Original Paper Accepted after revision: November 6, 2014 Published online: March 24, 2015
Cells Tissues Organs DOI: 10.1159/000369613
Mechanical Force-Induced Specific MicroRNA Expression in Human Periodontal Ligament Stem Cells F.L. Wei a, d J.H. Wang b G. Ding c S.Y. Yang a Y. Li a Y.J. Hu a S.L. Wang d, e
a
Department of Orthodontics, Shandong Provincial Key Laboratory of Oral Biomedicine, School of Stomatology, Shandong University, Jinan, b Department of Prosthodontics, Qindao Stomatological Hospital, Qingdao, c Department of Stomatology, Yidu Central Hospital, Weifang Medical University, Qingzhou, d Salivary Gland Disease Center and Molecular Laboratory for Gene Therapy and Tooth Regeneration, Beijing Key Laboratory of Tooth Regeneration and Function Reconstruction, Capital Medical University School of Stomatology, and e Department of Biochemistry and Molecular Biology, Capital Medical University School of Basic Medical Sciences, Beijing, PR China
Key Words Mechanical stimulation · Microarray · MicroRNAs · Network analysis · Osteogenic differentiation
tive target genes, which were related to mechanical force. The results from the interaction network provided a basis for postulating the functional roles of miRNAs in PDLSCs. © 2015 S. Karger AG, Basel
© 2015 S. Karger AG, Basel 1422–6405/15/0000–0000$39.50/0 E-Mail [email protected] www.karger.com/cto
Introduction
Periodontal ligament stem cells (PDLSCs), which are capable of differentiating into either osteoblasts or cementoblasts in response to mechanical stimuli [Matsuda et al., 1998; Kawarizadeh et al., 2005], play a pivotal role in alveolar bone remodeling during orthodontic tooth movement [Kawarizadeh et al., 2005]. A better understanding of the regulatory mechanism of PDLSC osteogenic differentiation is a prerequisite to enable further improvements in therapeutic approaches in orthodontics. In recent years, progress in molecular and genetic research
Prof. Songlin Wang Salivary Gland Disease Center and Molecular Laboratory for Gene Therapy and Tooth Regeneration, Beijing Key Laboratory of Tooth Regeneration and Function Reconstruction, Capital Medical University School of Stomatology Tian Tan Xi Li No. 4, Beijing 100050 (PR China) E-Mail slwang @ ccmu.edu.cn Dr. Fulan Wei Department of Orthodontics Shandong Provincial Key Laboratory of Oral Biomedicine School of Stomatology, Shandong University Wenhua Xi Road No. 44-1, Jinan, 250012 (PR China) E-Mail weifl @ sdu.edu.cn
Downloaded by: Rutgers University Alexander Library 128.6.218.72 - 4/8/2015 12:59:39 PM
Abstract It remains unclear how the expression of microRNAs (miRNAs) in human periodontal ligament stem cells (PDLSCs) might respond to mechanical stretch. To investigate specific miRNA expression in stretched PDLSCs, we used a Flexcell® FX5000TM tension system to achieve external mechanical stimulation. Then, a custom-designed microarray assay was performed to investigate and describe the genome-wide differential expression of miRNAs in normal and stretched PDLSCs. Finally, we implemented integrative miRNA target prediction and network analysis approaches to construct an interaction network of the key miRNAs and their putative targets. We found that stretching induced morphological changes and increased alkaline phosphatase (ALP) activity, runt-related transcription factor 2 (RUNX2), osteocalcin (OCN), and bone sialoprotein (BSP) expression in PDLSCs. The microarray data showed that 53 miRNAs were differentially expressed with stretching. With an interaction network, we examined the connections between 10 selected key miRNAs and their puta-
ALP BSP ECs GO KEGG MAPK miRNAs mRNA OCN PDLSCs RT-PCR RUNX2
alkaline phosphatase bone sialoprotein endothelial cells gene ontology Kyoto Encyclopedia of Genes and Genomes mitogen-activated protein kinase microRNAs messenger RNA osteocalcin periodontal ligament stem cells reverse transcription polymerase chain reaction runt-related transcription factor 2
has uncovered various regulatory processes involved in the osteogenic differentiation of PDLSCs when they are subjected to mechanical stress [Li et al., 2014]. Transcription factors, runt-related transcription factor 2 (RUNX2), transcription factor Sp7 (also known as osterix) and β-catenin, are known to be essential for osteoblast differentiation [Komori, 2006]. RUNX2 and osterix also play a vital role in PDLSCs under proper tensile stress [Fujihara et al., 2010; Hong et al., 2010]. However, given the fact that noncoding RNA accounts for 98% of all genomic output in humans [Mattick, 2001], there may be additional mechanisms for controlling of PDLSC osteogenic differentiation other than transcriptional regulation. MicroRNAs (miRNAs), noncoding RNAs, are short single-stranded RNAs of 18–25 nucleotides [Bartel, 2004]. They do not encode protein; instead, they regulate the level of other proteins by decreasing messenger RNA (mRNA) levels or inhibiting translation by binding to the 3′UTR of the target mRNA [Hobert, 2008]. It has been predicted that more than a third of protein-coding genes are under the control of miRNAs [Bartel, 2004]. miRNAs have emerged as important regulators in several biological processes posttranscriptionally [Bartel, 2004; Kloosterman and Plasterk, 2006]. Recent studies demonstrated that miRNAs were differentially expressed between cyclically stretched and nonstretched rat alveolar epithelial cells, including 34 upregulated and 8 downregulated miRNAs [Yehya et al., 2012]. Another study suggested that miR-21 played an important role in mechanical-force-induced variations in cellular functions in vitro [Song et al., 2012]. In addition, miRNA was shown to be involved in regulating differentiation in periodontal ligament cells [Hung et al., 2010]. A recent study demonstrated that miR-218 occupies a critical position in osteo2
Cells Tissues Organs DOI: 10.1159/000369613
genic differentiation of PDLSCs [Gay et al., 2014]. However, the role of miRNA in osteogenic differentiation of PDLSCs exposed to mechanical stretch remains to be elucidated. Thus, this study attempts to investigate the effect of stretch on miRNA expression in PDLSCs.
Materials and Methods Cell Culture and Isolation of PDLSCs All protocols for handling human tissues were approved by the Research Ethics Committee of the Shandong University, China. This study consisted of 14 healthy human first premolars extracted for orthodontic reasons from children aged 12–16 years with their and their parents’ informed consent. The extracted teeth without caries or periodontitis were selected clinically or radiographically for experiments. The isolation and culture of PDLSCs were performed as previously reported [Wei et al., 2012, 2013]. Briefly, the periodontal ligament was gently separated from the middle third root surface of the first premolars from volunteers in the Department of Oral Maxillofacial Surgery, School of Stomatology, Shandong University, and then digested in a solution of 3 mg/ml collagenase type I (SigmaAldrich Corp., St. Louis, Mo., USA) and 4 mg/ml dispase II (SigmaAldrich) for 1 h at 37 ° C. Single-cell suspensions were obtained by passing the cells through a 70-μm strainer (Falcon; BD Labware, Franklin Lakes, N.J., USA). Cells were seeded into 25-cm2 culture flasks (Costar Inc., Cambridge, Mass., USA) with α-modification of Eagle’s medium (Gibco, Invitrogen Corp., Carlsbad, Calif., USA) supplemented with 15% fetal calf serum (Gibco, Invitrogen), 2 mM glutamine, 100 U/ml penicillin and 100 μg/ml streptomycin (Invitrogen), and then incubated at 37 ° C in 5% CO2. The second or third passage of PDLSCs was used in the following experiments.
Application of Mechanical Force External mechanical stimulation was achieved with a Flexcell® FX-5000TM tension system (Flexcell International Corp., Hillsborough, N.C., USA). Flexcell amino silicone-bottom plates were coated with a 0.6 mg/ml collagen I solution (Sigma Aldrich). PDLSCs were seeded onto these plates at a density of approximately 2.5 × 105 cells/cm2. After the cultures had reached approximately 80% confluence, the cells were serum deprived for 24 h. Then, PDLSCs were stretched in a Flexcell FX-5000 tension system. Physiological bone remodeling occurred during orthodontic tooth movement. Thus, the loading regime in vitro was chosen to be within the physiological range. According to previous studies [Hamilton et al., 2004; Gilbert et al., 2010], we imposed 10% equibiaxial strain at 1.0 Hz for 12 h. Control PDLSCs were cultured without stretching. Alkaline Phosphatase Activity Assay After exposure to stretch, PDLSCs were stained to determine alkaline phosphatase (ALP) activity. Cells were fixed with 4% paraformaldehyde and stained with a solution of 0.25% naphthol AS-BI phosphate and 0.75% fast red violet in an ALP kit, according to the manufacturer’s protocol (Sigma-Aldrich). ALP activity was measured with an ALP activity kit according to the manufacturer’s protocol (Sigma-Aldrich). Activity was normalized to the protein concentration in the sample.
Wei /Wang /Ding /Yang /Li /Hu /Wang
Downloaded by: Rutgers University Alexander Library 128.6.218.72 - 4/8/2015 12:59:39 PM
Abbreviations used in this paper
ParafloTM miRNA Microarray Assay Microarray analyses were performed on a cell mixture pooled from 3 volunteers which were not subjected to stretch and on a cell mixture from another 3 volunteers subjected to mechanical stretch; experiments were reproduced twice. TRIzol reagent (Invitrogen) was used to isolate RNAs from cultured cells (normal PDLSCs and PDLSCs stretched for 12 h) according to the manufacturer’s instructions. Microarray assays were performed by an outsourced service provider (LC Sciences). Data were analyzed by first subtracting the background and then normalizing the signals with a LOWESS filter (locally weighted regression) [Bolstad et al., 2003]. For two-color experiments, the ratio of the two sets of signals detected (log2 transformed, balanced) and p values of the t test were calculated. Hierarchical clustering analysis was performed to identify differences between signals, and differentially detected signals were defined as those with p < 0.01.
www.genome.jp/kegg/) annotations of miRNA targets and DAVID (the Database for Annotation, Visualization and Integrated Discovery; http://david.abcc.ncifcrf.gov/) were used as the gene annotation tool. We chose only GO terms with p < 0.01 and a false detection rate ≤5%, and pathways with p < 0.05 and a false detection rate ≤5%, based on Fisher’s exact test. Statistics Analysis All statistical calculations were performed with SAS 9.2 statistical software. Values are means ± SD. Student’s t test was performed for normally distributed data to determine statistically significant differences. The Wilcoxon two-sample test was performed for nonnormally distributed data. A value of p ≤ 0.05 was considered significant.
