ARCHIVES

Vol.

OF BIOCHEMISTRY

294, No. 2, May

AND

BIOPHYSICS

1, pp. 373-381,1992

Mapping of Antigenic Sites to Monoclonal Antibodies on the Primary Structure of the F,-ATPase ,6 Subunit from Escherichia co/i; Concealed Amino-Terminal Region of the Subunit in the F, Junji Miki, Masamitsu

Takeshi Futai,?

Matsuda, Hiromi Kariya, and Hiroshi Kanazawal

Hitoshi

Ohmori,

Tomofusa

Tsuchiya,*

Department of Biotechnology, Faculty of Engineering Sciences, and *Department of Microbiology, Faculty of Pharmaceutical Sciences, Okayama University, Okayama, Japan; and TDepartment of Organic Chemistry and Biochemistry, The Institute of Scientific and Industrial Research, Osaka Uniuersity, Osaka, Japan

Received

September

24, 1991, and in revised

form

December

12, 1991

To analyze relationships between the ternary and primary structures of the /3 subunit of Escherichia cofi F1 ATPase, we prepared two monoclonal antibodies /912 and 831 against the /3 peptide. These antibodies bind to the /3 subunit but do not bind to the F1 ATPase, resulting in no inhibition of the ATPase activities. Several different portions of the fi subunit peptide were prepared by constructing expression plasmids carrying the corresponding DNA segment of the @ subunit gene amplified by the polymerase chain reaction. Western blotting analysis using these peptides revealed that the antibodies bound to a peptide of 104 amino acid residues from the amino terminal end, which is outside the previously estimated catalytic domain between residues 140 and 350. These results indicated that the amino terminal portion of the maximal 104 residues is not exposed to the surface of the F1 ATPase. The binding spectrum of the antibodies to the subunit from various species including Vibrio alginolyticus and thermophilic bacterium PS3 indicated possible epitope sequences within the 104 residues. The ternary structure of the @ subunit, in terms of cleavage sites by endopeptidases, was analyzed using the antibodies. A 43-kDa peptide without binding ability to /312 and 831 appeared upon cleavage by lysyl endopeptidase. The results suggested that lysyl residues from around 70 to 100 from the amino terminus are exposed to the surface Of the fi subunit. 0 is92 Academic PRSRI, hc.

i To whom

correspondence

should

0003~9S61/92 $3.00 Copyright 0 1992 by Academic Press, AII rights of reproduction in any form

be addressed.

Proton translocating ATPase (F1F0)2 catalyzes the synthesis of ATP from ADP and inorganic phosphate utilizing an electrochemical gradient of protons (for review, see Refs. (l-4)). The enzyme is composed of eight different subunits in Escherichia coli; F1 is the membrane peripheral portion consisting of five nonidentical subunits, (Y, & y, 6, and t, and forms the catalytic center of the enzyme. Three copies of the CYand /3 subunits, which are contained in the catalytic complex, occupy alternating positions within it (5). F0 is the membrane integral portion consisting of three nonidentical subunits, a, b, and c, and which forms a proton channel. The reconstituted &y complex from the isolated subunits in the ratio 3:3:1 is a minimal complex with ATPase activity (6,7). Recent reports have suggestedthat cy& or (Y& is the minimal active combination for TF1 (8) and CF1 (9). Among the subunits, the p subunit plays an essential role in forming the catalytic center (l-4) and its primary structure is highly conserved throughout various species, including humans and bacteria (l-3, 10). The extensive analysis of point mutations and chemical modifications causing functional defects in the fi subunit revealed functionally essential and important residues

’ Abbreviations used: BSA, bovine serum albumin; DAB, 3,3’-diaminobenzidine tetrahydrochloride; DMEM, Dulbecco’s modified Eagle’s medium; EDTA, ethylenediaminetetraacetate; ELISA, enzyme-linked immunosorbent assay; HAT, hypoxantin aminopterin and thymidine; IPTG, isopropyl /3-D-thiogalactoside; PBS, phosphate-buffered saline; PCR, polymerase chain reaction; SDS, sodium dodecyl sulfate; FIFo, proton translocating ATPase for oxidative phosphorylation.

373 Inc. reserved.

374

MIKI

within it (1,4). Based on these observations, a hypothetical catalytic domain between residues 140 and 350, and its ternary structure were proposed (12). Recently we analyzed reversion mutations from a defective mutant of the p subunit (13) and reported that Ser-174 possibly interacts with Gly-149, Ala-295, and Leu-400. These residues are located within the previously estimated catalytic domain of the fl subunit (11,12), suggesting that this domain is indeed folded for catalytic function. However, the actual ternary structures which are essential for understanding the molecular mechanisms of FIFo remain unknown. In this study, we obtained monoclonal antibodies raised against the fi subunit, and analyzed the locations of epitopes to the antibodies on the primary structure of the /3 subunit to correlate the primary and ternary structures. Although monoclonal antibodies raised against the Fi subunits have been reported (14, 15, 39), mapping of their epitopes on the primary structures of the subunits is rare. Bromocyan cleavage or treatment with o-iodosobenzoic acid has been used to map the antigenic sites to anti-y antibodies (15). Since this procedure has limitations for use in mapping due to the availability of specific cleavage sites for the reagents, more general approaches are required for detailed mapping. In this study, we established a new mapping procedure by synthesizing portions of p subunit peptides using the polymerase chain reaction and an expression vector of the peptide genes. This procedure is applicable to epitope mapping of the antibodies against the other subunits of FIFo. Two monoclonal antibodies which bound to the fl subunit isolated in the present study did not bind to Fi ATPase, suggesting that the epitopes reside on internal domains rather than at the surface of the F1 complex. These antibodies bind to the peptide at amino terminal 104 on the subunit. The results indicated that the regions recognized by the monoclonal antibodies in the amino terminal domain are not exposed to the surface of F1 ATPase. Although the functional importance of the central portion of the @subunit has been described, the other portions of the subunit, including the amino terminal portion analyzed in the present study, are not known. The antibodies obtained in the present study will be very useful for analyzing the amino terminal domain. MATERIALS

