34+ derived and monocytederived dendritic cells. J Immunol 177(4):2080Y2087, 2006. 18. Martinet L, Fleury-Cappellesso S, Gadelorge M, Dietrich G, Bourin P, Fournie´ JJ, Poupot R: A regulatory cross-talk between V+9V%2 T lymphocytesand mesenchymal stem cells. Eur J Immunol 39(3):752Y762, 2009. 19. Pelte CH, Chawla LS: Novel therapeutic targets for prevention and therapy of sepsis associated acute kidney injury. Curr Drug Targets 10(12):1205Y1211, 2009. 20. Mei SH, McCarter SD, Deng Y, Parker CH, Liles WC, Stewart DJ: Prevention of LPS-induced acute lung injury in mice by mesenchymal stem cells overexpressing angiopoietin 1. PLoS Med 4(9):e269, 2007.
SEPSIS AND AKI TREATMENT WITH MSCS
129
21. Hubbard WJ, Choudhry MA, Schwacha MG, Kerby JD, Rue LW, Bland KI, Chaudry IH: Cecal ligation and puncture. Shock 24(Suppl 1):52Y57, 2005. 22. Hu J, Zhang L, Wang N, Ding R, Cui S, Zhu F, Xie Y, Sun X, Wu D, Hong Q, et al: Mesenchymal stem cells attenuate ischemic acute kidney injury by inducing regulatory T cells through splenocyte interactions. Kidney Int 84(3):521Y531, 2013. 23. Ne´meth K, Leelahavanichkul A, Yuen PS, Mayer B, Parmelee A, Doi K, Robey PG, Leelahavanichkul K, Koller BH, Brown JM, et al.: Bone marrow stromal cells attenuate sepsis via prostaglandin E(2)Ydependent reprogramming of host macrophages to increase their interleukin-10 production. Nat Med 15(1):42Y49, 2009. 24. Mei SH, Haitsma JJ, Dos Santos CC, Deng Y, Lai PF, Slutsky AS, Liles WC, Stewart DJ: Mesenchymal stem cells reduce inflammation while enhancing bacterial clearance and improving survival in sepsis. Am J Respir Crit Care Med 182(8):1047Y1057, 2010. 25. Krasnodembskaya A, Song Y, Fang X, Gupta N, Serikov V, Lee JW, Matthay MA: Antibacterial effect of human mesenchymal stem cells is mediated in part from secretion of the antimicrobial peptide LL-37. Stem cells 28(12):2229Y2238, 2010. 26. Dong C: Diversification of T-helper-cell lineages: finding the family root of IL17Yproducing cells. Nat Rev Immunol 6(4):329Y333, 2006. 27. Iwakura Y, Ishigame H: The IL-23/IL-17 axis in inflammation. J Clin Invest 116(5):1218Y1222, 2006. 28. Day YJ, Huang L, Ye H, Linden J, Okusa MD: Renal ischemia-reperfusion injury and adenosine 2A receptorYmediated tissue protection: role of macrophages. Am J Physiol 288(4):F722YF731, 2004. 29. Jo SK, Sung SA, Cho WY, Go KJ, Kim HK: Macrophages contribute to the initiation of ischaemic acute renal failure in rats. Nephrol Dial Transplant 21(5):1231Y1239, 2006. 30. Linden A, Laan M, Anderson GP: Neutrophils interleukin-17A and lung disease. Eur Respir J 25(1):159Y172, 2005. 31. Hartupee J, Liu C, Novotny M, Li X, Hamilton T: IL-17 enhances chemokine gene expression through mRNA stabilization. J Immunol 179(6):4135Y4141, 2007. 32. Semedo P, Palasio CG, Oliveira CD, Feitoza CQ, Gonc¸alves GM, Cenedeze MA, Wang PM, Teixeira VP, Reis MA, Pacheco-Silva A, et al.: Early modulation of inflammation by mesenchymal stem cell after acute kidney injury. Int Immunopharmacol 9(6):677Y682, 2009. 33. Wise AF, Ricardo SD: Mesenchymal stem cells in kidney inflammation and repair. Nephrology (Carlton) 17(1):1Y10, 2012. 34. Luz-Crawford P, Kurte M, Bravo-Alegrı´a J, Contreras R, Nova-Lamperti E, Tejedor G, Noe¨l D, Jorgensen C, Figueroa F, Djouad F, et al.: Mesenchymal stem cells generate a CD4+CD25+Foxp3+ regulatory T cell population during the differentiation process of TH1 and TH17 cells. Stem Cell Res Ther 4(3):65, 2013. 35. Qu X, Liu X, Cheng K, Yang R, Zhao RC: Mesenchymal stem cells inhibit TH17 cell differentiation by IL-10 secretion. Exp Hematol 40(9):761Y770, 2012. 36. Duffy MM, Pindjakova J, Hanley SA, McCarthy C, Weidhofer GA, Sweeney EM, English K, Shaw G, Murphy JM, Barry FP, et al.: Mesenchymal stem cell inhibition of T-helper 17 cell-differentiation is triggered by cell-cell contact and mediated by prostaglandin E2 via the EP4 receptor. Eur J Immunol 41(10):2840Y2851, 2011. 37. Jung KH, Song SU, Yi T, Jeon MS, Hong SW, Zheng HM, Lee HS, Choi MJ, Lee DH, Hong SS: Human bone marrowYderived clonal mesenchymal stem cells inhibit inflammation and reduce acute pancreatitis in rats. Gastroenterology 140(3):998Y1008, 2011.
Copyright © 2013 by the Shock Society. Unauthorized reproduction of this article is prohibited.