Results
Stretching of PDLSCs Induced Morphological Changes and Osteogenic Differentiation The stretched PDLSCs displayed a markedly altered morphology (fig. 1). Specifically normal PDLSCs spread out and exhibited a random cellular orientation (fig. 1a). Stretched PDLSCs were elongated, and they had aligned in parallel to the direction of the strain (fig. 1b). PDLSCs that were stretched for 12 h exhibited increased ALP activity, an early marker for osteogenic differentiation, compared to that in normal cells (fig. 1c–e). PCR results showed that stretching of PDLSCs resulted in increases in osteogenic genes RUNX2, OCN and BSP (fig. 1f–h). Protein expression of RUNX2, OCN and BSP also confirmed that changes in the mRNAs for these genes (fig. 1i).
Network Analysis Unique profiles were defined and significant profiles selected with the following criteria: strong signal intensities (signal >1,000), log2 (stretched PDLSCs/normal PDLSCs) >1 and p < 0.01. For miRNAs expressed in significant amounts, we used TargetScan (http://www.targetscan.org/) to predict miRNA target genes. Gene ontology (GO) terms (http://www.geneontology.org/), the Kyoto Encyclopedia of Gene and Genome (KEGG) pathway (http://
miRNA Microarray Analysis RNA gel electrophoresis confirmed that good quality RNA was obtained from both normal and stretched PDLSCs. With miRNA microarray technology, we detected miRNA expression of normal PDLSCs and stretched PDLSCs (fig. 2a–c). We found that 841 miRNAs were expressed in normal PDLSCs, and 748 miRNAs were expressed in stretched PDLSCs (data not shown). Hierarchical clustering analysis was performed to identify differences in miRNA expression between normal and stretched PDLSCs (fig. 2d). Analysis of the microarray data showed that 53 miRNAs were differentially expressed (p < 0.01; table 2). Of these, 26 were upregulated and 27 were downregulated in stretched PDLSCs compared to normal controls. To validate the microarray results, we selected 10 representative miRNAs, including miR-1246, miR-5096, miR-638, miR-663, miR-21, miR-4492, miR-4734, miR3195, miR-4281 and miR-3178, and performed qRT-PCR
Specific MicroRNA Expression in PDLSCs
Cells Tissues Organs DOI: 10.1159/000369613
Real-Time Reverse Transcription Polymerase Chain Reaction A strong signal intensity (signal >1,000), a log2 (stretched PDLSCs/normal PDLSCs) >1 and p < 0.01 were used to select miRNAs for real-time reverse transcription polymerase chain reaction (RT-PCR) validation. miRNAs were isolated from PDLSCs maintained in culture for 3 days that were either normal or stretched (12 h). miRNA and gene primers were both designed with DNAStar version 6.1.3 software (table 1). Samples and primers were mixed in platinum SYBR Green qPCR SuperMix-UDG (Invitrogen: 11733-038). Real-time PCR was carried out for 45 cycles (95 ° C for 10 s, 60 ° C for 30 s) after an initial denaturation step (95 ° C for 10 s).
3
Downloaded by: Rutgers University Alexander Library 128.6.218.72 - 4/8/2015 12:59:39 PM
Western Blot Cells were harvested in RIPA lysis buffer (10 mM Tris, 5 mM EDTA, 0.25% Triton X-100, 300 mM NaCI, PMSF, 1× proteinase inhibitor) as soon as specific experiments were done. The protein concentration was measured using a BCA protein assay reagent kit. Equal aliquots of protein samples were separated by SDSPAGE using 10-20% Tris-glycine gels and then electrotransferred onto polyvinylidene fluoride membranes (Amersham Biosciences, Piscataway, N.J., USA). Membranes were blocked with 5% lipidfree milk in TBST (Tris-buffered saline with 0.1% Tween) for 1 h at room temperature, followed by incubation with primary antibodies at 4 ° C overnight. The membrane was washed with TBST for 10 min 3 times and exposed to HRP-conjugated goat antimouse secondary antibody for 2 h at room temperature. Immunoreactivity was detected using the ECL chemiluminescence reaction (Amersham Pharmacia Biotech Co., Ltd., UK). Loading differences were normalized by assessing the housekeeping protein in each sample. The primary antibodies used were as follows: mouse antiRunx2 (1:1,000; Abcam plc., Cambridge, UK), mouse anti-osteocalcin (1: 500; Invitrogen), mouse anti-bone sialoprotein (BSP; 1:500; Abcam) and rabbit anti-β-actin (1:2,000; Abcam).
Gene/miRNA name
Primer (5′ to 3′)
Primer sequence
RUNX2
forward reverse forward reverse forward reverse forward reverse sequence RT forward reverse sequence RT forward reverse sequence RT forward reverse sequence RT forward reverse sequence RT forward reverse sequence RT forward reverse sequence RT forward reverse sequence RT forward reverse sequence RT forward reverse sequence RT forward reverse sequence RT forward reverse
CGAATGGCAGCACGCTATTAA GTCGCCAAACAGATTCATCCA TAGTGAAGAGACCCAGGCGCT ATAGGCCTCCTGAAAGCCGA GTCACTGGAGCCAATGCAGAA CCCACCATTTGGAGAGGTTGT TCATGGGTGTGAACCATGAGAA GGCATGGACTGTGGTCATGAG AAUGGAUUUUUGGAGCAGG GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCTGCT GGCGGAATGGATTTTTGG CAGTGCAGGGTCCGAGGTAT GUUUCACCAUGUUGGUCAGGC GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGCCTGA CGGCGTTTCACCATGTTG CAGTGCAGGGTCCGAGGTAT AGGGAUCGCGGGCGGGUGGCGGCCU GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGGCCG GTTATTAGGGATCGCGGGC CAGTGCAGGGTCCGAGGTAT AGGCGGGGCGCCGCGGGACCGC GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGCGGTC AGGATTAGGCGGGGCG CAGTGCAGGGTCCGAGGTAT UAGCUUAUCAGACUGAUGUUGA GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCAACA GCCGCGTAGCTTATCAGACT CAGTGCAGGGTCCGAGGTATT GGGGCUGGGCGCGCGCC GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGCGCG ATTATTGGGGCTGGGCG CAGTGCAGGGTCCGAGGT GCUGCGGGCUGCGGUCAGGGCG GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCGCCCT ATTATGCTGCGGGCTGCG CAGTGCAGGGTCCGAGGT CGCGCCGGGCCCGGGUU GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACCCG ATTATTCGCGCCGGGC CGCAGGGTCCGAGGTATTC GGGUCCCGGGGAGGGGGG GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCCCCC TTAATAGGGTCCCGGGGAGG CAGTGCAGGGTCCGAGGT GGGGCGCGGCCGGAUCG GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCGATCC ATTATTGGGGCGCGGC GGCAGGGTCCGAGGTATTC AUUUGCUAUCUGAGAGAUGGUGAUGACAUUUUAAACCACCAAGAUCGCUGAUGCA CGCAGGGTCCGAGGTATTC GCCGCCATTTGCTATCTGAG CGCAGGGTCCGAGGTATTC
OCN BSP GAPDH hsa-miR-1246
hsa-miR-5096
hsa-miR-638
hsa-miR-663
hsa-miR-21
hsa-miR-4492
hsa-miR-4734
hsa-miR-3195
hsa-miR-4281
hsa-miR-3178
RNU24
4
Cells Tissues Organs DOI: 10.1159/000369613
Wei /Wang /Ding /Yang /Li /Hu /Wang
Downloaded by: Rutgers University Alexander Library 128.6.218.72 - 4/8/2015 12:59:39 PM
Table 1. Gene/miRNA primers
a
b
c
d
2.5
*
0.8 0.6 0.4 0.2 0
0h
1.5 1.0 0.5 0
f
12 h
3
*
Specific MicroRNA Expression in PDLSCs
g
3
2
BSP/GAPDH
OCN/GAPDH
phological changes and osteogenic differentiation. a, b PDLSCs in the control group are randomly organized, but PDLSCs in the stretched group are aligned in parallel to the direction of strain, providing organized morphology. Stretching of PDLSCs resulted in enhanced ALP activity (c–e) and increases in osteogenic genes RUNX2, OCN and BSP (f–h). * p < 0.05. Values are means ± SD for triplicate samples from a representative experiment. i Western blot results showed protein expression of RUNX2, OCN and BSP. a, b Scale bars = 200 μm.
1
0
0h
h
12 h
2 1 0
0h
RUNX2
OCN
BSP
DŽ$FWLQ
DŽ$FWLQ
DŽ$FWLQ
i
0h
12 h
4
* Fig. 1. Stretching of PDLSCs induced mor-
0h
12 h
0h
Cells Tissues Organs DOI: 10.1159/000369613
12 h
12 h
0h
12 h
5
Downloaded by: Rutgers University Alexander Library 128.6.218.72 - 4/8/2015 12:59:39 PM
e
*
2.0 RUNX2/GAPDH
Sigma unit/min/mg protein
1.0
b
a
c
d
Cells Tissues Organs DOI: 10.1159/000369613
&RQWURO3'/6&V 6WUHWFKHG3'/6&V
15
10
5
78
m
iR -
31
81 42
95
iR m
m
iR -
31
34 47 iR -
m
iR -
44
92
21 m
iR m
63 -6 iR
m
iR
-6
38
96 m
50 iR m
m
e
iR -
12
46
0
Wei /Wang /Ding /Yang /Li /Hu /Wang
Downloaded by: Rutgers University Alexander Library 128.6.218.72 - 4/8/2015 12:59:39 PM
6
20
Expression level (2 – ©&T)
Fig. 2. Microarray hybridization signals and miRNA expression profiles analyzed with hierarchical clustering of normal and stretched PDLSCs. a–c Microarrays show miRNA expression profiles of normal PDLSCs (a), stretched PDLSCs (b) and normal and stretched PDLSC signals overlaid (c). Red: p < 0.01, green: p > 0.01. d miRNA expression was analyzed with hierarchical clustering, and 53 differential profiles were found between normal and stretched PDLSCs. Red indicates a gene that was highly expressed at that stage. Green indicates a gene that was rarely expressed at that stage. e qRT-PCR was used to determine miRNA expression (miR1246, miR-5096, miR-638, miR-663, miR21, miR-4492, miR-4734, miR-3195, miR4281 and miR-3178). qRT-PCR analysis validated the microarray analysis. RNU24 was used for normalization. Values are means ± SD for triplicate samples from a representative experiment.