AND

METHODS

Construction of hybridomus. The fi subunit from E. coli was purified as described previously (28). BALB/c mice (8 to 12 weeks of age) were immunized with 10 pg of the purified intact /3 subunit from E. coli and 2 mg of aluminium hydroxide gel three times at 3-week intervals. At the same time as the first immunization, 0.1 pg of Bordetella pertussis toxin was also injected subcutaneously. Four days after the last immunization, a dissociated spleen cell suspension was prepared as described previously (16). Spleen cells (5 X 107) were fused with the HATsensitive NS-1 cell line (2 X 107) in 0.3 ml of 50% polyethylene glycol (PEG4000, Merk) for 90 s as described previously by Rudolph et al. (17). The production of anti-8 subunit antibodies in HAT-resistant col-

ET

AL. onies selected procedures.

in DMEM

medium

was examined

using

the following

Enzyme-linked immunosorbent assays (ELISA). According to the published procedure (18), an ELISA was used to assess reactivities of the monoclonal antibodies to the isolated fi subunit. Purified p subunit, 0.2 pg in 50 pl of PBS, was fixed in wells of flat bottom polystylene microtiter plates (Nunc Co.) by incubation at 4’C overnight. The wells were washed three times with 200 ~1 of PBS and incubated for 2 h at 37’C with 300 ~1 of PBS containing 1% BSA to block nonspecific binding of the antibodies. The wells were again washed with PBS and then 50 ~1 of culture media or antibody solution diluted in PBS was added to each well. The plates were incubated for 2 h at 37’C and then washed three times with washing buffer containing 20 mM imidazole-HCl (pH 7.2), 0.3 M NaCl, and 0.02% Tween 20. Each well then received 50 pl of goat anti-mouse IgG and anti-mouse IgM labeled with peroxidase (KPL, Inc.), at a concentration of about 0.5 pg/ml. The plates were again incubated for 3 h at 37’C and then washed five times with 200 pl of washing buffer. The plates were developed by adding 50 pl(2,2’-azinodi-[3-ethylbenzthiazoline sulfonate(6)] substrate to each well. The enzyme reaction was measured by photometer (microplate reader MPR A4i, Tosoh Co.) at 405 nm. Production and purification of monoclinal antibodies. The hybridoma producing monoclonal antibodies pl2 and j331 was grown as ascites tumors. The immunological class of the antibodies /312 and 831 was IgGl, as determined with a monoclonal antibody typing kit (The Binding Site Ltd.). These antibodies were purified by ammonium sulfate precipitation and column chromatography on DEAE Bio-Gel A (Bio-Rad Co.). Antibody adsorption assays. The binding ability of the antibodies to the Fi complex was determined by an antibody adsorption assay. Buffers and procedures were the same as those in the ELISA assay shown above except for the preincubation of the monoclonal antibodies with the native Fi complex or the isolated p subunit before addition to the fixed /3 subunit. About 5-10 ng of the monoclonal antibodies was preincubated at room temperature for 15 min with O-4.7 pmol of Fi or O-6.0 pmol of the isolated p subunit. The molecular weights for Fi of 381,759 and for the j3 subunit of 50,117 were used in the calculations. Zmmunolagical detection of proteins. Samples were separated by SDSpolyacrylamide gel electrophoresis on 12.5% gels using Tris-glycine buffer (19) or 16.5% gels using Tris-Tricine buffer (20). The proteins were transferred onto polyvinylidene difluoride membrane (GVHP filter, Millipore Co.) by electroblotting. The blotted filter was incubated overnight at 4°C with PBS containing 5% skim milk and 1% BSA (blocking buffer) to block nonspecific binding of the antibodies. The filter was incubated for 1.5 h at 37°C with the antibody diluted in the blocking buffer (1:700 for purified antibodies) after removing the blocking reagents. The filter was then incubated with 2 pg/ml of biotinylated antimouse IgG for 2 h at room temperature. The Vectastain ABC reagent (a complex of avidin and biotinylated peroxidase, Vector Lab., Inc.) was added and incubated for 30 min at room temperature. Blots were developed with 100 ml of 20 mM Tris-HCl, pH 7.6, containing 20 mg of 3,3’-diaminobenzidine tetrahydrochloride (DAB) and 20 ~1 of 30% hydrogen peroxide. Bacterial strains and growth conditions. E. coli B strain BL21(DE3) and BL21(DE3) carrying plasmid pLysS or pLysE(21) were used as the host for the T7 expression system which was a kind gift from Dr. F. W. Studier, Brookhaven National Laboratory, Upton, New York. Rich medium (L-broth) (22) was used for genetic analysis. To express target genes, cells carrying expression plasmids were grown in MSZB medium (21), containing 1% Bacto Tryptone (Difco), 0.1% NH&l, 0.3% KHzPO,, 0.6% Na2HP04, 0.5% NaCl, 1 mM MgSOI, and 0.4% glucose. To isolate strains carrying antibiotic resistance, 50 pg/ml of ampicillin was added to the medium. Cells carrying expression plasmids were shaken in 10 ml of MSZB medium at 37”C, and gene expression was induced by adding 0.4 mM IPTG when the culture reached an ODBoo of 0.6. The cells were usually harvested 2-4 h after the induction. The cells collected by cen-