MESENCHYMAL STEM CELLS AMELIORATE SEPSIS-ASSOCIATED ACUTE KIDNEY INJURY IN MICE Cong-juan Luo, Fu-jian Zhang, Li Zhang, Yan-qiu Geng, Qing-gang Li, Quan Hong, Bo Fu, Fei Zhu, Shao-yuan Cui, Zhe Feng, Xue-feng Sun, and Xiang-mei Chen State Key Laboratory of Kidney Diseases, Department of Nephrology, Chinese PLA General Hospital and Medical School of Chinese PLA, Beijing, People’s Republic of China Received 26 Aug 2013; first review completed 11 Sep 2013; accepted in final form 23 Oct 2013 ABSTRACT—Objective: Significant progress has been made in critical care medicine during the past several decades. However, the mortality rate is still high in patients with sepsis, especially with acute kidney injury (AKI). Mesenchymal stem cells (MSCs) possess an ability to ameliorate renal injury from ischemia-reperfusion, but it is still unknown whether they have the ability to reduce sepsis-associated AKI. Methods: Male C57BL/6 mice underwent cecal ligation and puncture operation to induce sepsis and then received either normal saline or MSCs (1 106 cells intravenously) 3 h after surgery. Results: Within 24 h after cecal ligation and puncture operation, the septic mice developed kidney injury and exhibited a higher mortality. Treatment with MSCs decreased serum creatinine and blood urea nitrogen levels and improved recovery of tubular function. mRNA levels of interleukin 6 (IL-6), IL-17, tumor necrosis factor !, interferon +, CXCL1, CXCL2, CXCL5, CCL2, and CCL3 in kidney tissue were dramatically decreased after MSC treatment. Neutrophil infiltration in kidney and blood bacterial loads were attenuated after MSC injection. Moreover, mice treated with MSCs had a higher survival rate than the saline treatment group. Injected MSCs were mainly localized in the lungs, spleen, and abdominal cavity lymph node, but not in the kidneys. Conclusions: Treatment with MSCs can alleviate sepsis-associated AKI and improve survival in mice with polymicrobial sepsis. These effects may be mediated by the inhibition of IL-17 secretion and balance of the proinflammatory and anti-inflammatory states. Mesenchymal stem cells may be a potential new therapeutic agent for the prevention or reduction of sepsis-associated AKI. KEYWORDS—Cecal ligation and puncture, mesenchymal stem cells, sepsis, acute kidney injury, interleukin 17
INTRODUCTION
volved in neutrophil recruitment via the production of several cytokines and CXC chemokines, such as CXCL1, CXCL5, and macrophage inflammatory protein 2 (CXCL2) (5Y8). The receptor for IL-17 is expressed in various types of cells, such as endothelial cells, macrophages, and stromal cells. These cells produce diverse proinflammatory cytokines and chemokines in response to IL-17, which mediates inflammation and induces neutrophil recruitment to inflammatory sites (8). This suggests that IL-17 plays a uniquely powerful role in the inflammatory system. Thus, it is not surprising that the IL-17 family has been shown to be involved in various physiological and pathophysiological processes including sepsis (9, 10). The level of IL-17 gradually increases in serum during the inflammatory responses to sepsis, further suggesting that IL-17 could be an important pathogenic factor in SA-AKI. Inhibition of the action of IL-17 may therefore be a new direction for the treatment of SA-AKI. However, little is known about the proinflammatory effect of IL-17 in SA-AKI. Mesenchymal stem cells (MSCs) have been shown to secretion of paracrine-acting angiogenic, trophic, anti-inflammatory, and immunomodulatory factors. Accordingly, MSC-based therapies are being evaluated for treatment of ischemic, inflammatory, and immunological disorders (11). Previous studies indicated that injection of MSCs both ameliorates renal injury and accelerates repair, such as ischemia-reperfusion (IR) or cisplatin-induced damage (12, 13). Several lines of evidence suggest that MSCs may also exhibit immunosuppressive or immunomodulatory properties, such as inhibition of !"T-cell and natural killer cell proliferation induced by mitogens or cognate peptides (14, 15). Mesenchymal stem cells also inhibit the differentiation and maturation of dendritic cells (16, 17). Moreover, MSCs are potent
Sepsis is one of the leading causes of death in the worldwide, particularly in the developing countries, and the costs to health care systems are huge (1). Sepsis is the most common cause of death in the intensive care unit, and sepsis-associated acute kidney injury (SA-AKI) is an independent risk factor for mortality. Its occurrence increases the complexity and costs of treatment (2). Currently, there are no effective methods to treat or prevent SA-AKI. Therefore, new ways to prevent SA-AKI are urgently needed. The pathophysiology of sepsis includes interactions between the microbial pathogen and the host immune system, as well as inflammatory and coagulation responses (3). However, our understanding of the pathogenesis of SA-AKI is still limited. In the past few years, most related studies have focused on hemodynamic factors after bacterial invasion. Recently, new mediators, such as interleukin 17 (IL-17), have been discovered in sepsis. Interleukin 17 is mainly produced by T cells known as TH17, +%T cells (4). It has been demonstrated that IL-17 is inAddress reprint requests to Li Zhang, No. 28 Fuxing Rd, Beijing, 100853, People’s Republic of China. E-mail: [email protected]. Co-correspondence: Xiang-mei Chen, No. 28 Fuxing Rd, Beijing, 100853, People’s Republic of China; E-mail: [email protected]. Luo and F. Zhang contributed equally to this study. This research was supported by a grant from the National Basic Research Program of China (2011CB944000), the Fund of Chinese PLA 12th Five-Year Plan for Medical Sciences (BWS11J027), National Natural Science Foundation of China (81170643), the Fund of National Key Technology R&D Program (2011BA110B00), and the Fund of Beijing Municipal Science & Technology Commission (Z131107002213011). The authors declare no conflicts of interest. DOI: 10.1097/SHK.0000000000000080 Copyright Ó 2013 by the Shock Society
123
Copyright © 2013 by the Shock Society. Unauthorized reproduction of this article is prohibited.