Table 2. Differentially expressed miRNAs between control PDLSCs and stretched PDLSCs
Upregulated hsa-miR-1246 hsa-miR-1290 hsa-miR-4685-5p hsa-miR-4487 hsa-miR-4655-5p hsa-miR-764 hsa-miR-4317 hsa-miR-654-5p hsa-miR-5096 hsa-miR-638 hsa-miR-4732-5p hsa-miR-4419b hsa-miR-1587 hsa-miR-663 hsa-miR-21 hsa-miR-4507 hsa-miR-4492 hsa-miR-1268b hsa-miR-4734 hsa-miR-4484 hsa-miR-4505 hsa-miR-1268 hsa-miR-4508 hsa-miR-24 hsa-miR-1915 hsa-miR-3665
PDLSC signal 47.56 1.00 28.84 25.33 11.71 11.61 12.62 35.79 308.69 5,547.10 73.55 49.98 130.15 636.19 932.72 212.21 532.76 279.12 853.85 1,202.05 558.32 308.39 2,219.59 3,428.03 1,623.71 23,170.05
Stretched PDLSC signal
log2
miRNAs
13,908.49 256.06 314.49 370.21 185.79 122.00 122.15 216.48 1,781.10 23,466.84 253.71 172.03 395.09 1,630.78 2,302.91 527.61 1,255.42 622.29 1,893.44 2,326.41 1,070.01 529.21 3,515.04 4,861.48 2,240.67 25,518.25
8.35 7.99 5.35 4.21 3.99 3.39 3.27 2.59 2.53 2.08 1.79 1.78 1.60 1.35 1.33 1.31 1.22 1.16 1.15 0.95 0.94 0.78 0.67 0.50 0.46 0.14
Downregulated hsa-miR-107 hsa-miR-423-5p hsa-miR-103a hsa-miR-3195 hsa-miR-4281 hsa-miR-3178 hsa-miR-16 hsa-miR-145 hsa-miR-762 hsa-miR-455-3p hsa-miR-127-3p hsa-miR-214 hsa-miR-4668-5p hsa-miR-222 hsa-miR-23b hsa-miR-181a hsa-miR-4739 hsa-miR-3940-5p hsa-miR-4488 hsa-miR-3141 hsa-miR-100 hsa-miR-125b hsa-miR-221 hsa-miR-26a hsa-miR-3656 hsa-miR-4497 hsa-miR-4516
analyses in triplicate samples. The expression levels of all the selected miRNAs were consistent with the normalized microarray data (fig. 2e). PCR results were consistent with the normalized microarray data. Prediction of miRNA Targets and Networks In hierarchical clustering analysis, 10 differentiationrelated miRNAs (hsa-miR-1246, hsa-miR-5096, hsamiR-638, hsa-miR-663, hsa-miR-21, hsa-miR-4492, hsamiR-4734, hsa-miR-3195, hsa-miR-4281 and hsamiR-3178) changed more significantly than the others. We selected these 10 miRNAs based on a strong signal intensity (signal >1,000), a log2 (stretched PDLSCs/normal PDLSCs) >1 and p < 0.01. Fisher’s exact test was performed to detect the possible target genes and functions of these 10 miRNAs. We identified 8,117 predicted miRNA-mRNA interactions (online suppl. material 1; see www.karger.com/doi/10.1159/000369613 for all online Specific MicroRNA Expression in PDLSCs
PDLSC signal 621.53 542.38 762.54 1,292.70 4,331.44 1,286.74 558.45 949.19 1,000.43 878.65 497.82 2,907.58 4,131.64 14,986.62 10,141.94 1,108.79 1,885.92 1,841.13 5,761.42 2,636.18 2,943.43 7,658.42 7,195.55 2,192.10 5,336.41 6,879.27 7,742.27
Stretched PDLSC signal 271.90 245.20 350.67 612.61 2,067.15 632.49 281.83 530.10 558.61 514.56 302.84 1,839.19 2,659.67 9,816.27 7,031.43 776.41 1,354.36 1,342.27 4,270.08 1,977.67 2,260.79 5,988.67 5,725.58 1,756.43 4,458.57 5,922.25 6,736.02
log2
–1.19 –1.15 –1.12 –1.08 –1.08 –1.02 –0.99 –0.85 –0.84 –0.77 –0.72 –0.66 –0.64 –0.61 –0.53 –0.51 –0.48 –0.46 –0.43 –0.41 –0.38 –0.36 –0.33 –0.32 –0.26 –0.22 –0.20
suppl. material). All targets were then processed by target gene function (GO) and KEGG pathway annotation analyses. Based on the GO and the KEGG pathway-significance analyses, we identified the most significant GO/ KEGG target genes (online suppl. material 2–5). The GO project provided the ontology of defined terms, which represented the gene product properties (fig. 3). We created a diagram of an miRNA gene regulatory network (fig. 4) that quantitatively separated the core regulatory functions of miRNAs and their target genes.
Discussion
In the present study, we demonstrated that PDLSCs exposed to stretch showed increased osteogenic differentiation, and 53 miRNAs were expressed significantly differently in stretched PDLSCs compared with normal Cells Tissues Organs DOI: 10.1159/000369613
7
Downloaded by: Rutgers University Alexander Library 128.6.218.72 - 4/8/2015 12:59:39 PM
miRNAs
S gene number
Se q
ue
nc eRe spe g Po ul cific at sit io DN iv n e of A b re gu in t P la la ran din tio sm sc ri g n a of Se Reg m pt tra qu ul Zin em ion ns en atio c io br a cr ce ip -s n o n b ne tio pe f A in d c n R fro ific F G ing m DN TP a Ex RN A b se te rn A p ind al ol in si ym g A er H RF de om G as o op TPa f pl e se asm N h ili eg N a c er at ce ctiv a vo iv ll a e us ad tor re sy gu st Cel hes la em l a io tio H ist de dhe n n of on ve sio tra lo e pm n de ns I n ac cr t et rac ent ip yl tio a el Sm n f Me se lula al rom tal bin r lG io d TP RN n b ing as A i e- po ndi n m l Re ed ym g sp ia era on ted se se sig t De o h nal y nd po rit xi Re ic a gu la Vas spi tio o n n dila e Re of gu tio ne la n tio ur on n C of og al tra ni Go nsc tion lg rip ia t pp ion ar at us
1,300 1,200 1,100 1,000 900 800 700 600 500 400 300 200 100 0
GO term
Fig. 3. miRNA target gene function. Based on GO analyses, these targets genes had a wide range of diverse func-
tions, including molecular function, biological processes and cellular components, etc.
8
Cells Tissues Organs DOI: 10.1159/000369613
al., 2010]. Mechanical stretch upregulated the expression of miR-26a, which attenuates the endogenous glycogen synthase kinase-3β protein levels followed by the induction of human airway smooth muscle cell hypertrophy [Mohamed et al., 2010]. In accordance with the above studies, our microarray analyses demonstrated that strain modulated the expression of 53 miRNAs in PDLSCs: 26 miRNAs were upregulated and 27 downregulated. Next, we identified 10 differentiation-related miRNAs (miR-1246, miR-5096, miR-638, miR-663, miR-21, miR4492, miR-4734, miR-3195, miR-4281 and miR-3178). It has been found that shear stress could modulate miR-21 expression; this change in miR-21 then modulated EC apoptosis and EC nitric oxide synthase activity [Weber et al., 2010]. It was also reported that oscillatory shear stress could induce sustained miR-21 expression in ECs, which was implicated in flow-mediated, endothelial inflammation [Zhou et al., 2011]. Cyclic stretch was also shown to modulate miR-21 expression. That study suggested that increased miR-21 expression may be involved in the regWei /Wang /Ding /Yang /Li /Hu /Wang
Downloaded by: Rutgers University Alexander Library 128.6.218.72 - 4/8/2015 12:59:39 PM
PDLSCs. Mechanical stretch regulated miRNA expression in PDLSCs, and these miRNAs were involved in osteogenic differentiation of PDLSCs. This result provides a potential explanation for the previous observation that miRNAs are involved in mechanical-force-induced variations in cellular functions in vitro. There are different miRNAs expressing under mechanical environment. miRNAs were differentially expressed between cyclically stretched and nonstretched rat alveolar epithelial cells, including 34 upregulated and 8 downregulated miRNAs [Yehya et al., 2012]. It was also reported that mechanical loading modulated the expression of multiple miRNAs that regulate cell proliferation and extracellular matrix synthesis in tendon fibroblasts, which indicated that miRNA could play an important role in the adaptation of tendons to growth stimuli [Mendias et al., 2012]. Laminar shear stress modulates miRNAs expression in endothelial cells (ECs) and miR19a plays an important role in the flow regulation of cyclin D1 expression and endothelial proliferation [Qin et
a
Fig. 4. miRNA-gene network. The constructed subnetwork of miRNAs and their potential target genes show enrichment of genes involved in MAPK (a) and Wnt (b) signaling pathways. A number of miRNA potential target genes were affected by stretch-
ing based on both GO and KEGG pathway analyses. Red: potential target genes of ten key miRNAs in MAPK and Wnt signaling pathways.
Specific MicroRNA Expression in PDLSCs
Cells Tissues Organs DOI: 10.1159/000369613
9
Downloaded by: Rutgers University Alexander Library 128.6.218.72 - 4/8/2015 12:59:39 PM
b
10
Cells Tissues Organs DOI: 10.1159/000369613
overexpressed in stretched PDLSCs were involved in several signaling pathways associated with osteogenic differentiation, like MAPK and Wnt. We built a pathway interaction network that included the MAPK and Wnt pathways. We used this network to uncover useful clues regarding how miRNAs influenced the cellular and molecular responses of PDLSCs to mechanical force. In summary, stretched PDLSCs displayed an miRNA expression profile different from that observed in normal PDLSCs: 26 miRNAs were upregulated and 27 downregulated. We constructed an interaction network of key miRNAs and their target genes (which were related to mechanical force) to postulate the functional roles of miRNAs in PDLSCs. This integrated analysis provided important information that may inspire further experimental investigation into the behavior of miRNAs and their targets in response to mechanical force. Acknowledgments This work was supported by the Chinese, Shandong and Beijing Governments (National Natural Science Foundation of China Nos. 81200758, 81470709 and 81371109, Independent Innovation Foundation of Shandong University No. 2011GN038, Jinan Scientific Researcher Start-Up Program of University No. 201102066, Science and Technology Development Plan of Shandong Province No. 2010GSF10267) and Beijing Municipality Government grants (Beijing Scholar Program-PXM 2013_014226_000055, PXM2014_014226_000048, PXM2014_ 014226_000013, PXM2014_014226_000053, Z121100005212004, PXM 2013_014226_000021, PXM 2013_014226_07_000080 and TJSHG201310025005).
Disclosure Statement The authors declare that they have no potential conflicts of interest with respect to the authorship and/or publication of this article.
References
Bartel, D.P. (2004) MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116: 281–297. Bolstad, B.M., R.A. Irizarry, M. Astrandand, T.P. Speed (2003) A comparison of normalization methods for high density oligonucleotide array data based on variance and bias. Bioinformatics 19: 185–193. Fujihara, C., S. Yamada, N. Ozaki, N. Takeshita, H. Kawaki, T. Takano-Yamamoto, S. Murakami (2010) Role of mechanical stress-induced glutamate signaling-associated molecules in cytodifferentiation of periodontal ligament cells. J Biol Chem 285: 28286–28297.