MONOCLONAL

ANTIBODIES

OF

THE

F,-ATPase

trifugation were resuspended and adjusted to 2 OD units at 600 nm in sample buffer (50 mM Tris-HCl, pH 6.8, 2 mM EDTA, 1% SDS, 1% fimercaptoethanol, 8% glycerol, 0.025% bromphenol blue). The samples were electrophoresed after heating for 2 min in a boiling water bath. Enzymatic amplification of chromosomal DNA. E. coli chromosomal DNA (2 wg) prepared from strain KY7230 (thy-, thi-, asn-) (23) according to the published procedure (24) was amplified with 2 units of Tth DNA polymerase (from Thermus thermophilus HB8) by the procedure originally described by Saiki et al. (25). The reaction mixture, including two primers (50 pmol) in appropriate combinations to amplify target regions was subjected to 30 cycles of incubation (1 min at 94’C, 2 min at 45”C, and 2 min at 72°C) in a programmable incubator (DriBlock PHC-1, Techne Co.). Primers synthesized in this study had extra sequences besides the recognition site for either NcoI or BamHI (Table I) to ensure binding of the enzyme to the recognition site. BEF-47, -105, and -146 have an additional initiation codon corresponding to the positions of codon 46,104, and 145 of the @ subunit, respectively? BER46, -104, -145, -201, and -225 have an additional termination codon corresponding to codon -47, 105, 146, 202, and 226, respectively. The expression vectors used in Construction of expressionplasmids. this study, pET3d and pET3xa, were constructed by Studier et al. (21). The amplified DNAs with oligonucleotide BEF-1 in combinations with BER-46, -104, -145, and -201 as the primers encode residues l-46, l104,1-145, and l-201 of the p subunit, respectively. Other portions of the @ subunit gene were also amplified with appropriate combinations of the primers shown in Table I. The amplified DNAs were digested with restriction endonucleases, NcoI and BamHI, and then electrophoresed on polyacrylamide gels. The DNA fragments corresponding to the p subunit portions were eluted from the gel matrix and ligated to pET3d digested with NcoI and BamHI. Since an internal NcoI site (around codon 226) is present in the fl subunit gene, an expression plasmid carrying the carboxyl terminal half of the p subunit was constructed from the portion between residues 226 and 459, and pETBd, in which ATG for /3Met-226 works as an initiation codon. In order to construct an expression plasmid for the whole fl subunit, the amplified DNA with primers, BEF-1 and BER-459, was digested with NcoI, and the portion encoding the amino terminal half of the /3 subunit between residues 1 and 225 was introduced as the NcoI-NcoI fragment to the plasmid carrying the portion encoding the carboxyl terminal region between residues 226 and 459. Expression plasmids producing fusion proteins of a portion of the @ subunit and T7 gene 10 protein were constructed as follows. The oligonucleotide XA (5’-AAGGAGATCTACCATGG-3’) carrying the sequence recognized by EglII and the sequence adjacent to the 5’ end of the NcoI site in pET3d in that order was synthesized as a primer with which to construct a fusion gene. The amplified DNAs with XA in combination with appropriate BER primers were digested with BgZII and BamHI, and then the resulting BglII-BamHI fragments were introduced into a unique BamHI site in another expression vector pET3xa. Gene 10 is located between the NdeI site at the amino terminal end and the BamHI site next to 260th codon at the carboxyl terminal end in pET3xa. Plasmids with the insert in the proper orientation were selected by restriction mapping with the EglII and BamHI sites as the markers. Preparation of membranes and the ATPase assay. Cells harvested in the late logarithmic phase of growth were disrupted by sonication (UR-POOP, TOMY SEIKO Co.) and the membranes were fractionated as previously described (22). The ATPase activity and protein concentration were assayed by reported procedures (26, 27). Digestion of the purified j3 subunit with lysyl endopeptidase or V8 protease. Purified 6 subunit, 20 pg, was digested with 0.1 pg of lysyl endopeptidase (35) or V8 protease (36) in 250 ~1 of 170 mM 2-amino-2-

3 Codons are numbered starting from the second codon of the gene coding for the b subunit, as amino terminal methionine is missing in the isolated /3 subunit (30).

/3 SUBUNIT

FROM

Escherichia TABLE

375

coli

I

Sequences of Synthetic Oligonucleotides for Primers BEF-1 BEF-47 BEF-105 BEF-146 BER-46 BER-104 BER-145 BER-201 BER-225 BER-459

TACTCCATGGCTACTGGAAAGATTG TACTCCATGGGCGGCGGTATCGTACG TACTCCATGGAGCGTTGGGCGATTCA TACTCCATGGGTCTGTTCGGTGGTGC CCTTGGATCCTAGAGCTGCTGCTGAACTT CCTTGGATCCTATTCTTCACCGATCTCGC CCTTGGATCCTAAACTTTACCGCCCTTAG CCTTGGATCCTATTTGTCGATAACGTTGG CCTTGGATCCTTAGGTCAGACCGGTCAGAGC TACTGGATCCGATTAAGGCGTTAAAG

Note. The sequences of primers synthesized for PCR amplification of the portions of the uncD gene coding for the fl subunit are shown. The oligonucleotides were synthesized by a DNA synthesizer (MilliGen/ Biosearch Cyclone). The sequences of oligonucleotides, BEF and BER, correspond to the sequences of antisense and sense strands, respectively. The underbars show the additional NcoI or BamHI site.

methyl-1,3-propanediol buffer (pH 9.5) for various periods in 250 ~1 of 80 mM Tris-HCl (pH 7.8) at 25°C respectively. corresponding to 0.3 pg of p subunit were electrophoresed SDS-polyacrylamide gel.

at 30°C or Samples in a 12.5%

Other procedures. The p subunits synthesized by recombinant plasmids were purified as described previously (28). The /3 subunit from thermophilic bacterium PS3 was a gift from Dr. Y. Kagawa, Jichi Medical School, Japan. E. coli Fi was prepared as described previously (26). Nondenaturing electrophoresis was carried out in slab gels according to a published procedure (29). Reagents and chemicals. Restriction endonucleases and T4 DNA ligase were purchased from BRL Co. (U.S.A.). Tth DNA polymerase was purchased from TOYOBO Co. (Japan). Lysyl endopeptidase and V8 protease were purchased from Wako Chemical Co. (Japan). Other materials were of the highest grade available commercially.

