Journal of Medical Virology 86:1813–1819 (2014)
Merkel Cell Polyomavirus Detection in Merkel Cell Cancer Tumors in Northern Germany Using PCR and Protein Expression Miriam Leitz,1 Kristin Stieler,1 Adam Grundhoff,2 Ingrid Moll,3 Johanna M. Brandner,3 and Nicole Fischer1* 1
Institute for Microbiology and Virology, University Medical Center Eppendorf, Hamburg, Germany Heinrich-Pette Institute, Leibniz Institute for Experimental Virology, Hamburg, Germany 3 Department for Dermatology and Venerology, University Medical Center Eppendorf, Hamburg, Germany 2
Merkel cell carcinoma is a highly malignant skin cancer which predominantly occurs in elderly and immunocompromised persons. The identification of the Merkel cell polyomavirus (MCPyV) has inaugurated a new understanding of Merkel cell carcinoma pathogenesis. The frequent detection of the virus in Merkel cell carcinoma tissue (70–90%), its monoclonal integration in the tumor cells and the expression of viral oncogenes highly suggest that MCPyV is causally linked to the pathogenesis of the majority of Merkel cell cancer (MCC) cases. Using qualitative and quantitative PCR together with immunohistochemical staining this study aimed at characterizing the presence of MCPyV sequences and viral early gene expression in a cohort of MCC cases (n ¼ 32) selected in Northern Germany. 40–57% of the cases were identified as MCPyV positive with 40.6% of the cases positive by immunohistochemical staining and 51.6–57.6% positive by PCR. Interestingly, in the majority (64%) of LT-Antigen positive tumors only 25–50% of tumor cells express LT-Antigen. These data are in accord with published studies describing heterogeneity in MCPyV viral loads and suggest that detection of MCPyV in Merkel cell carcinoma by PCR should be undertaken using multiple primer pairs. J. Med. Virol. 86: 1813–1819, 2014. # 2013 Wiley Periodicals, Inc.
KEY WORDS:
Merkel cell polyomavirus; immunohistochemistry; LT-Antigen expression; Merkel cell cancer; polyomavirus and skin cancer
C 2013 WILEY PERIODICALS, INC.
INTRODUCTION Merkel cell cancer (MCC) is a rare but highly aggressive neuroendocrine tumor of the skin predominantly found in elderly and immunosuppressed patients. Solid organ transplant patients, patients suffering from leukemia as well as HIV patients have a 15-fold higher risk to develop MCC [AlboresSaavedra et al., 2010]. A panel of immunhistochemical marker proteins including cytokeratin 20 (CK20), neurofilaments, chromogranin, and neuron specific enolase are used to confirm the histological diagnosis of MCC [Albores-Saavedra et al., 2010]. The development of MCC, in particular cellular pathways contributing to MCC pathogenesis is still poorly understood. In 2008, a new polyomavirus from MCC primary tumor material was identified, the Merkel cell polyomavirus [Feng et al., 2008]. Using mostly PCR several groups worldwide confirmed that up to 90% of all MCC cases carry viral sequences [Foulongne et al., 2008; Kassem et al., 2008; Shuda et al., 2008; Becker et al., 2009; Garneski et al., 2009]. The viral DNA is monoclonal integrated in the host genome [Feng et al., 2008; Shuda et al., 2008], which together with LT-Antigen expression within the tumor cells Virus Nomenclature: dsDNA virus, Order not assigned, Family Polyomaviridae, Genus Polyomavirus, Species Merkel cell polyomavirus. Correspondence to: Nicole Fischer, Institute for Medical Microbiology and Virology, University Medical Center Eppendorf, Martinistrasse 52, D-20246 Hamburg, Germany. E-mail: [email protected] Accepted 3 September 2013 DOI 10.1002/jmv.23808 Published online 17 October 2013 in Wiley Online Library (wileyonlinelibrary.com).