124
SHOCK VOL. 41, NO. 2
LUO ET
suppressors of +%T-cell proliferation, cytokine production, and cytolytic responses in vitro (18). Previous studies have shown that MSCs can ameliorate experimental sepsis and sepsis-induced acute lung injury (19, 20). Because acute lung injury, SA-AKI, and sepsis are all associated with an exaggerated inflammatory response, we hypothesized that MSCs would exert a beneficial effect in polymicrobial model of sepsis and SA-AKI. This study was designed to examine the beneficial effect of MSCs in SAAKI mice. To investigate the mechanism by which MSCs exert their therapeutic effect in SA-AKI mice, we examined the inflammatory status of serum and kidney tissue, specifically the levels of the cytokine IL-17 and its related chemokines. MATERIALS AND METHODS Animals Male C57Bl/6 mice weighing 25 to 30 g were housed in an animal facility with 12-h light-dark cycle at 22-C and free access to food and water. They were acclimated for 1 week before conducting experiments. All experimental procedures were approved by the Ethics Committee of The General Hospital of the People’s Liberation Army.
Culture of MSCs C57Bl/6 mouse bone marrowYderived MSCs/red fluorescent protein (RFP) were purchased from Cyagen Biosciences (Sunnyvale, Calif). The culture process was initiated according to the manufacturer’s instructions. The sixth, eighth, and tenth passage MSCs were used for experiments.
Mouse model of cecal ligation and puncture Cecal ligation and puncture (CLP)Yinduced sepsis was generated as described previously (21). Mice were anesthetized with 2% pentobarbital, and a 1- to 2-cm midline incision was made along the linea alba of the abdominal muscle to isolate and exteriorize the cecum. Seventy-five percent of the cecum was ligated with a 4-0 silk suture, and the cecum was punctured twice with a 21-gauge needle. A small amount (droplet) of feces was gently extruded from the penetration holes to ensure patency. The cecum was then returned to the peritoneal cavity, and the abdominal incision was closed with 4-0 silk sutures. After the operation, 1 mL prewarmed normal saline was administered into the peritoneal cavity. In the sham group, mice underwent the same procedure but were neither ligated nor punctured. After 3 h of CLP, mice were injected 1 106 MSCs in 0.2 mL normal saline by tail vein (22). As a control, the CLP mice were administered only 0.2 mL normal saline. Mice were divided into three groups: sham, CLP, and CLP + MSCs.
AL.
Plates were incubated for 24 h at 37-C under aerobic conditions; colony enumeration was then counted and multiplied by the dilution factor.
Assessment of kidney injury Kidney injury was assessed by measuring the levels of serum creatinine and blood urea nitrogen and calculating the changes in levels. Blood samples were collected from the vena cava at the indicated time points (n = 10 in each group), and the serum was separated by centrifugation at 3,000 revolutions/min for 15 min at 4-C and then stored at j20-C until use.
Histopathology Kidneys were harvested at 24 h after CLP. Specimens were fixed in 10% formaldehyde for at least 24 h. After dehydration in a series of ascending concentrations of ethanol, the samples were embedded in paraffin and then sectioned at 3-mm thickness for staining with periodic acidYSchiff. Stained sections were observed by light microscopy (Olympus IX71, Tokyo, Japan) at a magnification of 400 and were evaluated by three independent pathologists. Histological examinations for acute tubular necrosis were semiquantified using the following scoring system as described previously (22): 0 = none, 1 = less than 10%; 2 = 11% to 25%, 3 = 26% to 45%, 4 = 46% to 75%, and 5 = greater than 76%.
Enzyme-linked immunosorbent assay Animals were anesthetized and killed at 24 h (n = 6 per group). Specific detection of IL-6, IL-17, tumor necrosis factor ! (TNF-!), interferon + (IFN-+), and IL-10 was accomplished by sandwich enzyme-linked immunosorbent assay according to the manufacturer’s instructions (R&D Systems, Minneapolis, Minn).
Real-time polymerase chain reaction Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, Calif) following the manufacturer’s instructions. The TaqMan Reverse Transcription Kit (Applied Biosystems, Foster City, Calif) and a Gene Amp polymerase chain reaction (PCR) System 9700 (Applied Biosystems) were used for generation of cDNA. Polymerase chain reaction was performed with the SYBR Green Mastermix and a 7500 Real-time PCR System (Applied Biosystems). Results were analyzed by the 2j$$CT method with normalization to glyceraldehyde 3-phosphate dehydrogenase expression (n = 6 for each group). The primers used are listed in Table 1.
Immunofluorescence studies of kidney samples For use in immunofluorescence studies, 4-Hm-thick sections were cut and then incubated overnight with rat anti-Ly6G (1:100; Santa Cruz Biotechnology, Santa Cruz, Calif) antibody in a humidified chamber. After washing with phosphatebuffered saline, secondary antibodies conjugated with fluorescein isothiocyanate goat antiYrat immunoglobulin G (1:50; Jackson ImmunoResearch Laboratories; West Grove, Pa) were applied for 1 h at room temperature in a darkened humidified chamber. Nuclei were stained with DAPI (Zhongshan Goldenbridge Biotechnology, Beijing, China). Each tissue section was observed with light microscopy at a magnification of 400 (n = 6 for each group).
Survival study Survival after surgery was assessed every 24 h for 7 days with n = 20 in each group.