RESULTS Isolation of monoclonal antibodies against the p subunit. Mice were immunized with the purified /3 subunit from E. coli Fi ATPase. Immunized spleen cells from the mouse were fused to the myeloma cell line NS-1 with polyethylene glycol. Hybrid cells which produced monoclonal antibodies against the fi subunit were screened by an ELISA assay. Sixteen independent clones producing the antibodies were isolated, among which fil2 and fi31 had higher binding activities, and were further analyzed. Mapping antigenic regions of the fl subunit to the antibodies. To determine the regions of the fl subunit antigenic to the two monoclonal antibodies, we constructed two hybrid plasmids carrying the genes encoding the amino terminal half (residues 1 to 225) and the carboxyl terminal half (residues 226 to 459) of the ,8subunit, named pETl-225 and pET226-459, respectively (Fig. 1). These expression plasmids have the T7 promoter and the T$ terminator derived from pET3d constructed by Studier et al. (21). Expression of the inserted genes from the p subunit gene is controlled by expression of T7 RNA poly-

MIKI

ET

AL. A

0 1234567

pETl-225

1234567

66k45k2Sk-

pET226.456

24k 2Ok-

pETl-201 pET1-145 pET1-104 pET1-46

C 1234567

14k -

I

I 2

I 3

I 4

I 5

FIG. 1. Peptide fragments of the E. coli /3 subunit produced from T7 expression plasmids. DNA segments with NcoI and BornHI sites carrying a portion of the /3 subunit gene were inserted into the expression vector pET3d. These segments were amplified with the primers shown in Table I, from chromosomal DNA of an E. coli wild-type strain, and then cut by the restriction enzymes, NcoI and BarnHI. Each primer has an initiation codon or a termination codon; then each peptide fragment shown in this figure as a closed box was produced in the host cell BL21(DE3). We divided the amino terminal half of the gene into four parts corresponding to the exons (2, 3, 4, and 5) of the human gene. The regions corresponding to the exons of the human gene are shown by open boxes.

merase, which in turn is under the control of the lactose promoter in strain BL21(DE3). As shown in Fig. 2A, large quantities of both peptides were synthesized upon induction of the T7 RNA polymerase with IPTG. The monoclonal antibodies, @12and 831, reacted with the peptide corresponding to the amino terminal half but not with the peptide of the carboxyl terminal half, indicating that the epitopes reside in the amino terminal half of the @ subunit (Figs. 2B and 2C). We analyzed the locations of the epitopes within the amino terminal half by constructing expression plasmids as described above, but carrying portions of the amino terminal half. It was proposed for higher eucaryotic cells that exons of a gene encode specific functional domains of the encoding protein (31). We assumed that the epitopes for the antibodies g12 and 831 reside in such exons. Since the genomic sequence for the human fl subunit gene has been determined (32), we divided the amino terminal half of E. coli gene into four parts corresponding to the exons of the human gene (exons 2 to 5) (Fig. 1). Since the first exon for the human gene encodes an extra sequence of the p subunit propeptide, the first portion from residues 1 to 46 in E. coli corresponds to the second human exon. Subsequently, portions of residues 47 to 104, 105 to 145, and 146 to 201 correspond to human exons 3,4, and 5, respectively. DNA segments coding for each portion were synthesized by PCR using the appropriate oligonucleotides shown in Table I as primers and were fused to the vector pET3d. Although the constructed plasmids are structurally normal, a peptide was synthesized only for the portion of residues 1 to 46 (pETl-46) but not for the other portions. Since the peptides are relatively short, they could have been digested in the cells. In fact, peptides corresponding to residues 1 to 104 (pETl-104) and 1 to

FIG. 2. Western blot analysis of the p subunit and its fragments derived from the T7 expression system. Total proteins from cells of BL21(DE3) carrying pETl-459 (lanes 2, 3), pETl-225 (lanes 4, 5), or pET226-459 (lanes 6, 7) were extracted in sample buffer containing SDS and electrophoresed in a 12.5% SDS-polyacrylamide gel. The gel was stained with Coomassie blue (A) or probed with the monoclonal antibody j312 (B) or 031 (C!). The cells were collected immediately before (lanes 2,4,6) and 4 h after (lanes 3,5, 7) induction of the target DNAs. One microgram of Fi was applied to lane 1. The proteins were electrophoretically blotted onto GVHP filters, blocked, and probed with the monoclonal antibody 812 (B) or j331 (C), respectively, as described under Materials and Methods.

145 (pETl-145) were synthesized. However, even longer portions, residues 47 to 104, residues 105 to 225, and residues 47 to 225, were not synthesized using the plasmids constructed in the same way as described above. Although the reasons are presently unclear, it seemsthat peptides without the amino terminal end of the /3 subunit could not be synthesized. As shown in Fig. 3, the two monoclonal antibodies reacted with the peptides corresponding to residues 1 to 104 and 1 to 145, but not to the peptide of residues 1 to 46.

A 1

B 2

3

4

12

C 3

4

12

3

4

--P 21.5 12.5

-

6.5 -

FIG. 3.