1814
contributes to the classification of Merkel cell polyomavirus (MCPyV) as a human tumor virus [Shuda et al., 2009; Bouvard et al., 2012]. Interestingly, all early gene regions of the virus isolated from MCC tumor material carry premature STOP codon mutations within the LT-Antigen region resulting in a truncated LT protein lacking the origin binding domain and the C-terminus of the protein [Shuda et al., 2008; Fischer et al., 2010], which suggest a positive selection for the N-terminal region of the protein encompassing DNAJ domain as well as a retinoblastoma protein (Rb) binding motif or a negative selection against the C-terminal part of the protein essential for viral replication. Most studies addressing MCPyV association with MCC applied qualitative PCR technology to detect viral sequences using genomic DNA isolated from MCC paraffin sections [Feng et al., 2008; Foulongne et al., 2008; Kassem et al., 2008; Becker et al., 2009; Busam et al., 2009; Duncavage et al., 2009; Garneski et al., 2009; Helmbold et al., 2009; Sihto et al., 2009; Touze et al., 2009; Wieland et al., 2009; Bhatia et al., 2010; Loyo et al., 2010]. To increase sensitivity some studies additionally applied nested PCR or southern blot technology [Feng et al., 2008; Kassem et al., 2008; Touze et al., 2009; Wieland et al., 2009]. Quantitative PCR technique used by several studies detecting a 162-bp fragment in the LT-region increased sensitivity and specificity of the detection of MCPyV especially in DNA isolated from paraffin section [Becker et al., 2009; Busam et al., 2009; Garneski et al., 2009; Sihto et al., 2009; Bhatia et al., 2010; Loyo et al., 2012; Hattori et al., 2013]. Reports using PCR to detect MCPyV in MCC vary in MCPyV positivity depending on primer pairs used ranging from 40% to 100% [Feng et al., 2008; Kassem et al., 2008; Becker et al., 2009; Busam et al., 2009; Duncavage et al., 2009; Garneski et al., 2009; SastreGarau et al., 2009; Shuda et al., 2009; Sihto et al., 2009; Touze et al., 2009; Varga et al., 2009; Wetzels et al., 2009; Bhatia et al., 2010; Houben et al., 2010; Loyo et al., 2010; Andres et al., 2011]. Immunohistochemistry using the only commercially available antibody against MCPyV early gene product, CM2B4, recognizing a peptide in the second exon of the LT-Antigen was used in only a few studies so far [Busam et al., 2009; Shuda et al., 2009, 2011; Paik et al., 2011; Ly et al., 2012; Erovic et al., 2013]. Based on the majority of these studies IHC of MCPyV LT-Antigen expression using CM2B4 is highly suitable as a diagnostic tool, however, as observed for PCR based results, discrepancies applying LT IHC exist: frequency of MCC sections positive for LT expression vary from 63% to 97% [Shuda et al., 2009; Ly et al., 2012; Erovic et al., 2013]. In addition, the number of MCC tumors with more than 60% of tumor cells expressing LT-Antigen varies from 35% to 97% [Busam et al., 2009; Erovic et al., 2013]. Interestingly, an earlier report demonstrated that the CM2B4 antibody failed to detect LT-Antigen in J. Med. Virol. DOI 10.1002/jmv
Leitz et al.
several cases of MCC and that a combined use of CM2B4 and a small T (sT)-Antigen specific antibody (CM5E1) significantly increased sensitivity [Shuda et al., 2011]. Furthermore, a more recent study reported significantly increased sensitivity of IHC using a different noncommercial LT-Antigen specific antibody, Ab3 [Rodig et al., 2012]. Intrigued by the discrepancies in nucleic acid based as well as IHC based MCPyV detection in MCC cohorts this study with regard to MCC diagnostics sought to (1) compare widely used qualitative and quantitative MCPyV PCR detection, (2) compare PCR based and immunohistochemistry based detection of MCPyV, and (3) quantify the number of LT-Antigen expressing tumor cells in a cohort of MCC cases collected in Northern Germany. MATERIALS AND METHODS Patients MCC cases were collected in the department of Dermatology at the University Medical Center Hamburg-Eppendorf between the years 1999 and 2011. The study was approved by the local ethics committee (060900). Immunohistochemical Staining LT-Antigen expression: Sections were deparaffinized using xylene and rehydrated using a series of graded ethanol. Endogenous peroxidase expression was blocked using 3% hydrogen peroxidase solution. Sections were heated 4 2 min in citrate buffer using a microwave oven (650 W) and cooled down to room temperature. Blocking of nonspecific binding sites was performed for 30 min at RT with 10% swine serum in antibody dilution buffer (Dako, BIOZOL Diagnostica, Germany). CM2B4 antibody (Santa Cruz Biotechnology, Germany) 1:100 diluted was incubated for 2 hr at RT followed by incubation with the secondary antibody (Dako K4000) for 30 min. Staining was performed