Bacterial load determination Blood was obtained from the vena cava at 24 h after CLP surgery (n = 6 in each group). Following 1:3 dilution in sterile phosphate-buffered saline, 100 HL samples were plated on 5% sheep blood agar plates (Remel, Lenexa, Kans).
Two-photon fluorescence confocal imaging of MSCs after injection We traced the distribution of MSCs after injection with a Leica two-photon fluorescence confocal imaging TCS SP5 system (Leica Microsystems, Mannheim, Germany). Mice were killed at 3, 6, 12, 18, and 24 h (n = 3 in each group at each time point; experiments repeated three times). Fresh, thick tissues of the right lung, right lower liver, spleen, and peritoneal cavity lymph node were sampled.
TABLE 1. Primers used for real-time PCR Gene
Forward primers (5¶-3¶)
Reverse primer (5¶-3¶)
IL-17
TGGACTCTCCACCGCAATG
TGGGGGTTTCTTAGGGGTCA
IL-6
AGTCAATTCCAGAAACCGCTATG
ACAGGTCTGTTGGGAGTGGT
CTACTGAACTTCGGGGTGAT
CAGGCTTGTCACTCGAATT
TNF-! IL-10 CXCL1
AGGCAGCCTTGCAGAAAAGA
GCTCCACTGCCTTGCTCTTA
TGGCTGGGATTCACCTCAAGAACA
TGTGGCTATGACTTCGGTTTGGGT
CXCL2
GAAGTCATAGCCACTCTCAAGG
TTCCGTTGAGGGACAGCA
CXCL5
CGTAACTCCAAAAATTAATCCCAAA
CGAGTGCATTCCGCTTAGCT
CCL2
AGCACCAGCCAACTCTCACT
CGTTAACTGCATCTGGCTGA
CCL3
CATCGTTGACTATTTTGAAACCAG
GCCGGTTTCTCTTAGTCAGGAA
Copyright © 2013 by the Shock Society. Unauthorized reproduction of this article is prohibited.
SHOCK FEBRUARY 2014
SEPSIS AND AKI TREATMENT WITH MSCS
125
vacuolization in the proximal tubules. Treatment with MSCs ameliorated the morphological damage and reduced the tubular injury score (P G 0.05; Fig. 3, CYF). Taken together, our data showed that CLP-induced polymicrobial sepsis resulted in AKI, and treatment with MSCs reduced the degree of AKI. Effect of treatment with MSCs on the expression of cytokines in plasma
The CLP surgery led to significant increases in plasma levels of proinflammatory cytokines, including IL-6, IL-10, IL-17, IFN-+, and TNF-! (Fig. 4), which are all indicators of the immune inflammatory status. Treatment with MSCs significantly decreased the level of IL-17, IL-6, IFN-+, and TNF-! in plasma at 24 h (P G 0.05) compared with the CLP group. However, the level of IL-10 was significantly increased (P G 0.05) compared with that in the CLP group. FIG. 1. Mesenchymal stem cells improve the survival rate of CLP model mice. Each group consisted of 20 animals. Kaplan-Meier curves represent the survival rate in each group. The survival rate at 7 days was significantly higher in the MSC group than the normal saline (NS) group; *P G 0.05.
Effect of treatment with MSCs on renal mRNA expression of cytokines and chemokines
In the absence of antibiotic therapy, we attempted to investigate whether the mice injected with MSCs show any improvement in terms of survivability. The survival rate of the CLP group was only 30% at 7 days, whereas it increased by nearly 100% in the MSC treatment group (58% mice surviving) (Fig. 1). Treatment with MSCs significantly improved the survival rate compared with that in septic mice that received normal saline (P G 0.05).
To investigate whether MSC treatment could directly affect local renal production of cytokines and chemokines, we examined the renal level of these cytokines using reverse transcriptaseYPCR. Our results showed that the mRNA expression levels of IL-17, IL-6, IFN-+, TNF-!, and IL-10 were significantly increased in both the CLP and MSC treatment groups at 24 h (Fig. 5). Compared with the untreated CLP group, treatment with MSCs decreased the expression levels of IL-17, IL-6, IFN-+, and TNF-! (P G 0.05), but increased the expression level of IL-10 (P G 0.05; Fig. 5). Previous studies showed that IL-17 in peritoneal fluid plays a critical role during severe polymicrobial sepsis. We speculated that IL-17 might play an important role in SA-AKI. We examined the mRNA expression levels in the kidney of the chemokines related to IL-17 function using reverse transcriptaseYPCR. The levels of CXCL1, CXCL2, CXCL5, CCL2, and CCL3 were dramatically increased in the CLP group and were significantly decreased by treatment with MSCs (P G 0.05; Fig. 5).
Effect of treatment with MSCs on bacterial load of CLP-induced septic mice
Effect of treatment with MSCs on the infiltration of inflammatory cells
To understand the mechanism of intravenous injection of MSCs on CLP-induced septic mice, we examined blood bacterial load in CLP mice at 24 h after CLP injury. Mice that received MSCs 3 h after CLP surgery exhibited significantly lower blood bacterial load compared with mice that received normal saline (P G 0.05; Fig. 2).
To test whether neutrophil infiltration plays a role in our model, we examined the degree of neutrophil infiltration in the
Statistical analyses Data are expressed as mean T SEM. Multiple comparisons of parametric data were performed using one-way analysis of variance followed by Student-NewmanKeuls post hoc tests. Expression levels of mRNA were calculated using the 2j$$CT method. Survival of the two subgroups was estimated using a Kaplan-Meier analysis. Analyses were completed using SPSS for Windows (version 10.1; SPSS, Chicago, Ill). Statistical significance was defined as P G 0.05.