Western blot analysis of the amino terminal fragments of the fl subunit derived from the T7 expression system. Total proteins from cells of BL21(DE3) carrying pETl-201 (lane l), pETl-145 (lane 2), pETl-104 (lane 3), or pETl-46 (lane 4) were electrophoresed in a 16.5% SDS-polyacrylamide gel with Tris-Tricine buffer and stained with Coomassie blue (A) or probed with the monoclonal antibody @12 (B) or 831 (C). Samples were prepared as described under Materials and Methods and in the legend to Fig. 1. Samples, 2.5, 5, 25, and 25 pl in lanes 1, 2, 3, and 4, respectively, were electrophoresed. The proteins were electrophoretically blotted onto GVHP filters, blocked, and probed with the monoclonal antibody /312 (B) or 831 (C), respectively, as described under Materials and Methods.

MONOCLONAL

ANTIBODIES

OF

THE

F,-ATPase

These results indicate that the epitopes for the antibodies are located among residues 1 to 104. When the DNA segments coding for the peptides without the amino terminal end were fused to gene 10 in pET3xa, fused peptides containing the /3 peptides connected to the carboxyl terminal 260th codon of the gene 10 protein were synthesized (Fig. 4A). Fused peptides carrying residues 1 to 46 and 47 to 104 were synthesized in the induced cells but they did not react with the antibodies, although the fused peptide of residues 1 to 104 did so (Fig. 4B). These results indicate that the epitopes for the antibodies are not among residues 1 to 46 or 47 to 104, but that they are located in sequences which span the two domains. A fused peptide of residues 1 to 46 and gene 10 did not react with the antibodies, confirming the previous results. Species specificity of the epitopes to the monoclonal anWe determined whether the monoclonal antitibodies. bodies could react with the p subunit from various species of bacteria. The cytoplasmic membranes from the various bacteria shown in Fig. 5 were analyzed by Western blotting using the monoclonal antibodies. As shown in Fig. 5, the p subunit from Klebsiella pneumoniae and Salmo-

A 12

6 3

4

5

12

3

4

5

(t; 66k

-

45k

-

36k

-

29k

-

24k

-

20k

-

,4k

_

,I,:$.!

blot analysis of portions of the /zl subunit as fusion FIG. 4. Western proteins derived from the T7 expression system. The DNAs introduced into pET3d were amplified with the oligonucleotide XA carrying upstream sequence of the NcoI site of pET3d and the appropriate BER primers, shown in Table I, as described under Materials and Methods. The amplified DNAs were digested with BglII and BarnHI, and the resulting EglII-BamHI fragments were introduced into the expression vector pET3xa digested with BarnHI. The plasmids carrying the genes in proper orientation were selected. The fused peptides of B subunit portions containing the gene 10 product were synthesized by inducing the target DNAs in the BLZl(DE3) cells carrying pXAl-104 (lane l), pXA46-145 (lane 21, pXAl-46 (lane 31, pXA47-104 (lane 41, andpXA105145 (lane 51. Samples were prepared as described under Materials and Methods and in the legend to Fig. 1. Samples, 5 ~1, were electrophoresed in a 12.5% SDS-polyacrylamide gel. The proteins were electrophoretically blotted onto GVHP filters, blocked, and probed with the monoclonal antibody @12 (B) as described under Materials and Methods. The same results were obtained with the antibody ,331 (data not shown).

8 SUBUNIT

A .amAl ....

12345678

FROM

Escherichia

coli

377

B 12345678

FIG. 5. Species specificity of the monoclonal antibodies. Membrane proteins, 10 pg, from various species of bacteria were electrophoresed on 12.5% SDS-polyacrylamide gels. Separated proteins were transferred to GVHP filters, blocked, and probed with the monoclonal antibody @12(A) or 031(B) as described under Materials and Methods and in the legend to Fig. 2. In each panel, the lanes are as follows: 1, S. aureccs; 2, P. aeruginosa; 3, P. pyocyaneum; 4, K. pneumoniae; 5, V. parahaemolyticus; 6, V. alginolyticus; 7, S. typhimurium; and 6, E. coli. Common bands with a molecular weight of around 65 kDa in the results of 012 and 831, which appeared in lanes 2,5, and 6, were due to their nonspecific binding to the second antibodies used in this assay system. The other bands were specific for the anti-0 subunit monoclonal antibodies.

nella typhimurium reacted with /312 and p31. Besides these, the p subunits from Pseudomonas aeruginosa, Pseudomonas pyocyaneum, and Vibrio parahaemolyticus reacted with 031. These results indicated that the epitopes for pl2 and /331 are different even in the amino terminal 104 residues and that p31 recognizes epitopes common to broader species than pl2. Bands appearing for P. aeruginsa, V. parahaemolyticus, and V. alginolyticus in the results for pl2 were also visible for p31. Since these bands appeared only with goat anti-mouse immunoglobulin antibodies without the monoclonal antibodies, they were due to nonspecific binding to the second antibodies used in this assay system. Reactivities to the purified p subunit from the thermophylic bacterium PS3, in which the nucleotide sequence of the fl subunit was determined (33), were analyzed. The antibodies did not bind to the subunit, which suggested that the epitopes are in sequences which are not common to the two species. Binding of the monoclonal antibodies to the F, complex. To determine whether the epitopes in the amino terminal 104 residues are on the surface of the FL complex, we tested the antibody binding capacity to the complex. First, we electrophoresed the purified F1 on a nondenaturing polyacrylamide gel and then analyzed it by Western blotting. As shown in Fig. 6, the antibodies reacted to F1. A significant amount of the p subunit was also visible. However, the stained band corresponding to the P subunit was very weak and the staining ratio of the /3, versus F1, was much higher in Western blotting than in peptide staining. Therefore, we thought that the

378

MIKI

A

B

ET

C

FIG. 6. Immunological analysis of the purified Fi after nondenaturing gel electrophoresis. The purified E. coli Fr was electrophoresed under nondenaturing conditions, and the proteins were electrophoretically transferred to a GVHP filter. (A) Stained with Coomassie brilliant blue before blotting; (B and C) probed with the monoclonal antibodies /312 and @31, respectively, as described under Materials and Methods and in the legend to Fig. 2. The open and closed triangles indicate the positions of the F1 and isolated fl subunit, respectively.

antibodies bound to the B subunit rather than to Fi. If, during electrophoresis and electroblotting, the /3 subunit was released from the F1 complex, then the dissociated fl subunits should locate at the same position as Fi on the blotted filter.