Wei /Wang /Ding /Yang /Li /Hu /Wang
Downloaded by: Rutgers University Alexander Library 128.6.218.72 - 4/8/2015 12:59:39 PM
ulation of human aortic smooth muscle cell proliferation and apoptosis mediated by stretch [Song et al., 2012]. Oscillatory shear stress also increased miR-663 expression, which plays a role in the inflammatory response of ECs [Ni et al., 2011]. Therefore, miR-21 and miR-663 are thought to play important roles in mechanical-force-induced variations in cellular functions. Among the miRNAs reported to be upregulated in stretched PDLSCs in our study, miR-1246 was the most highly expressed miRNA. miR-1246 was a novel target of p53 to suppress the expression of DYRK1A and consequently activate NFAT [Liao et al., 2012]. miR-1246 was significantly underexpressed >2-fold in diseased versus healthy gingival tissue, which suggested that miR-1246 played an important role in periodontal tissue homeostasis [Stoecklin-Wasmer et al., 2012]. In our dataset, miR638 expression was higher in stretched PDLSCs. miR-638 has been reported to be downregulated in human basal cell carcinomas [Sand et al., 2012], chronic lymphocytic leukemias [Zhu et al., 2012] and colorectal carcinoma tissue compared with adjacent tissues [Ma et al., 2014]. SOX2 is a Yamanaka factor that can induce pluripotent stem cells from mouse embryonic and adult fibroblast cultures [Takahashi and Yamanaka, 2006]. SOX2 was identified as the functional target gene of miR-638 in colorectal cancer [Ma et al., 2014]. SOX2 overexpression promotes dedifferentiation and induces epithelial-to-mesenchymal transition [Herreros-Villanueva et al., 2013]. These results imply that miR-638 plays certain roles in differentiation by targeting SOX2. miR-5096 was downregulated in the SGC-7901/5-Fu cell line compared with its parental cell line [Wang et al., 2013]. There are few data about miR4492, miR-4734, miR-3195, miR-4281 and miR-3178. miRNAs regulate gene expression at the posttranscriptional level by degrading their target mRNAs or by translational repression [Bartel et al., 2004]. Based on our GO data, a number of miRNA target genes were under- or overexpressed in stretched PDLSCs. The GO enrichment analysis of functional significance demonstrated that these targets had a wide range of diverse functions, including molecular function, biological processes and cellular components, etc. miRNAs also activate multiple signaling pathways. The mitogen-activated protein kinase (MAPK) signaling pathway plays an important role in the osteogenic differentiation of mesenchymal stem cells in response to mechanical strain [Yan et al., 2012]. The Wnt signaling pathway is required for the osteogenic response to mechanical loading [Tu et al., 2012]. Based on the KEGG data, the putative target genes of miRNAs that were under- or
Specific MicroRNA Expression in PDLSCs
Ma, K., X. Pan, P. Fan, Y. He, J. Gu, W. Wang, T. Zhang, Z. Li , X. Luo (2014) Loss of miR-638 in vitro promotes cell invasion and a mesenchymal-like transition by influencing SOX2 expression in colorectal carcinoma cells. Mol Cancer 13: 118. Matsuda, N., N. Morita, K. Matsuda, M. Watanabe (1998) Proliferation and differentiation of human osteoblast cells associated with differential activation of MAP kinases in response to epidermal growth factor, hypoxia, and mechanical stress in vitro. Biochem Biophys Res Commun 249: 350–354. Mattick, J.S. (2001) Non-coding RNAs: the architects of eukaryotic complexity. EMBO Rep 2: 986–991. Mendias, C.L., J.P. Gumucio, E.B. Lynch (2012) Mechanical loading and TGF-β change the expression of multiple miRNAs in tendon fibroblasts. J Appl Physiol (1985) 113: 56– 62. Mohamed, J.S., M.A. Lopez, A.M. Boriek (2010) Mechanical stretch up-regulates microRNA26a and induces human airway smooth muscle hypertrophy by suppressing glycogen synthase kinase-3b. J Biol Chem 285: 29336– 29347. Ni, C.W., H. Qiu, H. Jo (2011) MicroRNA-663 upregulated by oscillatory shear stress plays a role in inflammatory response of endothelial cells. Am J Physiol Heart Circ Physiol 300: H1762–H1769. Qin, X., X. Wang, Y. Wang, Z. Tang, Q. Cui, J. Xi, Y.S. Li, S. Chien, N. Wang (2010) MicroRNA19a mediates the suppressive effect of laminar flow on cyclin D1 expression in human umbilical vein endothelial cells. Proc Natl Acad Sci USA 107: 3240–3244. Sand, M., M. Skrygan, D. Sand, D. Georgas, S.A. Hahn, T. Gambichler, P. Altmeyer, F.G. Bechara (2012) Expression of microRNAs in basal cell carcinoma. Br J Dermatol 167: 847– 855. Song, J.T., B. Hu, H.Y. Qu, C.L. Bi, X.Z. Huang, M. Zhang (2012) Mechanical stretch modulates microRNA 21 expression, participating in proliferation and apoptosis in cultured human aortic smooth muscle cells. PLoS One 7: e47657. Stoecklin-Wasmer, C., P. Guarnieri, R. Celenti, R.T. Demmer, M. Kebschull, P.N. Papapanou (2012) MicroRNAs and their target genes in gingival tissues. J Dent Res 91: 934– 940.
Cells Tissues Organs DOI: 10.1159/000369613
Takahashi, K, S. Yamanaka (2006) Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126: 663–676. Tu, X., Y. Rhee, K.W. Condon, N. Bivi, M.R. Allen, D. Dwyer, M. Stolina, C.H. Turner, A.G. Robling, L.I. Plotkin, T. Bellido (2012) Sost downregulation and local Wnt signaling are required for the osteogenic response to mechanical loading. Bone 50: 209–217. Wang, Y., X. Gu, Z. Li, J. Xiang, J. Jiang, Z. Chen (2013) microRNA expression profiling in multidrug resistance of the 5-Fu-induced SGC-7901 human gastric cancer cell line. Mol Med Rep 7: 1506–1510. Weber, M., M.B. Baker, J.P. Moore, C.D. Searles (2010) MiR-21 is induced in endothelial cells by shear stress and modulates apoptosis and eNOS activity. Biochem Biophys Res Commun 393: 643–648. Wei, F., C. Qu, T. Song, G. Ding, Z. Fan, D. Liu, Y. Liu, C. Zhang, S. Shi, S. Wang (2012) Vitamin C treatment promotes mesenchymal stem cell sheet formation and tissue regeneration by elevating telomerase activity. J Cell Physiol 227: 3216–3224. Wei, F., T. Song, G. Ding, J. Xu, Y. Liu, D. Liu, Z. Fan, C. Zhang, S. Shi, S. Wang (2013) Functional tooth restoration by allogeneic mesenchymal stem cell-based bio-root regeneration in swine. Stem Cells Dev 22: 1752–1762. Yan, Y.X., Y.W. Gong, Y. Guo, Q. Lv, C. Guo, Y. Zhuang, Y. Zhang, R. Li, X.Z. Zhang (2012) Mechanical strain regulates osteoblast proliferation through integrin-mediated ERK activation. PLoS One 7: e35709. Yehya, N., A. Yerrapureddy, J. Tobias, S.S. Margulies (2012) MicroRNA modulate alveolar epithelial response to cyclic stretch. BMC Genomics 13: 154. Zhou, J., K.C. Wang, W. Wu, S. Subramaniam, J.Y. Shyy, J.J. Chiu, J.Y. Li, S. Chien (2011) MicroRNA-21 targets peroxisome proliferatorsactivated receptor-alpha in an autoregulatory loop to modulate flow-induced endothelial inflammation. Proc Natl Acad Sci USA 108: 10355–10360. Zhu, D.X., W. Zhu, C. Fang, L. Fan, Z.J. Zou, Y.H. Wang, P. Liu, M. Hong, K.R. Miao, P. Liu, W. Xu, J.Y. Li (2012) miR-181a/b significantly enhances drug sensitivity in chronic lymphocytic leukemia cells via targeting multiple anti-apoptosis genes. Carcinogenesis 33: 1294– 1301.
11
Downloaded by: Rutgers University Alexander Library 128.6.218.72 - 4/8/2015 12:59:39 PM
Gay, I., A. Cavender, D. Peto, Z. Sun, A. Speer, H. Cao, B.A. Amendt (2014) Differentiation of human dental stem cells reveals a role for microRNA-218. J Periodontal Res 49: 110–120. Gilbert, H.T., J.A. Hoyland, S.J. Millward-Sadler (2010) The response of human anulus fibrosus cells to cyclic tensile strain is frequencydependent and altered with disc degeneration. Arthritis Rheum 62: 3385–3394. Hamilton, D.W., T.M. Maul, D.A. Vorp (2004) Characterization of the response of bone marrow-derived progenitor cells to cyclic strain: implications for vascular tissue-engineering applications. Tissue Eng 10: 361–369. Herreros-Villanueva, M., J.S. Zhang, A. Koenig, E.V. Abel, T.C. Smyrk, W.R. Bamlet, A.A. de Narvajas, T.S. Gomez, D.M. Simeone, L. Bujanda, D.D. Billadeau (2013) SOX2 promotes dedifferentiation and imparts stem cell-like features to pancreatic cancer cells. Oncogenesis 2: e61. Hobert, O. (2008) Gene regulation by transcription factors and microRNAs. Science 319: 1785–1786. Hong, S.Y., Y.M. Jeon, H.J. Lee, J.G. Kim, J.A. Baek, J.C. Lee (2010) Activation of RhoA and FAK induces ERK-mediated osteopontin expression in mechanical force-subjected periodontal ligament fibroblasts. Mol Cell Biochem 335: 263–272. Hung, P.S., F.C. Chen, S.H. Kuang, S.Y. Kao, S.C. Lin, K.W. Chang (2010) miR-146a induces differentiation of periodontal ligament cells. J Dent Res 89: 252–257. Kawarizadeh, A., C. Bourauel, W. Götz, A. Jäger (2005) Early responses of periodontal ligament cells to mechanical stimulus in vivo. J Dent Res 84: 902–906. Kloosterman, W.P., R.H. Plasterk (2006) The diverse functions of microRNAs in animal development and disease. Dev Cell 11: 441–450. Komori, T. (2006) Regulation of osteoblast differentiation by transcription factors. J Cell Biochem 99: 1233–1239. Li, L., M.X. Han, S. Li, Y. Xu, L. Wang (2014) Hypoxia regulates the proliferation and osteogenic differentiation of human periodontal ligament cells under cyclic tensile stress via MAPK pathways. J Periodontol 85: 498– 508. Liao, J.M., X. Zhou, Y. Zhang, H. Lu (2012) MiR1246: a new link of the p53 family with cancer and Down syndrome. Cell Cycle 11: 2624– 2630.