RESULTS Effect of treatment with MSCs on the survival of CLP-induced septic mice
Effects of treatment with MSCs on SA-AKI
Sepsis-associated AKI was determined by measuring biochemical indicators in blood samples taken at 24 h. Levels of blood urea nitrogen and serum creatinine increased in mice with CLP-induced sepsis (269 T 46 and 0.82 T 0.16 mg/dL, respectively) compared with the sham group (25.2 T 3.83 and 0.11 T 0.01 mg/dL, respectively), indicating the development of AKI. Mesenchymal stem cell treatment dramatically reduced serum creatinine and blood urea nitrogen levels (P G 0.05; Fig. 3, A and B), compared with mice that received normal saline. Morphological changes in the CLP group were scored 24 h after MSC treatment by brush border loss, tubular degeneration, and
FIG. 2. Mesenchymal stem cells inhibit CLP-induced blood bacterial load. Blood samples were taken 24 h after CLP operation and cultured on 5% sheep blood agar plates. The numbers of bacterial colonies were counted after 24 h of incubation. Data are presented as means T SEM. *P G 0.01 vs. sham; #P G 0.05 vs. CLP + NS.
Copyright © 2013 by the Shock Society. Unauthorized reproduction of this article is prohibited.
126
SHOCK VOL. 41, NO. 2
LUO ET
AL.
FIG. 3. Mesenchymal stem cells ameliorate SA-AKI. Treatment with MSCs significantly reduced serum creatinine (SCr) and blood urea nitrogen (BUN) levels 24 h after CLP injury compared with levels in sepsis mice treated with NS. Moreover, MSC therapy improved tubular injury and reduced acute tubular necrosis (ATN) scores 24 h after CLP. For SCr, BUN, and ATN scores, values are means T SEM; n = 10 in each group. *P G 0.05 vs. CLP + NS; #P G 0.05 vs. sham.
kidney using immunofluorescence. In the sham group, there was no detectable Ly-6GYpositive cell infiltration (Fig. 6A). In the CLP group, there were many Ly-6GYpositive cells in the renal tissue (Fig. 6B). These cells were mainly detected in the renal cortex, including the glomerulus and tubulointerstitium. Compared with the CLP group, the MSC-treated group exhibited less neutrophil infiltration (Fig. 6, C and D). Distribution of intravenously infused MSCs
The location of MSCs should aid in the elucidation of the molecular mechanism by which MSCs alleviate the damage that occurs during SA-AKI. Two-photon microscopy was used to evaluate the distribution of RFP-labeled MSCs after injection into the mice with CLP surgery. Images were acquired at 3, 6, 12, and 24 h after cell injection. Mesenchymal stem cells were mainly found in the spleen, lymph nodes, and lung after injection and persisted for at least 24 h with nearly no signal detected in the kidney throughout this period (Fig. 7). These results suggest that MSCs perform their protective function through paracrine secretions rather than cell-to-cell contacts. DISCUSSION The results from the present study show that bone marrowYderived MSCs moderate SA-AKI and reduce mortality in a clinically relevant model of polymicrobial sepsis induced by CLP. The improvement in SA-AKI was associated
with an overall reduction in the inflammatory response, specifically a reduced production of IL-17. Mesenchymal stem cells have been shown previously to preserve renal function after CLP in mice when administered up to 24 h before CLP (23). Those studies were extended here by determining the effects of MSCs when administered 3 h after the onset of CLP. Mesenchymal stem cells injected 3 h after CLP injury still have beneficial effects. Because treatments for septic patients usually begin after the onset of symptoms, Therefore, our results might be more relevant in guiding the clinical treatment of sepsis and SA-AKI. In our study, we found that MSCs significantly reduced CLPinduced blood bacterial load, consistent with previous findings that MSCs have the ability to reduce bacterial burden in inflammation model. Mei et al. (24) showed that MSCs have the ability to reduce organ and peritoneal space bacterial burden in CLP model. Krasnodembskaya et al. (25) reported that MSCs as well as their conditioned medium possess direct antimicrobial activity in Escherichia coli pneumonia mice model, which is mediated in part by the secretion of LL-37. Although we did not examine the change of phagocytic capacity after MSC injection in CLP mice, we found reduced neutrophil infiltration in kidney and protective effect of SA-AKI after MSC treatment. Therefore, we speculated that MSCs might secrete antimicrobial peptides to reduce circulating bacterial loads in CLP mice model. The pathogenesis of SA-AKI is not well understood. The inflammatory response inherent to sepsis has been examined as a
FIG. 4. Mesenchymal stem cells reduce the production of proinflammatory cytokines and increase the release of anti-inflammatory cytokines in plasma. Enzyme-linked immunosorbent assay was used to quantify the proinflammatory cytokines IL-17, IL-6, IFN-+, and TNF-! and the anti-inflammatory cytokine IL-10 in the plasma of each group at 24 h after CLP injury. n = 6 for each group. Data are presented as means T SEM. *P G 0.01 vs. sham and #P G 0.05 vs. CLP.
Copyright © 2013 by the Shock Society. Unauthorized reproduction of this article is prohibited.