with DAB chromagen (Dako K3467) for 10 min at RT. Samples were counterstained with Mayers hamin solution. Sections were coated with crystal mount mounting medium and embedded with Eukitt. Sections were analyzed on an upright Zeiss Axioskop 2 plus microscope (Carl Zeiss, Jena, Germany), equipped with a Leica DFC 290 FX camera using HC PLAN S 10/25 and N PLAN APO 5/0.11 lenses. Images were acquired using Openlab software (Improvision, Coventry, UK) and Leica Application Suite software. CK20 staining was applied following protocol 2 using a CK20 mAb (IT-Ks 20.10, Progen Biotechnik, Germany) at a 1:75 dilution. Quantification of LT Expressing Cells Analysis was based on five representative tumor sections of each tumor. Sections were photo documented and analyzed based on number of tumor cells
MCPyV Detection to Diagnose Merkel Cell Cancer
expressing LT-Antigen and staining intensity: With regard to proportion of LT-Antigen expressing tumor cells, tumors were divided into subgroups with 75% positive tumor cells. Concerning the staining intensity, positive tumor cells were visually graded in þ weak, þþ intermediate, and þþþ strong. Sections were analyzed using an upright Zeiss Axioskop 2 plus microscope (Carl Zeiss), equipped with a Leica DFC 290 FX camera using HC PLAN S 10/25 and N PLAN APO 5/0.11 lenses. Images were processed using Photoshop CS5. MCPyV Detection of LT Sequences by Qualitative PCR MCPyV specific PCR was performed as described [Feng et al., 2008; Fischer et al., 2010]. Briefly, genomic DNA was extracted using QIAamp DNA FFPE tissue kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. DNA (100 ng) was amplified with the two different primer sets located in the LT-Antigen region: Primer set I: M1M2F: 50 GGCATGCCTGTGAATTAGGA, M1M2R: 50 -TTGCAGTAATTTGTAAGGGGACT and primer set II: LT3F: 50 -TTGTCTCGCCAGCATTGTAG, LT5R: 50 -TGGGAAAGTACACAAAATCTGTCA. PCR fragments were submitted to automated sequencing using an ABI Prism 3100 genetic analyzer. Detection of LT Sequences by Quantitative PCR LT quantitative real time PCR was performed as described earlier [Fischer et al., 2010]. Briefly, 100 ng of genomic DNA was amplified in a total volume of 10 ml using the primers LT3F and LT3R [Feng et al., 2008; Fischer et al., 2010] in the presence of Fermentas SyBr Green Master Mix on a Qiagen Rotorgene Q 5plex instrument and Rotorgene 1.7 software using the following conditions: 5 min 95˚C, 40 5 sec 95˚C, 20 sec 60˚C, 20 sec 72˚C. A MCPyV standard was included for calculation of MCPyV copy numbers. Each sample was normalized against GAPDH; GAPDH F: GAAGGTGAAGGTCGGAGTC; GAPDH R: GAAGATGGTGATGGGATTTC. A plasmid containing the genomic GAPDH sequences (pCR2.1-GAPDH-F/R) was included as a standard to determine absolute copy numbers. PCR efficiency for each primer set was determined by plotting the Ct values (determined by using the Rotorgene Software version 1.7) against the log 10 value of template concentration; the slope (M) determines the reaction according to (10 1/M) 1 ¼ 1. RESULTS MCC Patient Data Twenty-seven patients (32 MCC samples) were included in the current analysis: four patients developed metastasis with one patient having multiple metastases (Table I). MCC diagnosis was based on histopathology, CK20, chromogranin A, neuron spe-
1815
cific enolase (NSE) staining and neurofilament expression. 48.15% of patients were female and 51.85% were male. The age of patients ranged between 40 and 94 years with a median age of 75.5 years. MCC tumors were localized in 18.5% of the patients on cheek, forehead and ear, 18.5% of the tumors were localized in the upper torso, and 29.6% of MCC lesions were localized on the upper or lower extremities, while in 33.3% of the MCC cases no data on tumor localization were available. MCPyV Detection by PCR Using DNA From Paraffin Sections To detect MCPyV by PCR qualitative and quantitative PCR was performed. MCPyV sequences, at least one primer pair had to amplify MCPyV specific sequences, were detected in 19/32 cases (59.4%) applying qualitative PCR. Using a different set of primer sequences amplifying a shorter region within the MCPyV genome by real-time PCR 16/29 (55.2%) MCC cases were positive for LT sequences (Table I). Viral copy numbers varied ranging from 0.03 to 152 copies/sample. In six MCC cases very low copy numbers were detected, less than 0.1 copies/cell. LT-Antigen Expression in MCC Tissue Sections PCR results were compared to immunohistochemical staining of MCPyV LT-Antigen (Fig. 1, Table I). 