Cells Tissues Organs DOI: 10.1159/000369613
Mechanical Force-Induced Specific MicroRNA Expression in Human Periodontal Ligament Stem Cells F.L. Wei a, d J.H. Wang b G. Ding c S.Y. Yang a Y. Li a Y.J. Hu a S.L. Wang d, e
a
Department of Orthodontics, Shandong Provincial Key Laboratory of Oral Biomedicine, School of Stomatology, Shandong University, Jinan, b Department of Prosthodontics, Qindao Stomatological Hospital, Qingdao, c Department of Stomatology, Yidu Central Hospital, Weifang Medical University, Qingzhou, d Salivary Gland Disease Center and Molecular Laboratory for Gene Therapy and Tooth Regeneration, Beijing Key Laboratory of Tooth Regeneration and Function Reconstruction, Capital Medical University School of Stomatology, and e Department of Biochemistry and Molecular Biology, Capital Medical University School of Basic Medical Sciences, Beijing, PR China
Key Words Mechanical stimulation · Microarray · MicroRNAs · Network analysis · Osteogenic differentiation
tive target genes, which were related to mechanical force. The results from the interaction network provided a basis for postulating the functional roles of miRNAs in PDLSCs. © 2015 S. Karger AG, Basel
© 2015 S. Karger AG, Basel 1422–6405/15/0000–0000$39.50/0 E-Mail [email protected] www.karger.com/cto
Introduction
Periodontal ligament stem cells (PDLSCs), which are capable of differentiating into either osteoblasts or cementoblasts in response to mechanical stimuli [Matsuda et al., 1998; Kawarizadeh et al., 2005], play a pivotal role in alveolar bone remodeling during orthodontic tooth movement [Kawarizadeh et al., 2005]. A better understanding of the regulatory mechanism of PDLSC osteogenic differentiation is a prerequisite to enable further improvements in therapeutic approaches in orthodontics. In recent years, progress in molecular and genetic research
Prof. Songlin Wang Salivary Gland Disease Center and Molecular Laboratory for Gene Therapy and Tooth Regeneration, Beijing Key Laboratory of Tooth Regeneration and Function Reconstruction, Capital Medical University School of Stomatology Tian Tan Xi Li No. 4, Beijing 100050 (PR China) E-Mail slwang @ ccmu.edu.cn Dr. Fulan Wei Department of Orthodontics Shandong Provincial Key Laboratory of Oral Biomedicine School of Stomatology, Shandong University Wenhua Xi Road No. 44-1, Jinan, 250012 (PR China) E-Mail weifl @ sdu.edu.cn
Downloaded by: Rutgers University Alexander Library 128.6.218.72 - 4/8/2015 12:59:39 PM
Abstract It remains unclear how the expression of microRNAs (miRNAs) in human periodontal ligament stem cells (PDLSCs) might respond to mechanical stretch. To investigate specific miRNA expression in stretched PDLSCs, we used a Flexcell® FX5000TM tension system to achieve external mechanical stimulation. Then, a custom-designed microarray assay was performed to investigate and describe the genome-wide differential expression of miRNAs in normal and stretched PDLSCs. Finally, we implemented integrative miRNA target prediction and network analysis approaches to construct an interaction network of the key miRNAs and their putative targets. We found that stretching induced morphological changes and increased alkaline phosphatase (ALP) activity, runt-related transcription factor 2 (RUNX2), osteocalcin (OCN), and bone sialoprotein (BSP) expression in PDLSCs. The microarray data showed that 53 miRNAs were differentially expressed with stretching. With an interaction network, we examined the connections between 10 selected key miRNAs and their puta-
ALP BSP ECs GO KEGG MAPK miRNAs mRNA OCN PDLSCs RT-PCR RUNX2
alkaline phosphatase bone sialoprotein endothelial cells gene ontology Kyoto Encyclopedia of Genes and Genomes mitogen-activated protein kinase microRNAs messenger RNA osteocalcin periodontal ligament stem cells reverse transcription polymerase chain reaction runt-related transcription factor 2
has uncovered various regulatory processes involved in the osteogenic differentiation of PDLSCs when they are subjected to mechanical stress [Li et al., 2014]. Transcription factors, runt-related transcription factor 2 (RUNX2), transcription factor Sp7 (also known as osterix) and β-catenin, are known to be essential for osteoblast differentiation [Komori, 2006]. RUNX2 and osterix also play a vital role in PDLSCs under proper tensile stress [Fujihara et al., 2010; Hong et al., 2010]. However, given the fact that noncoding RNA accounts for 98% of all genomic output in humans [Mattick, 2001], there may be additional mechanisms for controlling of PDLSC osteogenic differentiation other than transcriptional regulation. MicroRNAs (miRNAs), noncoding RNAs, are short single-stranded RNAs of 18–25 nucleotides [Bartel, 2004]. They do not encode protein; instead, they regulate the level of other proteins by decreasing messenger RNA (mRNA) levels or inhibiting translation by binding to the 3′UTR of the target mRNA [Hobert, 2008]. It has been predicted that more than a third of protein-coding genes are under the control of miRNAs [Bartel, 2004]. miRNAs have emerged as important regulators in several biological processes posttranscriptionally [Bartel, 2004; Kloosterman and Plasterk, 2006]. Recent studies demonstrated that miRNAs were differentially expressed between cyclically stretched and nonstretched rat alveolar epithelial cells, including 34 upregulated and 8 downregulated miRNAs [Yehya et al., 2012]. Another study suggested that miR-21 played an important role in mechanical-force-induced variations in cellular functions in vitro [Song et al., 2012]. In addition, miRNA was shown to be involved in regulating differentiation in periodontal ligament cells [Hung et al., 2010]. A recent study demonstrated that miR-218 occupies a critical position in osteo2
Cells Tissues Organs DOI: 10.1159/000369613
genic differentiation of PDLSCs [Gay et al., 2014]. However, the role of miRNA in osteogenic differentiation of PDLSCs exposed to mechanical stretch remains to be elucidated. Thus, this study attempts to investigate the effect of stretch on miRNA expression in PDLSCs.
Materials and Methods Cell Culture and Isolation of PDLSCs All protocols for handling human tissues were approved by the Research Ethics Committee of the Shandong University, China. This study consisted of 14 healthy human first premolars extracted for orthodontic reasons from children aged 12–16 years with their and their parents’ informed consent. The extracted teeth without caries or periodontitis were selected clinically or radiographically for experiments. The isolation and culture of PDLSCs were performed as previously reported [Wei et al., 2012, 2013]. Briefly, the periodontal ligament was gently separated from the middle third root surface of the first premolars from volunteers in the Department of Oral Maxillofacial Surgery, School of Stomatology, Shandong University, and then digested in a solution of 3 mg/ml collagenase type I (SigmaAldrich Corp., St. Louis, Mo., USA) and 4 mg/ml dispase II (SigmaAldrich) for 1 h at 37 ° C. Single-cell suspensions were obtained by passing the cells through a 70-μm strainer (Falcon; BD Labware, Franklin Lakes, N.J., USA). Cells were seeded into 25-cm2 culture flasks (Costar Inc., Cambridge, Mass., USA) with α-modification of Eagle’s medium (Gibco, Invitrogen Corp., Carlsbad, Calif., USA) supplemented with 15% fetal calf serum (Gibco, Invitrogen), 2 mM glutamine, 100 U/ml penicillin and 100 μg/ml streptomycin (Invitrogen), and then incubated at 37 ° C in 5% CO2. The second or third passage of PDLSCs was used in the following experiments.
Application of Mechanical Force External mechanical stimulation was achieved with a Flexcell® FX-5000TM tension system (Flexcell International Corp., Hillsborough, N.C., USA). Flexcell amino silicone-bottom plates were coated with a 0.6 mg/ml collagen I solution (Sigma Aldrich). PDLSCs were seeded onto these plates at a density of approximately 2.5 × 105 cells/cm2. After the cultures had reached approximately 80% confluence, the cells were serum deprived for 24 h. Then, PDLSCs were stretched in a Flexcell FX-5000 tension system. Physiological bone remodeling occurred during orthodontic tooth movement. Thus, the loading regime in vitro was chosen to be within the physiological range. According to previous studies [Hamilton et al., 2004; Gilbert et al., 2010], we imposed 10% equibiaxial strain at 1.0 Hz for 12 h. Control PDLSCs were cultured without stretching. Alkaline Phosphatase Activity Assay After exposure to stretch, PDLSCs were stained to determine alkaline phosphatase (ALP) activity. Cells were fixed with 4% paraformaldehyde and stained with a solution of 0.25% naphthol AS-BI phosphate and 0.75% fast red violet in an ALP kit, according to the manufacturer’s protocol (Sigma-Aldrich). ALP activity was measured with an ALP activity kit according to the manufacturer’s protocol (Sigma-Aldrich). Activity was normalized to the protein concentration in the sample.
Wei /Wang /Ding /Yang /Li /Hu /Wang
Downloaded by: Rutgers University Alexander Library 128.6.218.72 - 4/8/2015 12:59:39 PM
Abbreviations used in this paper
ParafloTM miRNA Microarray Assay Microarray analyses were performed on a cell mixture pooled from 3 volunteers which were not subjected to stretch and on a cell mixture from another 3 volunteers subjected to mechanical stretch; experiments were reproduced twice. TRIzol reagent (Invitrogen) was used to isolate RNAs from cultured cells (normal PDLSCs and PDLSCs stretched for 12 h) according to the manufacturer’s instructions. Microarray assays were performed by an outsourced service provider (LC Sciences). Data were analyzed by first subtracting the background and then normalizing the signals with a LOWESS filter (locally weighted regression) [Bolstad et al., 2003]. For two-color experiments, the ratio of the two sets of signals detected (log2 transformed, balanced) and p values of the t test were calculated. Hierarchical clustering analysis was performed to identify differences between signals, and differentially detected signals were defined as those with p < 0.01.
www.genome.jp/kegg/) annotations of miRNA targets and DAVID (the Database for Annotation, Visualization and Integrated Discovery; http://david.abcc.ncifcrf.gov/) were used as the gene annotation tool. We chose only GO terms with p < 0.01 and a false detection rate ≤5%, and pathways with p < 0.05 and a false detection rate ≤5%, based on Fisher’s exact test. Statistics Analysis All statistical calculations were performed with SAS 9.2 statistical software. Values are means ± SD. Student’s t test was performed for normally distributed data to determine statistically significant differences. The Wilcoxon two-sample test was performed for nonnormally distributed data. A value of p ≤ 0.05 was considered significant.