SHOCK FEBRUARY 2014
SEPSIS AND AKI TREATMENT WITH MSCS
127
FIG. 5. Mesenchymal stem cells reduce proinflammatory and promote anti-inflammatory gene transcriptional activity in the septic kidney. The mRNA expression of the inflammatory cytokines IL-10, IL-17, IL-6, IFN-+, and TNF-! and chemokines CXCL1, CXCL2, CXCL5, CCL2, and CCL3 in kidney tissue 24 h after CLP operation. *P G 0.01 vs. sham and #P G 0.05 vs. CLP.
direct mechanism of AKI. The kidney is particularly sensitive to mediator-induced damage. In this study, we demonstrated that not only the plasma levels of TNF-!, IL-6, IFN-+, IL-17, and IL-10 significantly increased in parallel with the kidney injury, but also the mRNA levels of these cytokines in renal tissue increased at 24 h after CLP injury. These results show that the status of inflammation plays an important role in the pathogenesis of sepsis and SA-AKI. Interleukin 17 has been found to be elevated in a variety of inflammatory conditions. Our results show that the level of IL-17 in serum was significantly increased along with the CLP operation, especially at 24 h after CLP. The mRNA level of IL-17 in the kidney was also significantly increased at this time point. The infiltration of neutrophils in AKI has been demonstrated in previous studies (26, 27). Neutrophil infiltration was increased in the kidneys in our model. Levels of chemokines related to IL-17, such as CXCL1, CXCL2, CXCL5, CCL2, and CCL3, were also increased. Interleukin 17 acts on various cell types, including neutrophils, fibroblasts, epithelial cells, and endothelial cells. It also induces the expression of proinflammatory mediators such as IL-6, CXC chemokines, and matrix metalloproteinases (28, 29). Moreover, IL-17 has been reported to be a major orchestrator of sustained neutrophil mobilization and its associated activity through the induction of specific cytokines and colony-stimulating factors in resident lung cells (30). Collectively, this recruitment of neutrophils by IL-17 seems, in
part, to be regulated by enhanced expression of chemokines (31). In our study, the levels of IL-17 and the recruitment of neutrophils in the kidney were all significantly increased. Therefore, IL-17 may be an important pathogenic factor in SA-AKI, and inhibiting IL-17 could be a new therapeutic target for the treatment of SA-AKI. Interleukin 10 is a potent inhibitory cytokine that downregulates the monocyte inflammatory and procoagulant responses. Elevated levels of IL-10 have been detected in serum of patients with sepsis and after injection of lipopolysaccharide in mice. In our study, we also found increased levels of IL-10. It has been proposed that endogenously produced IL-10 serves a protective function in models of endotoxic shock. Thus, induction of IL-10 may be a protective measure. Treatment with MSCs in an IR injury model resulted in significantly decreased expression levels of proinflammatory cytokines, such as IL-1", TNF-!, and IFN-+ 24 h after IR injury and improved renal function (32, 33). Here we found that injection of MSCs 3 h after CLP led to decreased expression of TNF-!, IFN-+, and IL-6, but increased IL-10 levels in both the plasma and renal tissues. Treatment with MSCs can reduce the serum and kidney tissue expression of IL-17 and IL-17Yrelated chemokines. It can also reduce the infiltration of neutrophils in the CLP kidney. In this regard, our results are in line with previous reports that MSCs decrease proinflammatory cytokines and increase anti-inflammatory cytokines, which may explain their
FIG. 6. Mesenchymal stem cells reduce the infiltration of neutrophils in kidney. Histological sections of kidney from every group were subjected to immunofluorescence staining, and the number of positive cells was counted in five high-power fields per section (original magnification 400). Values represent means T SD (n = 6). #P G 0.05 vs. CLP.
Copyright © 2013 by the Shock Society. Unauthorized reproduction of this article is prohibited.
128
SHOCK VOL. 41, NO. 2
LUO ET
AL.
FIG. 7. Distribution of intravenously infused MSCs. Infused RFP-labeled MSCs were not detected in the kidney at any time point but persisted in spleen, peritoneal cavity lymph node, and lung during the entire experimental course, at least for 24 h after CLP.
beneficial effects in SA-AKI. However, the detailed mechanisms of MSCs are unknown. Previous study showed that MSCs were able to suppress the proliferation and activation of CD4+ T cells and suppress CD4+ T cells differentiate into TH1 and TH17 cells. These suppressive effects were associated with the increase in CD4+CD25+Foxp3+ regulatory T cells and IL-10 secretion (34). Mesenchymal stem cells also could inhibit TH17 cell differentiation by IL-10 secretion (35). Duffy et al. (36) showed that MSC inhibition of TH17 cell differentiation is triggered by cell-cell contact. Jung et al. (37) showed that MSCs protected pancreatic function through reducing the infiltration of CD3+ T cells and upregulating Foxp3+ regulatory T cells into the injured pancreatic tissue in pancreatitis rat models. In our study, even though we did not examine the changes of immune cells after the MSC intervention, we found that MSCs could balance the status of inflammation and MSCs mainly homed to lymphoid organs. Therefore, we speculate that MSCs may directly interact with lymphocytes and regulate the secretion of IL-17 and IL-10. Our results may provide new insights into the endogenous immune responses after SA-AKI in mice treated with MSCs. How MSCs exert their beneficial effects is presently poorly understood. Studies suggest that the distribution of MSCs might be essential for its beneficial effect. A previous study reports that MSCs can home to the damaged kidney to protect the kidney from further injury (33). However, recent studies found that intravenously injected MSCs mainly homed to the lungs and liver (22, 23). In this study, intravenously infused MSCs mainly accumulated in the lungs as Bemboli[ and in the spleen and lymph node as Bdebris.[ The reason that the vast majority of intravenously injected MSCs accumulated in the lungs is unknown. We propose that the tissue-specific distribution may be due to the size of MSCs relative to pulmonary capillaries, which may prevent MSCs from passing through the pulmonary circulation. Mesenchymal stem cells accumulated in the spleen and lymph node as Bdebris[ because MSCs were damaged by local macrophages. Although MSCs can protect