L I

0

2

4

AL.

6 0

2

.

I

4

I

0

.

I

.

10

I

20 AntibW

.

I

30 ( Pg 1

.

I

40

FIG. 8. Effect of the antibodies on ATPase activity. Purified monoclonal antibodies as indicated were incubated for 30 min with 1.0 pg of Fi purified from E. coli KY7230 in 0.1 ml of 50 mu Tris-HCl, pH 7.4, containing 10 mM MgClr and 50 pg/ml of BSA. Hydrolysis of ATP was started by adding 0.5 ml 4.8 mM ATP and 2.4 mM MgCl, in 30 mM TrisHCl, pH 8.0, at 37°C and allowing the reaction to proceed at that temperature for 10 min. The ATPase activity was assayed by measuring release of inorganic phosphate calorimetrically and is expressed as percentage activity. Open circles, incubated with 812; closed circles, incubated with 831.

The working hypothesis was confirmed by the second approach using the ELISA assay system. The p subunits were fixed on polystyrene plates and the effect of the p and F1 on binding of the antibodies to the fixed /3 subunit was analyzed. As shown in Fig. 7, the antibodies preincubated with the 0 subunit did not bind to the fixed p subunit, but the antibodies preincubated with the F1 complex did bind to the p subunit. These results supported the notion that the antibodies do not bind to the F1 complex.

Effects of the monoclonal antibodies on Fl ATPase acSince the antibodies did not bind to the Fi comtivity.

.

6

p subunil (pmol)

FIG. 7. Antibody adsorption assays by the purified Fr and the t!l subunit. About 5-10 ng of the monoclonal antibodies fi12 (A) and 831 (B) was preincubated at room temperature for 15 min with O-O.6 pg of the F1 or O-O.3 fig of the fi subunit which corresponds to O-4.7 or O-6.0 pmol of the 0 subunit, respectively. The adsorption abilities of the purified F1 and the @ subunit for monoclonal antibodies ware assessed using an ELISA assay. Buffers and procedures were the same as the ELISA assay as described in Materials and Methods except for the preincubation of monoclonal antibodies with purified F, or the isolated fi subunit. The microtiterplate developed with ABTS as a substrate was read at 405 nm with a microplate reader. Open squares, incubated with purified F,; closed circles, incubated with the purified @ subunit.

plex, effects of the antibodies on the ATP hydrolytic activity of the Fi were analyzed. As shown in Fig. 8, the antibodies did not inhibit the activities, which was consistent with the binding analysis.

Anutysis of the ,8 subunit cleavage by protease with the Using the antibodies @12and 831 we anaantibodies. lyzed proteolysis of the p subunit by endopeptidases to investigate the ternary structures of the subunit in terms of the cleavage sites. After digestion of the /3 subunit with limited amounts of a lysyl endopeptidase from Acromobatter, the fate of the cleaved peptides was detected by silver staining and the antibodies. As shown in Fig. 9, a major peptide of around 43 kDa and several minor bands stained by silver appeared. This 43-kDa band did not react with the antibodies, but a 32-kDa peptide did during the early stages of the digestion. When V8 protease from

MONOCLONAL

A

ANTIBODIES

B 1

2

3

4

5

2

3

4

5

12345

MW (Da)

C 1

OF

THE

F,-ATPase

/3 SUBUNIT

FROM

Escherichia

coli

379

subunit, the cleavage site may be 69, 81, or 98. This is also consistent with the notion that the epitope regions are within residues 1 to 104 from the amino terminal of the /3 subunit. One possibility is that the area containing the epitope region is hydrophilic and is exposed to the surface of the /3 subunit which is also cleaved easily by the peptidases. The appearance of the 32-kDa peptide reactive with the antibodies suggested that around residues 300 to 400 there are cleavable sites which may be less susceptible than those potentially around residues 70 to 90 of the lysyl endopeptidase. DISCUSSION