Results
Stretching of PDLSCs Induced Morphological Changes and Osteogenic Differentiation The stretched PDLSCs displayed a markedly altered morphology (fig. 1). Specifically normal PDLSCs spread out and exhibited a random cellular orientation (fig. 1a). Stretched PDLSCs were elongated, and they had aligned in parallel to the direction of the strain (fig. 1b). PDLSCs that were stretched for 12 h exhibited increased ALP activity, an early marker for osteogenic differentiation, compared to that in normal cells (fig. 1c–e). PCR results showed that stretching of PDLSCs resulted in increases in osteogenic genes RUNX2, OCN and BSP (fig. 1f–h). Protein expression of RUNX2, OCN and BSP also confirmed that changes in the mRNAs for these genes (fig. 1i).
Network Analysis Unique profiles were defined and significant profiles selected with the following criteria: strong signal intensities (signal >1,000), log2 (stretched PDLSCs/normal PDLSCs) >1 and p < 0.01. For miRNAs expressed in significant amounts, we used TargetScan (http://www.targetscan.org/) to predict miRNA target genes. Gene ontology (GO) terms (http://www.geneontology.org/), the Kyoto Encyclopedia of Gene and Genome (KEGG) pathway (http://
miRNA Microarray Analysis RNA gel electrophoresis confirmed that good quality RNA was obtained from both normal and stretched PDLSCs. With miRNA microarray technology, we detected miRNA expression of normal PDLSCs and stretched PDLSCs (fig. 2a–c). We found that 841 miRNAs were expressed in normal PDLSCs, and 748 miRNAs were expressed in stretched PDLSCs (data not shown). Hierarchical clustering analysis was performed to identify differences in miRNA expression between normal and stretched PDLSCs (fig. 2d). Analysis of the microarray data showed that 53 miRNAs were differentially expressed (p < 0.01; table 2). Of these, 26 were upregulated and 27 were downregulated in stretched PDLSCs compared to normal controls. To validate the microarray results, we selected 10 representative miRNAs, including miR-1246, miR-5096, miR-638, miR-663, miR-21, miR-4492, miR-4734, miR3195, miR-4281 and miR-3178, and performed qRT-PCR
Specific MicroRNA Expression in PDLSCs
Cells Tissues Organs DOI: 10.1159/000369613
Real-Time Reverse Transcription Polymerase Chain Reaction A strong signal intensity (signal >1,000), a log2 (stretched PDLSCs/normal PDLSCs) >1 and p < 0.01 were used to select miRNAs for real-time reverse transcription polymerase chain reaction (RT-PCR) validation. miRNAs were isolated from PDLSCs maintained in culture for 3 days that were either normal or stretched (12 h). miRNA and gene primers were both designed with DNAStar version 6.1.3 software (table 1). Samples and primers were mixed in platinum SYBR Green qPCR SuperMix-UDG (Invitrogen: 11733-038). Real-time PCR was carried out for 45 cycles (95 ° C for 10 s, 60 ° C for 30 s) after an initial denaturation step (95 ° C for 10 s).
3
Downloaded by: Rutgers University Alexander Library 128.6.218.72 - 4/8/2015 12:59:39 PM
Western Blot Cells were harvested in RIPA lysis buffer (10 mM Tris, 5 mM EDTA, 0.25% Triton X-100, 300 mM NaCI, PMSF, 1× proteinase inhibitor) as soon as specific experiments were done. The protein concentration was measured using a BCA protein assay reagent kit. Equal aliquots of protein samples were separated by SDSPAGE using 10-20% Tris-glycine gels and then electrotransferred onto polyvinylidene fluoride membranes (Amersham Biosciences, Piscataway, N.J., USA). Membranes were blocked with 5% lipidfree milk in TBST (Tris-buffered saline with 0.1% Tween) for 1 h at room temperature, followed by incubation with primary antibodies at 4 ° C overnight. The membrane was washed with TBST for 10 min 3 times and exposed to HRP-conjugated goat antimouse secondary antibody for 2 h at room temperature. Immunoreactivity was detected using the ECL chemiluminescence reaction (Amersham Pharmacia Biotech Co., Ltd., UK). Loading differences were normalized by assessing the housekeeping protein in each sample. The primary antibodies used were as follows: mouse antiRunx2 (1:1,000; Abcam plc., Cambridge, UK), mouse anti-osteocalcin (1: 500; Invitrogen), mouse anti-bone sialoprotein (BSP; 1:500; Abcam) and rabbit anti-β-actin (1:2,000; Abcam).
Gene/miRNA name
Primer (5′ to 3′)
Primer sequence
RUNX2
forward reverse forward reverse forward reverse forward reverse sequence RT forward reverse sequence RT forward reverse sequence RT forward reverse sequence RT forward reverse sequence RT forward reverse sequence RT forward reverse sequence RT forward reverse sequence RT forward reverse sequence RT forward reverse sequence RT forward reverse sequence RT forward reverse
CGAATGGCAGCACGCTATTAA GTCGCCAAACAGATTCATCCA TAGTGAAGAGACCCAGGCGCT ATAGGCCTCCTGAAAGCCGA GTCACTGGAGCCAATGCAGAA CCCACCATTTGGAGAGGTTGT TCATGGGTGTGAACCATGAGAA GGCATGGACTGTGGTCATGAG AAUGGAUUUUUGGAGCAGG GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCTGCT GGCGGAATGGATTTTTGG CAGTGCAGGGTCCGAGGTAT GUUUCACCAUGUUGGUCAGGC GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGCCTGA CGGCGTTTCACCATGTTG CAGTGCAGGGTCCGAGGTAT AGGGAUCGCGGGCGGGUGGCGGCCU GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGGCCG GTTATTAGGGATCGCGGGC CAGTGCAGGGTCCGAGGTAT AGGCGGGGCGCCGCGGGACCGC GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGCGGTC AGGATTAGGCGGGGCG CAGTGCAGGGTCCGAGGTAT UAGCUUAUCAGACUGAUGUUGA GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCAACA GCCGCGTAGCTTATCAGACT CAGTGCAGGGTCCGAGGTATT GGGGCUGGGCGCGCGCC GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGCGCG ATTATTGGGGCTGGGCG CAGTGCAGGGTCCGAGGT GCUGCGGGCUGCGGUCAGGGCG GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCGCCCT ATTATGCTGCGGGCTGCG CAGTGCAGGGTCCGAGGT CGCGCCGGGCCCGGGUU GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACCCG ATTATTCGCGCCGGGC CGCAGGGTCCGAGGTATTC GGGUCCCGGGGAGGGGGG GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCCCCC TTAATAGGGTCCCGGGGAGG CAGTGCAGGGTCCGAGGT GGGGCGCGGCCGGAUCG GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCGATCC ATTATTGGGGCGCGGC GGCAGGGTCCGAGGTATTC AUUUGCUAUCUGAGAGAUGGUGAUGACAUUUUAAACCACCAAGAUCGCUGAUGCA CGCAGGGTCCGAGGTATTC GCCGCCATTTGCTATCTGAG CGCAGGGTCCGAGGTATTC
OCN BSP GAPDH hsa-miR-1246
hsa-miR-5096
hsa-miR-638
hsa-miR-663
hsa-miR-21
hsa-miR-4492
hsa-miR-4734
hsa-miR-3195
hsa-miR-4281
hsa-miR-3178
RNU24
4
Cells Tissues Organs DOI: 10.1159/000369613
Wei /Wang /Ding /Yang /Li /Hu /Wang
Downloaded by: Rutgers University Alexander Library 128.6.218.72 - 4/8/2015 12:59:39 PM
Table 1. Gene/miRNA primers
a
b
c
d
2.5
*
0.8 0.6 0.4 0.2 0
0h
1.5 1.0 0.5 0
f
12 h
3
*
Specific MicroRNA Expression in PDLSCs
g
3
2
BSP/GAPDH
OCN/GAPDH
phological changes and osteogenic differentiation. a, b PDLSCs in the control group are randomly organized, but PDLSCs in the stretched group are aligned in parallel to the direction of strain, providing organized morphology. Stretching of PDLSCs resulted in enhanced ALP activity (c–e) and increases in osteogenic genes RUNX2, OCN and BSP (f–h). * p < 0.05. Values are means ± SD for triplicate samples from a representative experiment. i Western blot results showed protein expression of RUNX2, OCN and BSP. a, b Scale bars = 200 μm.
1
0
0h
h
12 h
2 1 0
0h
RUNX2
OCN
BSP
DŽ$FWLQ
DŽ$FWLQ
DŽ$FWLQ
i
0h
12 h
4
* Fig. 1. Stretching of PDLSCs induced mor-
0h
12 h
0h
Cells Tissues Organs DOI: 10.1159/000369613
12 h
12 h
0h
12 h
5
Downloaded by: Rutgers University Alexander Library 128.6.218.72 - 4/8/2015 12:59:39 PM
e
*
2.0 RUNX2/GAPDH
Sigma unit/min/mg protein
1.0
b
a
c
d
Cells Tissues Organs DOI: 10.1159/000369613
&RQWURO3'/6&V 6WUHWFKHG3'/6&V
15
10
5
78
m
iR -
31
81 42
95
iR m
m
iR -
31
34 47 iR -
m
iR -
44
92
21 m
iR m
63 -6 iR
m
iR
-6
38
96 m
50 iR m
m
e
iR -
12
46
0
Wei /Wang /Ding /Yang /Li /Hu /Wang
Downloaded by: Rutgers University Alexander Library 128.6.218.72 - 4/8/2015 12:59:39 PM
6
20
Expression level (2 – ©&T)
Fig. 2. Microarray hybridization signals and miRNA expression profiles analyzed with hierarchical clustering of normal and stretched PDLSCs. a–c Microarrays show miRNA expression profiles of normal PDLSCs (a), stretched PDLSCs (b) and normal and stretched PDLSC signals overlaid (c). Red: p < 0.01, green: p > 0.01. d miRNA expression was analyzed with hierarchical clustering, and 53 differential profiles were found between normal and stretched PDLSCs. Red indicates a gene that was highly expressed at that stage. Green indicates a gene that was rarely expressed at that stage. e qRT-PCR was used to determine miRNA expression (miR1246, miR-5096, miR-638, miR-663, miR21, miR-4492, miR-4734, miR-3195, miR4281 and miR-3178). qRT-PCR analysis validated the microarray analysis. RNU24 was used for normalization. Values are means ± SD for triplicate samples from a representative experiment.