41.9% of MCC samples were positive for LT-Antigen expression. To evaluate the number of MCPyV LT-Antigen expressing cells within the tumor, LT-Antigen expressing cells were calculated in 11 out of 13 LTAntigen positive MCC cases according to a recently published study [Erovic et al., 2013]. The results of IHC staining, number of LT-Antigen expressing cells representative for one of the four classes, class I: less than 25%, class II: 25–50%, class III: 50–75%, and class IV: more than 75%, are illustrated in Figure 1A–C and subsequently summarized in Table II. In 7/11 (63.6%) of MCC cases only 25–50% of all tumor cells express LT-Antigen; 3/11 (27.3%) displayed 50–75% of tumor cells positive for LTAntigen, while in none of the MCC cases all tumor cells stained positive for LT-Antigen expression (Table II). DISCUSSION Identification of MCPyV in MCC tissue in 2008 [Feng et al., 2008] and subsequent association of the virus with up to 90% of MCC [Chang and Moore, 2012] has opened a new understanding in the initiation and progression of MCC. The majority of studies analyzing the association of the virus with MCC have been performed applying qualitative or real-time PCR technology. Discrepancies in MCPyV detection in MCC cases using nucleic acid based technologies range from 40% to 100%. Some J. Med. Virol. DOI 10.1002/jmv
1816
Leitz et al. TABLE I. Summary of MCC Samples
Sample ID
Age
Gender
Origin of tumor
83 87
F M
88 69 66 94 65 55 70 73
F F M F F M F F
Primary Primary Metastasis — Primary Primary — Primary Primary Primary Primary
12 13 14 15 16 17 18 19
69
F
68
M
79 79 81 77
F F M M
Primary Lymphnode Primary Lymphnode Primary Primary Metastasis Primary
20
81
M
Primary
21 22 23 24 25 26 27 28 29 30 31 32
78 69 75 82
M F M M
90 70 85 80 87 40
M M M M F F
Metastasis Primary Metastasis Primary Lymphnode Lymphnode Primary Metastasis Metastasis Metastasis Metastasis Metastasis
1 2 3 4 5 6 7 8 9 10 11
Location of the lesion
% LT express. cells
MCPyV qualitative PCRa
MCPyV quantitative PCRb
CM2B4 IHCc
CK20
— Cheek — Cheek Forehead Arm Cheek — Knee Thigh Upper arm Lower leg Groin Torso Groin Upper leg Lower leg Cheek Upper arm Lower arm Torso — — — — — Ear Groin — — — —
— — 55.4 44.9 61.2 35.3 33.1 — — n.t. 40.2
þ þ þ þ þ þ þ
— 4.8 152 3.7 0.85 0.14 0.75 — — 0.04 0.04
þþ þþþ þ þþ þþ þþ þ
(þ) þ þ þ þ þ þ þ þ
n.t. n.t. — — n.t. 30.4 — —
þ þ þ þ þ
0.08 n.t. — — 0.03 0.06 — 0.4
þ þ n.t. þ
þ þ þ þ þ þ þ þ
—
þ
0.09
þ
— — 7.7 39.2 48.9 29.2 — — 53.9 n.t. n.t. 40.5
þ þ þ þ þ þ þ
— — 0.15 0.24 n.t. n.t. — — 0.55 — — 1.2
þ þþ þ þ þþ þþ
(þ) þ (þ) þ þ þ þ þ þ þ þ þ
MCPyVþ: 19/32 (59.4%) qualitative PCR; 16/29 (55.2%) real-time PCR; IHC: 13/31 (41.9%). n.t., not tested; (þ), partially positive CK20 staining; LT IHC: þ, weak staining; þþ, moderate staining; þþþ, strong staining. a Two individual qualitative PCRs targeting different regions (1711–1889; 571–879; GenBank accession no.: EU375803) in LT were applied. b Primers and protocols have been published earlier [Feng et al., 2008; Fischer et al., 2010]. c Shuda et al. [2009].
discrepancies between percentages of MCC cases positive for the virus can be attributed to geographical differences, for example, MCC cases collected in Australia show significant less viral prevalence. In general, the studies are difficult to compare due to different PCR technologies applied, nucleic acid extraction used and/or number of cases included in the study. However, the differences between studies in Europe and/or North America demonstrate the need for standardization in MCPyV detection. Only few studies used immunohistochemical staining against the viral LT-Antigen applying the so far only commercially available antibody CM2B4 [Busam et al., 2009; Bhatia et al., 2010; Paik et al., 2011; Shuda et al., 2011; Ly et al., 2012; Erovic et al., 2013]. These results, with exception of Australian MCC cases (18.1% LT-Antigen positive) are slightly more consistent with a prevalence of LTexpression of 63–97% [Busam et al., 2009; Bhatia et al., 2010; Paik et al., 2011; Shuda et al., 2011; Ly J. Med. Virol. DOI 10.1002/jmv
et al., 2012; Erovic et al., 2013]. However, recent studies applying a combination of CM2B4 and sTAntigen staining or applying a more sensitive LTAntigen specific antibody (Ab3) significantly increased sensitivity [Shuda et al., 2011; Rodig et al., 2012]. Studies which include both PCR and IHC have only sparsely been conducted [Busam et al., 2009; Bhatia et al., 2010]. This study is the first study comparing qualitative, quantitative PCR, and immunohistochemistry detection of MCPyV in one MCC cohort. There was a good concordance between qualitative and real-time PCR: 59.4% or 55.2% of all cases were MCPyV sequence positive. However, only 8/32 of MCC cases (25%) were positive by both primer sets used in qualitative PCR. This indicates that frequent point mutations within the LT-Antigen occur [Shuda et al., 2008; Neumann et al., 2011; Rodig et al., 2012] and multiple primer sets are necessary to unambiguously detect MCPyV sequences.