D 12345

Extensive genetic and biochemical approaches during the last 5 years have revealed correlations between the primary structure and catalytic function of the p subunit from E. coli (1,4). However, the topological arrangement of the residues in the subunit, which is important in understanding the function of the B subunit, has not been studied in depth. We therefore identified reversion mutations which recover the function of a mutated and defective /3 subunit and discussed the topological interaction of the two residues (13). In this study, we prepared monoclonal antibodies as probes to analyze the ternary structures of the @ subunit. For this purpose, the epitopes FIG. 9. Western blot analysis of the partial cleavage fragments of the B subunit with lysyl endopeptidase or VS protease. The purified fl subunit, should be mapped on the primary structure of the fl sub20 pg, was treated with 0.1 pg of lysyl endopeptidase for 0, 1,2,4, and unit. Although monoclonal antibodies against F, from E. 6 min (A, B, lanes l-5) or with 0.1 pg of V8 protease for 0,4,8,12, and coli have been reported (14,15), the epitopes were mapped 24 h (C, D, lanes l-5). Samples corresponding to 0.3 pg of j3 subunit only in regard to the antibodies to the y subunit. Peptides were electrophoresed in a 12.5% SDS-polyacrylamide gel, which was of the y subunit cleaved by a chemical reagent were used then stained with silver (37) (A, C). After electrophoresis the proteins were electrophoretically blotted onto GVHP filters, blocked, and probed to locate the epitopes (15). Availability of cleavage sites with the monoclonal antibody @12 (B, D) as described under Materials is a limiting factor for mapping. Therefore, in the present and Methods. The arrowheads indicate the positions of the isolated j3 study, we established a procedure to map the epitopes subunit. The same results were obtained with the antibody @31 (data using a recombinant DNA technique. DNAs for any pornot shown). tion of the peptide could be amplified by PCR, and the corresponding peptides were synthesized after constructStaphylococcus aureus was used, similar results were ob- ing fusion plasmids with the expression vectors pET3d tained, although the digestion reaction was much slower or pET3xa (21). We also chemically synthesized oligousing the same amount of the enzyme (0.1 pg/ml). Peppeptides but they did not function well in epitope mapping tides of 41 and 30 kDa unreactive and reactive with the (data not shown). Since short peptides usually have weak antibodies, respectively, were detected. These results antigenicity and their chemical synthesis is costly, the could be explained as follows. The 43- and 41-kDa pep- approach taken in the present study will be useful for tides should not have the epitopes to the antibodies, be- epitope mapping of the antibodies against the FIFo subcause the peptides did not react with the antibodies. Since units in general. the possible epitopes for the antibodies exist within the The monoclonal antibodies pl2 and /331 obtained in residues 1 to 104, these two peptides should not have the the present study bind to the /3 subunit, but not to the F1 amino terminal. These peptides correspond to the region ATPase complex. The antibodies also do not inhibit of 390 or 370 residues which was calculated taking an ATPase activities. These results indicated that the epiaverage molecular weight of amino acids of 110. This ex- topes to the antibodies are exposed on the p subunit but planation suggested that at least one of the sites rapidly not to the surface of the Fi ATPase. Two possibilities cleavable by proteases is located around residues 70 to 90 were raised by these results. Perhaps the epitopes were from the amino terminal end, since the /3 subunit has 459 buried in the internal domain in the F1 ATPase complex residues. Since lysyl residues are at 4,69,81,98,131,141, by a conformational change induced upon binding of the 144, 155, and 201 in the amino terminal half of the @ p subunit to the other subunits during complex formation,

380

MIKI

V.S/ginOlytiCllS

PS3

AL.

80 CIGYGS~~GLRRGVIVVNTGAPISVPVGTKTLGR~~NVLGOA~O~~~~VGA~------*,*****t*t*t..* . l t.t*t*. ****t**t*t...* TIA~ASTOGLIRGMEVI~TGAPISVPVGQVTLGRVFNVLGEPIOL~GO~PAO------l t**.*.t.*

E. co/i

ET

l *,,*

*

tt,t***~~*.t*

l

l

TIANGSSOGLRRGLOVKOL;KPIEVPVGKATLGR~~NVLGEP~OM~GEIG~~-------

.****

l ,

*

1..

l .*

FIG. 10. Alignment of amino acid sequences of the p subunits from V. algirwlyticus, PS3, and E. coli. Western blotting analysis revealed that the antibodies bound to a peptide of 104 amino acid residues from the amino terminal end of the /3 subunit. The sequences of the amino terminal regions of the @ subunits from V. alginolyticus (34), PS3 (33), and E. coli (30) were aligned to obtain maximal homology. Asterisks and dots indicate identical and conservative residues, respectively. Relatively hydrophilic regions according to hydropathy analysis described by Kyte and Doolittle (38) are shown by closed boxes. As described in the text, the first 46 and second 48 residues divided by an arrow did not react to the antibodies, suggesting that the epitopes may be located in sequences which span the two domains.

resulting in no antibody binding. The other possibility is simply that the epitopes are hindered from antibody attack by other subunits of the F1 complex, especially by the a! and y subunits. These possibilities are not mutually exclusive at present. The epitopes reside on 104 amino acid residues from the amino terminal end of the @ subunit. None of the first 46 and second 48 residues fused to the carrier peptide reacted with the antibodies. These results indicated that the epitopes span the two domains. It is not certain whether the epitopes are on a colinear structure across the junction of the two domains or on two sets of separate residues on both domains. Two separate epitope sequences may interact with each other in the ternary structure. It appeared that @12 and /331 reacted with the same domain of 104 residues, indicating that both antibodies recognized the same residues or residues closely situated. However, the binding reactivities monitored by band intensities in Western blotting analysis indicated that 031 has a higher affinity for the epitopes. The binding spectra of the two antibodies to several different sources of the p subunit were quite different. The 831 antibody can bind to the @subunit from more sources than can 012. These results suggested that the two antibodies recognize different epitopes within the 104 residues. The /3 subunit of K. pneumoniae and S. typhimurium reacted with the antibodies, but that from S. aureus did not. This spectrum is consistent with structural similarities of 5s RNA (40) among the species analyzed in the present study. From this aspect, it is also reasonable that V. alginolyticus and V. parahaemotiticus are weakly reactive with the antibodies. Since the /3 subunit of V. parahuemolyticus is more reactive with /331, this species may be closer to E. coli than V. alginolyticus, phylogenically. Both antibodies did not bind to the purified /3 subunit from thermophilic bacterium PS3, indicating that the