Table 2. Differentially expressed miRNAs between control PDLSCs and stretched PDLSCs
Upregulated hsa-miR-1246 hsa-miR-1290 hsa-miR-4685-5p hsa-miR-4487 hsa-miR-4655-5p hsa-miR-764 hsa-miR-4317 hsa-miR-654-5p hsa-miR-5096 hsa-miR-638 hsa-miR-4732-5p hsa-miR-4419b hsa-miR-1587 hsa-miR-663 hsa-miR-21 hsa-miR-4507 hsa-miR-4492 hsa-miR-1268b hsa-miR-4734 hsa-miR-4484 hsa-miR-4505 hsa-miR-1268 hsa-miR-4508 hsa-miR-24 hsa-miR-1915 hsa-miR-3665
PDLSC signal 47.56 1.00 28.84 25.33 11.71 11.61 12.62 35.79 308.69 5,547.10 73.55 49.98 130.15 636.19 932.72 212.21 532.76 279.12 853.85 1,202.05 558.32 308.39 2,219.59 3,428.03 1,623.71 23,170.05
Stretched PDLSC signal
log2
miRNAs
13,908.49 256.06 314.49 370.21 185.79 122.00 122.15 216.48 1,781.10 23,466.84 253.71 172.03 395.09 1,630.78 2,302.91 527.61 1,255.42 622.29 1,893.44 2,326.41 1,070.01 529.21 3,515.04 4,861.48 2,240.67 25,518.25
8.35 7.99 5.35 4.21 3.99 3.39 3.27 2.59 2.53 2.08 1.79 1.78 1.60 1.35 1.33 1.31 1.22 1.16 1.15 0.95 0.94 0.78 0.67 0.50 0.46 0.14
Downregulated hsa-miR-107 hsa-miR-423-5p hsa-miR-103a hsa-miR-3195 hsa-miR-4281 hsa-miR-3178 hsa-miR-16 hsa-miR-145 hsa-miR-762 hsa-miR-455-3p hsa-miR-127-3p hsa-miR-214 hsa-miR-4668-5p hsa-miR-222 hsa-miR-23b hsa-miR-181a hsa-miR-4739 hsa-miR-3940-5p hsa-miR-4488 hsa-miR-3141 hsa-miR-100 hsa-miR-125b hsa-miR-221 hsa-miR-26a hsa-miR-3656 hsa-miR-4497 hsa-miR-4516
analyses in triplicate samples. The expression levels of all the selected miRNAs were consistent with the normalized microarray data (fig. 2e). PCR results were consistent with the normalized microarray data. Prediction of miRNA Targets and Networks In hierarchical clustering analysis, 10 differentiationrelated miRNAs (hsa-miR-1246, hsa-miR-5096, hsamiR-638, hsa-miR-663, hsa-miR-21, hsa-miR-4492, hsamiR-4734, hsa-miR-3195, hsa-miR-4281 and hsamiR-3178) changed more significantly than the others. We selected these 10 miRNAs based on a strong signal intensity (signal >1,000), a log2 (stretched PDLSCs/normal PDLSCs) >1 and p < 0.01. Fisher’s exact test was performed to detect the possible target genes and functions of these 10 miRNAs. We identified 8,117 predicted miRNA-mRNA interactions (online suppl. material 1; see www.karger.com/doi/10.1159/000369613 for all online Specific MicroRNA Expression in PDLSCs
PDLSC signal 621.53 542.38 762.54 1,292.70 4,331.44 1,286.74 558.45 949.19 1,000.43 878.65 497.82 2,907.58 4,131.64 14,986.62 10,141.94 1,108.79 1,885.92 1,841.13 5,761.42 2,636.18 2,943.43 7,658.42 7,195.55 2,192.10 5,336.41 6,879.27 7,742.27
Stretched PDLSC signal 271.90 245.20 350.67 612.61 2,067.15 632.49 281.83 530.10 558.61 514.56 302.84 1,839.19 2,659.67 9,816.27 7,031.43 776.41 1,354.36 1,342.27 4,270.08 1,977.67 2,260.79 5,988.67 5,725.58 1,756.43 4,458.57 5,922.25 6,736.02
log2
–1.19 –1.15 –1.12 –1.08 –1.08 –1.02 –0.99 –0.85 –0.84 –0.77 –0.72 –0.66 –0.64 –0.61 –0.53 –0.51 –0.48 –0.46 –0.43 –0.41 –0.38 –0.36 –0.33 –0.32 –0.26 –0.22 –0.20
suppl. material). All targets were then processed by target gene function (GO) and KEGG pathway annotation analyses. Based on the GO and the KEGG pathway-significance analyses, we identified the most significant GO/ KEGG target genes (online suppl. material 2–5). The GO project provided the ontology of defined terms, which represented the gene product properties (fig. 3). We created a diagram of an miRNA gene regulatory network (fig. 4) that quantitatively separated the core regulatory functions of miRNAs and their target genes.
Discussion
In the present study, we demonstrated that PDLSCs exposed to stretch showed increased osteogenic differentiation, and 53 miRNAs were expressed significantly differently in stretched PDLSCs compared with normal Cells Tissues Organs DOI: 10.1159/000369613
7
Downloaded by: Rutgers University Alexander Library 128.6.218.72 - 4/8/2015 12:59:39 PM
miRNAs
S gene number
Se q
ue
nc eRe spe g Po ul cific at sit io DN iv n e of A b re gu in t P la la ran din tio sm sc ri g n a of Se Reg m pt tra qu ul Zin em ion ns en atio c io br a cr ce ip -s n o n b ne tio pe f A in d c n R fro ific F G ing m DN TP a Ex RN A b se te rn A p ind al ol in si ym g A er H RF de om G as o op TPa f pl e se asm N h ili eg N a c er at ce ctiv a vo iv ll a e us ad tor re sy gu st Cel hes la em l a io tio H ist de dhe n n of on ve sio tra lo e pm n de ns I n ac cr t et rac ent ip yl tio a el Sm n f Me se lula al rom tal bin r lG io d TP RN n b ing as A i e- po ndi n m l Re ed ym g sp ia era on ted se se sig t De o h nal y nd po rit xi Re ic a gu la Vas spi tio o n n dila e Re of gu tio ne la n tio ur on n C of og al tra ni Go nsc tion lg rip ia t pp ion ar at us
1,300 1,200 1,100 1,000 900 800 700 600 500 400 300 200 100 0
GO term
Fig. 3. miRNA target gene function. Based on GO analyses, these targets genes had a wide range of diverse func-
tions, including molecular function, biological processes and cellular components, etc.
8
Cells Tissues Organs DOI: 10.1159/000369613
al., 2010]. Mechanical stretch upregulated the expression of miR-26a, which attenuates the endogenous glycogen synthase kinase-3β protein levels followed by the induction of human airway smooth muscle cell hypertrophy [Mohamed et al., 2010]. In accordance with the above studies, our microarray analyses demonstrated that strain modulated the expression of 53 miRNAs in PDLSCs: 26 miRNAs were upregulated and 27 downregulated. Next, we identified 10 differentiation-related miRNAs (miR-1246, miR-5096, miR-638, miR-663, miR-21, miR4492, miR-4734, miR-3195, miR-4281 and miR-3178). It has been found that shear stress could modulate miR-21 expression; this change in miR-21 then modulated EC apoptosis and EC nitric oxide synthase activity [Weber et al., 2010]. It was also reported that oscillatory shear stress could induce sustained miR-21 expression in ECs, which was implicated in flow-mediated, endothelial inflammation [Zhou et al., 2011]. Cyclic stretch was also shown to modulate miR-21 expression. That study suggested that increased miR-21 expression may be involved in the regWei /Wang /Ding /Yang /Li /Hu /Wang
Downloaded by: Rutgers University Alexander Library 128.6.218.72 - 4/8/2015 12:59:39 PM
PDLSCs. Mechanical stretch regulated miRNA expression in PDLSCs, and these miRNAs were involved in osteogenic differentiation of PDLSCs. This result provides a potential explanation for the previous observation that miRNAs are involved in mechanical-force-induced variations in cellular functions in vitro. There are different miRNAs expressing under mechanical environment. miRNAs were differentially expressed between cyclically stretched and nonstretched rat alveolar epithelial cells, including 34 upregulated and 8 downregulated miRNAs [Yehya et al., 2012]. It was also reported that mechanical loading modulated the expression of multiple miRNAs that regulate cell proliferation and extracellular matrix synthesis in tendon fibroblasts, which indicated that miRNA could play an important role in the adaptation of tendons to growth stimuli [Mendias et al., 2012]. Laminar shear stress modulates miRNAs expression in endothelial cells (ECs) and miR19a plays an important role in the flow regulation of cyclin D1 expression and endothelial proliferation [Qin et
a
Fig. 4. miRNA-gene network. The constructed subnetwork of miRNAs and their potential target genes show enrichment of genes involved in MAPK (a) and Wnt (b) signaling pathways. A number of miRNA potential target genes were affected by stretch-
ing based on both GO and KEGG pathway analyses. Red: potential target genes of ten key miRNAs in MAPK and Wnt signaling pathways.
Specific MicroRNA Expression in PDLSCs
Cells Tissues Organs DOI: 10.1159/000369613
9
Downloaded by: Rutgers University Alexander Library 128.6.218.72 - 4/8/2015 12:59:39 PM
b
10
Cells Tissues Organs DOI: 10.1159/000369613
overexpressed in stretched PDLSCs were involved in several signaling pathways associated with osteogenic differentiation, like MAPK and Wnt. We built a pathway interaction network that included the MAPK and Wnt pathways. We used this network to uncover useful clues regarding how miRNAs influenced the cellular and molecular responses of PDLSCs to mechanical force. In summary, stretched PDLSCs displayed an miRNA expression profile different from that observed in normal PDLSCs: 26 miRNAs were upregulated and 27 downregulated. We constructed an interaction network of key miRNAs and their target genes (which were related to mechanical force) to postulate the functional roles of miRNAs in PDLSCs. This integrated analysis provided important information that may inspire further experimental investigation into the behavior of miRNAs and their targets in response to mechanical force. Acknowledgments This work was supported by the Chinese, Shandong and Beijing Governments (National Natural Science Foundation of China Nos. 81200758, 81470709 and 81371109, Independent Innovation Foundation of Shandong University No. 2011GN038, Jinan Scientific Researcher Start-Up Program of University No. 201102066, Science and Technology Development Plan of Shandong Province No. 2010GSF10267) and Beijing Municipality Government grants (Beijing Scholar Program-PXM 2013_014226_000055, PXM2014_014226_000048, PXM2014_ 014226_000013, PXM2014_014226_000053, Z121100005212004, PXM 2013_014226_000021, PXM 2013_014226_07_000080 and TJSHG201310025005).
Disclosure Statement The authors declare that they have no potential conflicts of interest with respect to the authorship and/or publication of this article.
References
Bartel, D.P. (2004) MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116: 281–297. Bolstad, B.M., R.A. Irizarry, M. Astrandand, T.P. Speed (2003) A comparison of normalization methods for high density oligonucleotide array data based on variance and bias. Bioinformatics 19: 185–193. Fujihara, C., S. Yamada, N. Ozaki, N. Takeshita, H. Kawaki, T. Takano-Yamamoto, S. Murakami (2010) Role of mechanical stress-induced glutamate signaling-associated molecules in cytodifferentiation of periodontal ligament cells. J Biol Chem 285: 28286–28297.