MCPyV Detection to Diagnose Merkel Cell Cancer
1817
Fig. 1. Representative tissue section pattern of MCC tumors (A) class I,
Merkel Cell Polyomavirus Detection in Merkel Cell Cancer Tumors in Northern Germany Using PCR and Protein Expression Miriam Leitz,1 Kristin Stieler,1 Adam Grundhoff,2 Ingrid Moll,3 Johanna M. Brandner,3 and Nicole Fischer1* 1
Institute for Microbiology and Virology, University Medical Center Eppendorf, Hamburg, Germany Heinrich-Pette Institute, Leibniz Institute for Experimental Virology, Hamburg, Germany 3 Department for Dermatology and Venerology, University Medical Center Eppendorf, Hamburg, Germany 2
Merkel cell carcinoma is a highly malignant skin cancer which predominantly occurs in elderly and immunocompromised persons. The identification of the Merkel cell polyomavirus (MCPyV) has inaugurated a new understanding of Merkel cell carcinoma pathogenesis. The frequent detection of the virus in Merkel cell carcinoma tissue (70–90%), its monoclonal integration in the tumor cells and the expression of viral oncogenes highly suggest that MCPyV is causally linked to the pathogenesis of the majority of Merkel cell cancer (MCC) cases. Using qualitative and quantitative PCR together with immunohistochemical staining this study aimed at characterizing the presence of MCPyV sequences and viral early gene expression in a cohort of MCC cases (n ¼ 32) selected in Northern Germany. 40–57% of the cases were identified as MCPyV positive with 40.6% of the cases positive by immunohistochemical staining and 51.6–57.6% positive by PCR. Interestingly, in the majority (64%) of LT-Antigen positive tumors only 25–50% of tumor cells express LT-Antigen. These data are in accord with published studies describing heterogeneity in MCPyV viral loads and suggest that detection of MCPyV in Merkel cell carcinoma by PCR should be undertaken using multiple primer pairs. J. Med. Virol. 86: 1813–1819, 2014. # 2013 Wiley Periodicals, Inc.
KEY WORDS:
Merkel cell polyomavirus; immunohistochemistry; LT-Antigen expression; Merkel cell cancer; polyomavirus and skin cancer
C 2013 WILEY PERIODICALS, INC.
INTRODUCTION Merkel cell cancer (MCC) is a rare but highly aggressive neuroendocrine tumor of the skin predominantly found in elderly and immunosuppressed patients. Solid organ transplant patients, patients suffering from leukemia as well as HIV patients have a 15-fold higher risk to develop MCC [AlboresSaavedra et al., 2010]. A panel of immunhistochemical marker proteins including cytokeratin 20 (CK20), neurofilaments, chromogranin, and neuron specific enolase are used to confirm the histological diagnosis of MCC [Albores-Saavedra et al., 2010]. The development of MCC, in particular cellular pathways contributing to MCC pathogenesis is still poorly understood. In 2008, a new polyomavirus from MCC primary tumor material was identified, the Merkel cell polyomavirus [Feng et al., 2008]. Using mostly PCR several groups worldwide confirmed that up to 90% of all MCC cases carry viral sequences [Foulongne et al., 2008; Kassem et al., 2008; Shuda et al., 2008; Becker et al., 2009; Garneski et al., 2009]. The viral DNA is monoclonal integrated in the host genome [Feng et al., 2008; Shuda et al., 2008], which together with LT-Antigen expression within the tumor cells Virus Nomenclature: dsDNA virus, Order not assigned, Family Polyomaviridae, Genus Polyomavirus, Species Merkel cell polyomavirus. Correspondence to: Nicole Fischer, Institute for Medical Microbiology and Virology, University Medical Center Eppendorf, Martinistrasse 52, D-20246 Hamburg, Germany. E-mail: [email protected] Accepted 3 September 2013 DOI 10.1002/jmv.23808 Published online 17 October 2013 in Wiley Online Library (wileyonlinelibrary.com).