against SA-AKI, no MSCs were observed in the injured kidney. In this study, we also demonstrated for the first time that intravenously injected MSCs accumulated in the peritoneal cavity lymph node. Our previous studies found that MSCs attenuated ischemic AKI by inducing regulatory T cells through splenocyte interactions (22). Therefore, we speculate that the protective effect of MSCs in SA-AKI occurs by paracrine secretions, rather than cell-to-cell contacts. This may also occur through interactions with lymphoid organs, including the spleen and peritoneal cavity lymph node, which modulate inflammatory or immune reactions. There are some limitations in our study. Although we observed decreased levels of IL-17 and related cytokines and chemokines in renal tissues after treatment of CLP mice with MSCs, the mechanism through which MSCs regulate IL-17 remains unknown; MSCs did not home to kidney, so it is unclear how they could protect against SA-AKI. Our group has reported that MSCs might interact with splenocytes and protect against ischemic AKI, although the exact crosstalk between MSCs and splenocytes is unclear (22). In summary, our study demonstrates that treatment with MSCs could protect against SA-AKI. Interleukin 17 may be involved in the pathogenesis of SA-AKI. Injection of MSCs can reduce the expression level of IL-17 in the kidneys, which could reduce the infiltration of inflammatory cells and maintain the balance between proinflammatory and anti-inflammatory status. Based on our work, MSCs may be a potentially effective treatment for SA-AKI. REFERENCES 1. Stehr SN, Reinhart K: Sepsis as a global health problemVwhy we need a global sepsis alliance. Shock 39(Suppl 1):3Y4, 2013. 2. Filiponi TC, de Souza Dura˜o M Jr: How to choose the ideal renal replacement therapy in sepsis? Shock 39(Suppl 1):50Y53, 2013. 3. Russell JA: Management of sepsis. N Engl J Med 355(7626):1699Y1713, 2006. 4. Weaver CT, Hatton RD, Mangan PR, Harrington LE: IL-17 family cytokines and the expanding diversity of effector T cell lineages. Annu Rev Immunol 25:821Y852, 2007.
Copyright © 2013 by the Shock Society. Unauthorized reproduction of this article is prohibited.
SHOCK FEBRUARY 2014 5. Witowski J, Pawlaczyk K, Breborowicz A, Scheuren A, Kuzlan-Pawlaczyk M, Wisniewska J, Polubinska A, Friess H, Gahl GM, Frei U, et al.: IL-17 stimulates intraperitoneal neutrophil infiltration through the release of GRO chemokine from mesothelial cells. J Immunol 165(10):5814Y5821, 2000. 6. Ye P, Rodriguez FH, Kanaly S, Stocking KL, Schurr J, Schwarzenberger P, Oliver P, Huang W, Zhang P, Zhang J, et al.: Requirement of interleukin 17 receptor signaling for lung CXC chemokine and granulocyte colony-stimulating factor expression, neutrophil recruitment, and host defense. J Exp Med 194(4): 519Y527, 2001. 7. Kawaguchi M, Kokubu F, Matsukura S, Ieki K, Odaka M, Watanabe S, Suzuki S, Adachi M, Huang SK: Induction of CXC chemokines, growth-related oncogene expression, and epithelial cellYderived neutrophil-activating protein-78 by ML-1 (interleukin-17F) involves activation of Raf1Ymitogen-activated protein kinase kinase-extracellular signalYregulated kinase 1/2 pathway. J Pharmacol Exp 307(3):1213Y1220, 2003. 8. Kolls JK, Linden A: Interleukin-17 family members and inflammation. Immunity 20(4):467Y476, 2004. 9. Flierl MA, Rittirsch D, Gao H, Hoesel LM, Nadeau BA, Day DE, Zetoune FS, Sarma JV, Huber-Lang MS, Ferrara JL, et al.: Adverse functions of IL-17A in experimental sepsis. FASEB J 22(7):2198Y2205, 2008. 10. Frangen TM, Bogdanski D, Schinkel C, Roetman B, Kalicke T, Muhr G, Koller M: Systemic IL-17 after severe injuries. Shock 29(4):462Y467, 2008. 11. Boregowda SV, Phinney DG: Therapeutic applications of mesenchymal stem cells: current outlook. BioDrugs 26(4):201Y208, 2012. 12. Morigi M, Introna M, Imberti B, Corna D, Abbate M, Rota C, Rottoli D, Benigni A, Perico N, Zoja C, et al.: Human bone marrow mesenchymal stem cells accelerate recovery of acute renal injury and prolong survival in mice. Stem Cells 26(8):2075Y2082, 2008. 13. Bruno S, Grange C, Collino F, Deregibus MC, Cantaluppi V, Biancone L, Tetta C, Camussi G: Microvesicles derived from mesenchymal stem cells enhance survival in a lethal model of acute kidney injury. PLoS One 7(3):e33115, 2012. 14. Glennie S, Soeiro I, Dyson PJ, Lam EW, Dazzi F: Bone marrow mesenchymal stem cells induce division arrest anergy of activated T-cells. Blood 105(7): 2821Y2827, 2005. 15. Spaggiari GM, Capobianco A, Becchetti S, Mingari MC, Moretta L: Mesenchymal stem cellYnatural killer cell interactions:evidence that activated NK cells are capable of killing MSCs, whereas MSCs can inhibit IL-2Yinduced NKcell proliferation. Blood 107(4):1484Y1490, 2006. 16. Aggarwal S, Pittenger MF: Human mesenchymal stem cells modulate allogeneic immune cell responses. Blood 105(4):1815Y1822, 2005. 17. Nauta AJ, Kruisselbrink AB, Lurvink E, Willemze R, Fibbe WE: Mesenchymal stem cells inhibit generation and function of both CD34+ derived and monocytederived dendritic cells. J Immunol 177(4):2080Y2087, 2006. 18. Martinet L, Fleury-Cappellesso S, Gadelorge M, Dietrich G, Bourin P, Fournie´ JJ, Poupot R: A regulatory cross-talk between V+9V%2 T lymphocytesand mesenchymal stem cells. Eur J Immunol 39(3):752Y762, 2009. 19. Pelte CH, Chawla LS: Novel therapeutic targets for prevention and therapy of sepsis associated acute kidney injury. Curr Drug Targets 10(12):1205Y1211, 2009. 20. Mei SH, McCarter SD, Deng Y, Parker CH, Liles WC, Stewart DJ: Prevention of LPS-induced acute lung injury in mice by mesenchymal stem cells overexpressing angiopoietin 1. PLoS Med 4(9):e269, 2007.