Wei /Wang /Ding /Yang /Li /Hu /Wang
Downloaded by: Rutgers University Alexander Library 128.6.218.72 - 4/8/2015 12:59:39 PM
ulation of human aortic smooth muscle cell proliferation and apoptosis mediated by stretch [Song et al., 2012]. Oscillatory shear stress also increased miR-663 expression, which plays a role in the inflammatory response of ECs [Ni et al., 2011]. Therefore, miR-21 and miR-663 are thought to play important roles in mechanical-force-induced variations in cellular functions. Among the miRNAs reported to be upregulated in stretched PDLSCs in our study, miR-1246 was the most highly expressed miRNA. miR-1246 was a novel target of p53 to suppress the expression of DYRK1A and consequently activate NFAT [Liao et al., 2012]. miR-1246 was significantly underexpressed >2-fold in diseased versus healthy gingival tissue, which suggested that miR-1246 played an important role in periodontal tissue homeostasis [Stoecklin-Wasmer et al., 2012]. In our dataset, miR638 expression was higher in stretched PDLSCs. miR-638 has been reported to be downregulated in human basal cell carcinomas [Sand et al., 2012], chronic lymphocytic leukemias [Zhu et al., 2012] and colorectal carcinoma tissue compared with adjacent tissues [Ma et al., 2014]. SOX2 is a Yamanaka factor that can induce pluripotent stem cells from mouse embryonic and adult fibroblast cultures [Takahashi and Yamanaka, 2006]. SOX2 was identified as the functional target gene of miR-638 in colorectal cancer [Ma et al., 2014]. SOX2 overexpression promotes dedifferentiation and induces epithelial-to-mesenchymal transition [Herreros-Villanueva et al., 2013]. These results imply that miR-638 plays certain roles in differentiation by targeting SOX2. miR-5096 was downregulated in the SGC-7901/5-Fu cell line compared with its parental cell line [Wang et al., 2013]. There are few data about miR4492, miR-4734, miR-3195, miR-4281 and miR-3178. miRNAs regulate gene expression at the posttranscriptional level by degrading their target mRNAs or by translational repression [Bartel et al., 2004]. Based on our GO data, a number of miRNA target genes were under- or overexpressed in stretched PDLSCs. The GO enrichment analysis of functional significance demonstrated that these targets had a wide range of diverse functions, including molecular function, biological processes and cellular components, etc. miRNAs also activate multiple signaling pathways. The mitogen-activated protein kinase (MAPK) signaling pathway plays an important role in the osteogenic differentiation of mesenchymal stem cells in response to mechanical strain [Yan et al., 2012]. The Wnt signaling pathway is required for the osteogenic response to mechanical loading [Tu et al., 2012]. Based on the KEGG data, the putative target genes of miRNAs that were under- or
Specific MicroRNA Expression in PDLSCs
Ma, K., X. Pan, P. Fan, Y. He, J. Gu, W. Wang, T. Zhang, Z. Li , X. Luo (2014) Loss of miR-638 in vitro promotes cell invasion and a mesenchymal-like transition by influencing SOX2 expression in colorectal carcinoma cells. Mol Cancer 13: 118. Matsuda, N., N. Morita, K. Matsuda, M. Watanabe (1998) Proliferation and differentiation of human osteoblast cells associated with differential activation of MAP kinases in response to epidermal growth factor, hypoxia, and mechanical stress in vitro. Biochem Biophys Res Commun 249: 350–354. Mattick, J.S. (2001) Non-coding RNAs: the architects of eukaryotic complexity. EMBO Rep 2: 986–991. Mendias, C.L., J.P. Gumucio, E.B. Lynch (2012) Mechanical loading and TGF-β change the expression of multiple miRNAs in tendon fibroblasts. J Appl Physiol (1985) 113: 56– 62. Mohamed, J.S., M.A. Lopez, A.M. Boriek (2010) Mechanical stretch up-regulates microRNA26a and induces human airway smooth muscle hypertrophy by suppressing glycogen synthase kinase-3b. J Biol Chem 285: 29336– 29347. Ni, C.W., H. Qiu, H. Jo (2011) MicroRNA-663 upregulated by oscillatory shear stress plays a role in inflammatory response of endothelial cells. Am J Physiol Heart Circ Physiol 300: H1762–H1769. Qin, X., X. Wang, Y. Wang, Z. Tang, Q. Cui, J. Xi, Y.S. Li, S. Chien, N. Wang (2010) MicroRNA19a mediates the suppressive effect of laminar flow on cyclin D1 expression in human umbilical vein endothelial cells. Proc Natl Acad Sci USA 107: 3240–3244. Sand, M., M. Skrygan, D. Sand, D. Georgas, S.A. Hahn, T. Gambichler, P. Altmeyer, F.G. Bechara (2012) Expression of microRNAs in basal cell carcinoma. Br J Dermatol 167: 847– 855. Song, J.T., B. Hu, H.Y. Qu, C.L. Bi, X.Z. Huang, M. Zhang (2012) Mechanical stretch modulates microRNA 21 expression, participating in proliferation and apoptosis in cultured human aortic smooth muscle cells. PLoS One 7: e47657. Stoecklin-Wasmer, C., P. Guarnieri, R. Celenti, R.T. Demmer, M. Kebschull, P.N. Papapanou (2012) MicroRNAs and their target genes in gingival tissues. J Dent Res 91: 934– 940.
Cells Tissues Organs DOI: 10.1159/000369613
Takahashi, K, S. Yamanaka (2006) Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126: 663–676. Tu, X., Y. Rhee, K.W. Condon, N. Bivi, M.R. Allen, D. Dwyer, M. Stolina, C.H. Turner, A.G. Robling, L.I. Plotkin, T. Bellido (2012) Sost downregulation and local Wnt signaling are required for the osteogenic response to mechanical loading. Bone 50: 209–217. Wang, Y., X. Gu, Z. Li, J. Xiang, J. Jiang, Z. Chen (2013) microRNA expression profiling in multidrug resistance of the 5-Fu-induced SGC-7901 human gastric cancer cell line. Mol Med Rep 7: 1506–1510. Weber, M., M.B. Baker, J.P. Moore, C.D. Searles (2010) MiR-21 is induced in endothelial cells by shear stress and modulates apoptosis and eNOS activity. Biochem Biophys Res Commun 393: 643–648. Wei, F., C. Qu, T. Song, G. Ding, Z. Fan, D. Liu, Y. Liu, C. Zhang, S. Shi, S. Wang (2012) Vitamin C treatment promotes mesenchymal stem cell sheet formation and tissue regeneration by elevating telomerase activity. J Cell Physiol 227: 3216–3224. Wei, F., T. Song, G. Ding, J. Xu, Y. Liu, D. Liu, Z. Fan, C. Zhang, S. Shi, S. Wang (2013) Functional tooth restoration by allogeneic mesenchymal stem cell-based bio-root regeneration in swine. Stem Cells Dev 22: 1752–1762. Yan, Y.X., Y.W. Gong, Y. Guo, Q. Lv, C. Guo, Y. Zhuang, Y. Zhang, R. Li, X.Z. Zhang (2012) Mechanical strain regulates osteoblast proliferation through integrin-mediated ERK activation. PLoS One 7: e35709. Yehya, N., A. Yerrapureddy, J. Tobias, S.S. Margulies (2012) MicroRNA modulate alveolar epithelial response to cyclic stretch. BMC Genomics 13: 154. Zhou, J., K.C. Wang, W. Wu, S. Subramaniam, J.Y. Shyy, J.J. Chiu, J.Y. Li, S. Chien (2011) MicroRNA-21 targets peroxisome proliferatorsactivated receptor-alpha in an autoregulatory loop to modulate flow-induced endothelial inflammation. Proc Natl Acad Sci USA 108: 10355–10360. Zhu, D.X., W. Zhu, C. Fang, L. Fan, Z.J. Zou, Y.H. Wang, P. Liu, M. Hong, K.R. Miao, P. Liu, W. Xu, J.Y. Li (2012) miR-181a/b significantly enhances drug sensitivity in chronic lymphocytic leukemia cells via targeting multiple anti-apoptosis genes. Carcinogenesis 33: 1294– 1301.
11
Downloaded by: Rutgers University Alexander Library 128.6.218.72 - 4/8/2015 12:59:39 PM
Gay, I., A. Cavender, D. Peto, Z. Sun, A. Speer, H. Cao, B.A. Amendt (2014) Differentiation of human dental stem cells reveals a role for microRNA-218. J Periodontal Res 49: 110–120. Gilbert, H.T., J.A. Hoyland, S.J. Millward-Sadler (2010) The response of human anulus fibrosus cells to cyclic tensile strain is frequencydependent and altered with disc degeneration. Arthritis Rheum 62: 3385–3394. Hamilton, D.W., T.M. Maul, D.A. Vorp (2004) Characterization of the response of bone marrow-derived progenitor cells to cyclic strain: implications for vascular tissue-engineering applications. Tissue Eng 10: 361–369. Herreros-Villanueva, M., J.S. Zhang, A. Koenig, E.V. Abel, T.C. Smyrk, W.R. Bamlet, A.A. de Narvajas, T.S. Gomez, D.M. Simeone, L. Bujanda, D.D. Billadeau (2013) SOX2 promotes dedifferentiation and imparts stem cell-like features to pancreatic cancer cells. Oncogenesis 2: e61. Hobert, O. (2008) Gene regulation by transcription factors and microRNAs. Science 319: 1785–1786. Hong, S.Y., Y.M. Jeon, H.J. Lee, J.G. Kim, J.A. Baek, J.C. Lee (2010) Activation of RhoA and FAK induces ERK-mediated osteopontin expression in mechanical force-subjected periodontal ligament fibroblasts. Mol Cell Biochem 335: 263–272. Hung, P.S., F.C. Chen, S.H. Kuang, S.Y. Kao, S.C. Lin, K.W. Chang (2010) miR-146a induces differentiation of periodontal ligament cells. J Dent Res 89: 252–257. Kawarizadeh, A., C. Bourauel, W. Götz, A. Jäger (2005) Early responses of periodontal ligament cells to mechanical stimulus in vivo. J Dent Res 84: 902–906. Kloosterman, W.P., R.H. Plasterk (2006) The diverse functions of microRNAs in animal development and disease. Dev Cell 11: 441–450. Komori, T. (2006) Regulation of osteoblast differentiation by transcription factors. J Cell Biochem 99: 1233–1239. Li, L., M.X. Han, S. Li, Y. Xu, L. Wang (2014) Hypoxia regulates the proliferation and osteogenic differentiation of human periodontal ligament cells under cyclic tensile stress via MAPK pathways. J Periodontol 85: 498– 508. Liao, J.M., X. Zhou, Y. Zhang, H. Lu (2012) MiR1246: a new link of the p53 family with cancer and Down syndrome. Cell Cycle 11: 2624– 2630.