1814
contributes to the classification of Merkel cell polyomavirus (MCPyV) as a human tumor virus [Shuda et al., 2009; Bouvard et al., 2012]. Interestingly, all early gene regions of the virus isolated from MCC tumor material carry premature STOP codon mutations within the LT-Antigen region resulting in a truncated LT protein lacking the origin binding domain and the C-terminus of the protein [Shuda et al., 2008; Fischer et al., 2010], which suggest a positive selection for the N-terminal region of the protein encompassing DNAJ domain as well as a retinoblastoma protein (Rb) binding motif or a negative selection against the C-terminal part of the protein essential for viral replication. Most studies addressing MCPyV association with MCC applied qualitative PCR technology to detect viral sequences using genomic DNA isolated from MCC paraffin sections [Feng et al., 2008; Foulongne et al., 2008; Kassem et al., 2008; Becker et al., 2009; Busam et al., 2009; Duncavage et al., 2009; Garneski et al., 2009; Helmbold et al., 2009; Sihto et al., 2009; Touze et al., 2009; Wieland et al., 2009; Bhatia et al., 2010; Loyo et al., 2010]. To increase sensitivity some studies additionally applied nested PCR or southern blot technology [Feng et al., 2008; Kassem et al., 2008; Touze et al., 2009; Wieland et al., 2009]. Quantitative PCR technique used by several studies detecting a 162-bp fragment in the LT-region increased sensitivity and specificity of the detection of MCPyV especially in DNA isolated from paraffin section [Becker et al., 2009; Busam et al., 2009; Garneski et al., 2009; Sihto et al., 2009; Bhatia et al., 2010; Loyo et al., 2012; Hattori et al., 2013]. Reports using PCR to detect MCPyV in MCC vary in MCPyV positivity depending on primer pairs used ranging from 40% to 100% [Feng et al., 2008; Kassem et al., 2008; Becker et al., 2009; Busam et al., 2009; Duncavage et al., 2009; Garneski et al., 2009; SastreGarau et al., 2009; Shuda et al., 2009; Sihto et al., 2009; Touze et al., 2009; Varga et al., 2009; Wetzels et al., 2009; Bhatia et al., 2010; Houben et al., 2010; Loyo et al., 2010; Andres et al., 2011]. Immunohistochemistry using the only commercially available antibody against MCPyV early gene product, CM2B4, recognizing a peptide in the second exon of the LT-Antigen was used in only a few studies so far [Busam et al., 2009; Shuda et al., 2009, 2011; Paik et al., 2011; Ly et al., 2012; Erovic et al., 2013]. Based on the majority of these studies IHC of MCPyV LT-Antigen expression using CM2B4 is highly suitable as a diagnostic tool, however, as observed for PCR based results, discrepancies applying LT IHC exist: frequency of MCC sections positive for LT expression vary from 63% to 97% [Shuda et al., 2009; Ly et al., 2012; Erovic et al., 2013]. In addition, the number of MCC tumors with more than 60% of tumor cells expressing LT-Antigen varies from 35% to 97% [Busam et al., 2009; Erovic et al., 2013]. Interestingly, an earlier report demonstrated that the CM2B4 antibody failed to detect LT-Antigen in J. Med. Virol. DOI 10.1002/jmv
Leitz et al.
several cases of MCC and that a combined use of CM2B4 and a small T (sT)-Antigen specific antibody (CM5E1) significantly increased sensitivity [Shuda et al., 2011]. Furthermore, a more recent study reported significantly increased sensitivity of IHC using a different noncommercial LT-Antigen specific antibody, Ab3 [Rodig et al., 2012]. Intrigued by the discrepancies in nucleic acid based as well as IHC based MCPyV detection in MCC cohorts this study with regard to MCC diagnostics sought to (1) compare widely used qualitative and quantitative MCPyV PCR detection, (2) compare PCR based and immunohistochemistry based detection of MCPyV, and (3) quantify the number of LT-Antigen expressing tumor cells in a cohort of MCC cases collected in Northern Germany. MATERIALS AND METHODS Patients MCC cases were collected in the department of Dermatology at the University Medical Center Hamburg-Eppendorf between the years 1999 and 2011. The study was approved by the local ethics committee (060900). Immunohistochemical Staining LT-Antigen expression: Sections were deparaffinized using xylene and rehydrated using a series of graded ethanol. Endogenous peroxidase expression was blocked using 3% hydrogen peroxidase solution. Sections were heated 4 2 min in citrate buffer using a microwave oven (650 W) and cooled down to room temperature. Blocking of nonspecific binding sites was performed for 30 min at RT with 10% swine serum in antibody dilution buffer (Dako, BIOZOL Diagnostica, Germany). CM2B4 antibody (Santa Cruz Biotechnology, Germany) 1:100 diluted was incubated for 2 hr at RT followed by incubation with the secondary antibody (Dako K4000) for 30 min. Staining was performed with DAB chromagen (Dako K3467) for 