SEPSIS AND AKI TREATMENT WITH MSCS
129
21. Hubbard WJ, Choudhry MA, Schwacha MG, Kerby JD, Rue LW, Bland KI, Chaudry IH: Cecal ligation and puncture. Shock 24(Suppl 1):52Y57, 2005. 22. Hu J, Zhang L, Wang N, Ding R, Cui S, Zhu F, Xie Y, Sun X, Wu D, Hong Q, et al: Mesenchymal stem cells attenuate ischemic acute kidney injury by inducing regulatory T cells through splenocyte interactions. Kidney Int 84(3):521Y531, 2013. 23. Ne´meth K, Leelahavanichkul A, Yuen PS, Mayer B, Parmelee A, Doi K, Robey PG, Leelahavanichkul K, Koller BH, Brown JM, et al.: Bone marrow stromal cells attenuate sepsis via prostaglandin E(2)Ydependent reprogramming of host macrophages to increase their interleukin-10 production. Nat Med 15(1):42Y49, 2009. 24. Mei SH, Haitsma JJ, Dos Santos CC, Deng Y, Lai PF, Slutsky AS, Liles WC, Stewart DJ: Mesenchymal stem cells reduce inflammation while enhancing bacterial clearance and improving survival in sepsis. Am J Respir Crit Care Med 182(8):1047Y1057, 2010. 25. Krasnodembskaya A, Song Y, Fang X, Gupta N, Serikov V, Lee JW, Matthay MA: Antibacterial effect of human mesenchymal stem cells is mediated in part from secretion of the antimicrobial peptide LL-37. Stem cells 28(12):2229Y2238, 2010. 26. Dong C: Diversification of T-helper-cell lineages: finding the family root of IL17Yproducing cells. Nat Rev Immunol 6(4):329Y333, 2006. 27. Iwakura Y, Ishigame H: The IL-23/IL-17 axis in inflammation. J Clin Invest 116(5):1218Y1222, 2006. 28. Day YJ, Huang L, Ye H, Linden J, Okusa MD: Renal ischemia-reperfusion injury and adenosine 2A receptorYmediated tissue protection: role of macrophages. Am J Physiol 288(4):F722YF731, 2004. 29. Jo SK, Sung SA, Cho WY, Go KJ, Kim HK: Macrophages contribute to the initiation of ischaemic acute renal failure in rats. Nephrol Dial Transplant 21(5):1231Y1239, 2006. 30. Linden A, Laan M, Anderson GP: Neutrophils interleukin-17A and lung disease. Eur Respir J 25(1):159Y172, 2005. 31. Hartupee J, Liu C, Novotny M, Li X, Hamilton T: IL-17 enhances chemokine gene expression through mRNA stabilization. J Immunol 179(6):4135Y4141, 2007. 32. Semedo P, Palasio CG, Oliveira CD, Feitoza CQ, Gonc¸alves GM, Cenedeze MA, Wang PM, Teixeira VP, Reis MA, Pacheco-Silva A, et al.: Early modulation of inflammation by mesenchymal stem cell after acute kidney injury. Int Immunopharmacol 9(6):677Y682, 2009. 33. Wise AF, Ricardo SD: Mesenchymal stem cells in kidney inflammation and repair. Nephrology (Carlton) 17(1):1Y10, 2012. 34. Luz-Crawford P, Kurte M, Bravo-Alegrı´a J, Contreras R, Nova-Lamperti E, Tejedor G, Noe¨l D, Jorgensen C, Figueroa F, Djouad F, et al.: Mesenchymal stem cells generate a CD4+CD25+Foxp3+ regulatory T cell population during the differentiation process of TH1 and TH17 cells. Stem Cell Res Ther 4(3):65, 2013. 35. Qu X, Liu X, Cheng K, Yang R, Zhao RC: Mesenchymal stem cells inhibit TH17 cell differentiation by IL-10 secretion. Exp Hematol 40(9):761Y770, 2012. 36. Duffy MM, Pindjakova J, Hanley SA, McCarthy C, Weidhofer GA, Sweeney EM, English K, Shaw G, Murphy JM, Barry FP, et al.: Mesenchymal stem cell inhibition of T-helper 17 cell-differentiation is triggered by cell-cell contact and mediated by prostaglandin E2 via the EP4 receptor. Eur J Immunol 41(10):2840Y2851, 2011. 37. Jung KH, Song SU, Yi T, Jeon MS, Hong SW, Zheng HM, Lee HS, Choi MJ, Lee DH, Hong SS: Human bone marrowYderived clonal mesenchymal stem cells inhibit inflammation and reduce acute pancreatitis in rats. Gastroenterology 140(3):998Y1008, 2011.
Copyright © 2013 by the Shock Society. Unauthorized reproduction of this article is prohibited.