10 min at RT. Samples were counterstained with Mayers hamin solution. Sections were coated with crystal mount mounting medium and embedded with Eukitt. Sections were analyzed on an upright Zeiss Axioskop 2 plus microscope (Carl Zeiss, Jena, Germany), equipped with a Leica DFC 290 FX camera using HC PLAN S 10/25 and N PLAN APO 5/0.11 lenses. Images were acquired using Openlab software (Improvision, Coventry, UK) and Leica Application Suite software. CK20 staining was applied following protocol 2 using a CK20 mAb (IT-Ks 20.10, Progen Biotechnik, Germany) at a 1:75 dilution. Quantification of LT Expressing Cells Analysis was based on five representative tumor sections of each tumor. Sections were photo documented and analyzed based on number of tumor cells
MCPyV Detection to Diagnose Merkel Cell Cancer
expressing LT-Antigen and staining intensity: With regard to proportion of LT-Antigen expressing tumor cells, tumors were divided into subgroups with 75% positive tumor cells. Concerning the staining intensity, positive tumor cells were visually graded in þ weak, þþ intermediate, and þþþ strong. Sections were analyzed using an upright Zeiss Axioskop 2 plus microscope (Carl Zeiss), equipped with a Leica DFC 290 FX camera using HC PLAN S 10/25 and N PLAN APO 5/0.11 lenses. Images were processed using Photoshop CS5. MCPyV Detection of LT Sequences by Qualitative PCR MCPyV specific PCR was performed as described [Feng et al., 2008; Fischer et al., 2010]. Briefly, genomic DNA was extracted using QIAamp DNA FFPE tissue kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. DNA (100 ng) was amplified with the two different primer sets located in the LT-Antigen region: Primer set I: M1M2F: 50 GGCATGCCTGTGAATTAGGA, M1M2R: 50 -TTGCAGTAATTTGTAAGGGGACT and primer set II: LT3F: 50 -TTGTCTCGCCAGCATTGTAG, LT5R: 50 -TGGGAAAGTACACAAAATCTGTCA. PCR fragments were submitted to automated sequencing using an ABI Prism 3100 genetic analyzer. Detection of LT Sequences by Quantitative PCR LT quantitative real time PCR was performed as described earlier [Fischer et al., 2010]. Briefly, 100 ng of genomic DNA was amplified in a total volume of 10 ml using the primers LT3F and LT3R [Feng et al., 2008; Fischer et al., 2010] in the presence of Fermentas SyBr Green Master Mix on a Qiagen Rotorgene Q 5plex instrument and Rotorgene 1.7 software using the following conditions: 5 min 95˚C, 40 5 sec 95˚C, 20 sec 60˚C, 20 sec 72˚C. A MCPyV standard was included for calculation of MCPyV copy numbers. Each sample was normalized against GAPDH; GAPDH F: GAAGGTGAAGGTCGGAGTC; GAPDH R: GAAGATGGTGATGGGATTTC. A plasmid containing the genomic GAPDH sequences (pCR2.1-GAPDH-F/R) was included as a standard to determine absolute copy numbers. PCR efficiency for each primer set was determined by plotting the Ct values (determined by using the Rotorgene Software version 1.7) against the log 10 value of template concentration; the slope (M) determines the reaction according to (10 1/M) 1 ¼ 1. RESULTS MCC Patient Data Twenty-seven patients (32 MCC samples) were included in the current analysis: four patients developed metastasis with one patient having multiple metastases (Table I). MCC diagnosis was based on histopathology, CK20, chromogranin A, neuron spe-
1815
cific enolase (NSE) staining and neurofilament expression. 48.15% of patients were female and 51.85% were male. The age of patients ranged between 40 and 94 years with a median age of 75.5 years. MCC tumors were localized in 18.5% of the patients on cheek, forehead and ear, 18.5% of the tumors were localized in the upper torso, and 29.6% of MCC lesions were localized on the upper or lower extremities, while in 33.3% of the MCC cases no data on tumor localization were available. MCPyV Detection by PCR Using DNA From Paraffin Sections To detect MCPyV by PCR qualitative and quantitative PCR was performed. MCPyV sequences, at least one primer pair had to amplify MCPyV specific sequences, were detected in 19/32 cases (59.4%) applying qualitative PCR. Using a different set of primer sequences amplifying a shorter region within the MCPyV genome by real-time PCR 16/29 (55.2%) MCC cases were positive for LT sequences (Table I). Viral copy numbers varied ranging from 0.03 to 152 copies/sample. In six MCC cases very low copy numbers were detected, less than 0.1 copies/cell. LT-Antigen Expression in MCC Tissue Sections PCR results were compared to immunohistochemical staining of MCPyV LT-Antigen (Fig. 1, Table I). 41.9% of MCC samples were positive for LT-Antigen expression. To evaluate the number of MCPyV LT-Antigen expressing cells within the tumor, LT-Antigen expressing cells were calculated in 11 out of 13 LTAntigen positive MCC cases according to a recently published study [Erovic et al., 2013]. The results of IHC staining, number of LT-Antigen expressing cells representative for one of the four classes, class I: less than 25%, class II: 25–50%, class III: 50–75%, and class IV: more than 75%, are illustrated in Figure 1A–C and subsequently summarized in Table II. In 7/11 (63.6%) of MCC cases only 25–50% of all tumor cells express LT-Antigen; 3/11 (27.3%) displayed 50–75% of tumor cells positive for LTAntigen, while in none of the MCC cases all tumor cells stained positive for LT-Antigen expression (Table II). DISCUSSION Identification of MCPyV in MCC tissue in 2008 [Feng et al., 2008] and subsequent association of the virus with up to 90% of MCC [Chang and Moore, 2012] has opened a new understanding in the initiation and progression of MCC. The majority of studies analyzing the association of the virus with MCC have been performed applying qualitative or real-time PCR technology. Discrepancies in MCPyV detection in MCC cases using nucleic acid based technologies range from 40% to 100%. Some J. Med. Virol. DOI 10.1002/jmv
1816
Leitz et al. TABLE I. Summary of MCC Samples
Sample ID
Age
Gender
Origin of tumor
83 87
F M
88 69 66 94 65 55 70 73
F F M F F M F F
Primary Primary Metastasis — Primary Primary — Primary Primary Primary Primary
12 13 14 15 16 17 18 19
69
F
68
M
79 79 81 77
F F M M
Primary Lymphnode Primary Lymphnode Primary Primary Metastasis Primary
20
81
M
Primary
21 22 23 24 25 26 27 28 29 30 31 32
78 69 75 82
M F M M
90 70 85 80 87 40
M M M M F F
Metastasis Primary Metastasis Primary Lymphnode Lymphnode Primary Metastasis Metastasis Metastasis Metastasis Metastasis
1 2 3 4 5 6 7 8 9 10 11
Location of the lesion
% LT express. cells
MCPyV qualitative PCRa
MCPyV quantitative PCRb
CM2B4 IHCc
CK20
— Cheek — Cheek Forehead Arm Cheek — Knee Thigh Upper arm Lower leg Groin Torso Groin Upper leg Lower leg Cheek Upper arm Lower arm Torso — — — — — Ear Groin — — — —
— — 55.4 44.9 61.2 35.3 33.1 — — n.t. 40.2
þ þ þ þ þ þ þ
— 4.8 152 3.7 0.85 0.14 0.75 — — 0.04 0.04
þþ þþþ þ þþ þþ þþ þ
(þ) þ þ þ þ þ þ þ þ
n.t. n.t. — — n.t. 30.4 — —
þ þ þ þ þ
0.08 n.t. — — 0.03 0.06 — 0.4
þ þ n.t. þ
þ þ þ þ þ þ þ þ
—
þ
0.09
þ
— — 7.7 39.2 48.9 29.2 — — 53.9 n.t. n.t. 40.5
þ þ þ þ þ þ þ
— — 0.15 0.24 n.t. n.t. — — 0.55 — — 1.2
þ þþ þ þ þþ þþ
(þ) þ (þ) þ þ þ þ þ þ þ þ þ
MCPyVþ: 19/32 (59.4%) qualitative PCR; 16/29 (55.2%) real-time PCR; IHC: 13/31 (41.9%). n.t., not tested; (þ), partially positive CK20 staining; LT IHC: þ, weak staining; þþ, moderate staining; þþþ, strong staining. a Two individual qualitative PCRs targeting different regions (1711–1889; 571–879; GenBank accession no.: EU375803) in LT were applied. b Primers and protocols have been published earlier [Feng et al., 2008; Fischer et al., 2010]. c Shuda et al. [2009].
discrepancies between percentages of MCC cases positive for the virus can be attributed to geographical differences, for example, MCC cases collected in Australia show significant less viral prevalence. In general, the studies are difficult to compare due to different PCR technologies applied, nucleic acid extraction used and/or number of cases included in the study. However, the differences between studies in Europe and/or North America demonstrate the need for standardization in MCPyV detection. Only few studies used immunohistochemical staining against the viral LT-Antigen applying the so far only commercially available antibody CM2B4 [Busam et al., 2009; Bhatia et al., 2010; Paik et al., 2011; Shuda et al., 2011; Ly et al., 2012; Erovic et al., 2013]. These results, with exception of Australian MCC cases (18.1% LT-Antigen positive) are slightly more consistent with a prevalence of LTexpression of 63–97% [Busam et al., 2009; Bhatia et al., 2010; Paik et al., 2011; Shuda et al., 2011; Ly J. Med. Virol. DOI 10.1002/jmv
et al., 2012; Erovic et al., 2013]. However, recent studies applying a combination of CM2B4 and sTAntigen staining or applying a more sensitive LTAntigen specific antibody (Ab3) significantly increased sensitivity [Shuda et al., 2011; Rodig et al., 2012]. Studies which include both PCR and IHC have only sparsely been conducted [Busam et al., 2009; Bhatia et al., 2010]. This study is the first study comparing qualitative, quantitative PCR, and immunohistochemistry detection of MCPyV in one MCC cohort. There was a good concordance between qualitative and real-time PCR: 59.4% or 55.2% of all cases were MCPyV sequence positive. However, only 8/32 of MCC cases (25%) were positive by both primer sets used in qualitative PCR. This indicates that frequent point mutations within the LT-Antigen occur [Shuda et al., 2008; Neumann et al., 2011; Rodig et al., 2012] and multiple primer sets are necessary to unambiguously detect MCPyV sequences.
MCPyV Detection to Diagnose Merkel Cell Cancer
1817
Fig. 1. Representative tissue section pattern of MCC tumors (A) class I,