epitopes are located on residues with different sequences from that of PS3. As shown in Fig. 10, several regions in which the sequences are less homologous among E. coli, PS3, and V. alginolyticus can be observed in the amino terminal 104 residues. These regions are also hydrophilic, which would make them good candidates for being the epitopes. Cleavage of the fi subunit by peptidases supported the notion that the epitopes reside in the amino terminal 104 residues, because 41- or 43-kDa peptides without the epitopes appeared after cleavage. This also suggested that some part of the region around residues 50 to 100 from the amino terminal is extensively exposed to the fi subunit surface. Lysyl residues recognized by the lysyl endopeptidase were 69,81, and 98. Since the peptide that appeared after cleavage by the endopeptidase is 43 kDa, Lys-69 is the most probable site. Within residues 1 to 69, four regions are relatively hydrophilic according to hydropathy analysis described by Kyte and Doolittle (38) (Fig. 10). Therefore the epitopes for the antibodies may exist within these residues, which would be consistent with the conclusion obtained from Western blotting. Further analysis using localized mutagenesis is required to distinguish the epitope sequence. The central domain of the /? subunit in approximately 200 residues between around 140 and 350 is proposed to be important for function, as concluded from results of mutant analysis and chemical modifications (4). However, the other portions besides the central domain are not well characterized. Since the epitopes for fi12 and P31 are in the amino terminal 104 residues, the antibodies recognize one of the portions outside of the central domain. Therefore, the antibodies will be very useful for the functional analyses of the amino terminal domain, including binding of adenine nucleotides and assembly with other subunits. These studies are now underway.

MONOCLONAL

ANTIBODIES

OF

THE

F,-ATPase

Dunn et al. also reported antibodies which reacted with the free p subunit but not with the F1 complex (14). These antibodies may be similar to /I12 and p31, but it is not clear, because their epitopes were not mapped to the primary structure of the p subunit. We repeatedly experienced peptides without an amino terminal end that were not synthesized from the expression vectors. When these peptides were fused to the gene 10 product, all of the peptides were synthesized. One possibility is that these peptides were synthesized but that they were degraded rapidly. The amino terminal end portion might protect the peptides with the end portion from the degradation. However, the peptide between residues 225 and 459 which does not have the amino terminal end was stably synthesized. Therefore, protection of the amino terminal end portion may be effective for the amino terminal half. ACKNOWLEDGMENTS This work was supported in part by Grants-in-Aid from the Ministry of Education, Science, and Culture, the Naito Science Foundation to H.K., and the Okayama Foundation for Science and Technology to J.M. The authors are grateful to Dr. S. Sakai, K. Tomochika, K. Hayashi, and T. Sekiya for help in synthesizing oligonucleotides. The authors thank K. Tomochika and Y. Tomita for preparation of membranes of various bacteria. The authors appreciate the valuable comments by T. Noumi and M. Tsuda.

REFERENCES 1. Futai, M., Noumi, T., and Maeda, M. (1989) 58, 111-136. 2. Futai, M., and Kanazawa, H. (1983) Micro&l. 3. Walker, J. E., Sara&e, Acta 768, 164-200. 4. Senior,

A. E. (1990)

M., and Gay, Annu.

Annu.

Reu. 47, 285-312.

N. J. (1984)

Rev. Biophys.

Reu. Biochem.

Ckem.

Biochim.

19, 7-41.

5. Gogol, E. P., Johnston, E., Aggeler, R., and Capaldi, Proc. Natl. Acad. Sci. USA 87,9585-9589. 6. Futai,

M. (1977)

Biochem.

7. Dunn,

S. D., and Futai,

Biophys. M. (1980)

Res. Commun. J. Biol.

Chem.

Biophys.

R. A. (1990) 79,

255,

8. Harada, M., Ohta, S., Sato, M., Ito, Y., Kobayashi, Ohta, T., and Kagawa, Y. (1991) B&him. Biophys.

1231-1237. 113-118. Y., Sone, N., Actu 1066,

279-284. 9. Avital, 7072. 10. Ohta,

S., and Gromet-Elhanan, S., and Kagawa,

Y. (1986)

Z. (1991)

J. BioL Chem.

J. Biochem.

(Tokyo)

266,706799,

135-141.

11. Kanazawa, H., and Futai, M. (1984) Third European Bioenergetics Conference, EBEC Reports, Vol. 3A, pp. 77-78. 12. Duncan, T. M., Parsonage, D., and Senior, A. E. (1986) FEBS Lett. 208, l-6. 13. Miki, J., Fujiwara, K., Tsuda, M., Tsuchiya, T., and Kanazawa, H. (1990) J. Biol. Chem. 265, 21,567-21,572.

fl SUBUNIT

FROM

14. Dunn, S. D., Tozer, J. BioL Chem. 260,

Escherichia

R. G., Antczak, 10,418-10,425.

381

coli D. F., and Heppel,

15. Ehrig, K., Hoppe, J., Friedl, P., and Schairer, Biophys. Res. Commun. 137, 468-473. 16. Ohmori,

H., and Yamamoto,

I. (1982)

L. A. (1985)

H. U. (1986)

J. Exp.

Med.

Biochem.

155, 1277-

1290. 17. Rudolph, ImmunoL

A. K., Burrows,

P. D., and Wabl,

M.

R. (1981)

Eur.

J.

11,527-529.

18. Engvall, E. (1980) in Methods in Enzymology (Van Vunakis, H., and Langone, J. J., Eds.), Vol. 70, pp. 419-439, Academic Press, San Diego. 19. Laemmli, 20. Schagger,

U. K. (1970) Nature H., and von Jagow,

227, 680-685. G. (1987) Anal.

166,368-

Biockem.

379. F. W., Rosenberg, A. H., Dunn, J. J., and Dubendorff, 21. Studier, W. (1990) in Methods in Enzymology (Goeddel, D. V., Ed.), 185, pp. 60-89, Academic Press, San Diego.

J. Vol.

22. Kanazawa, H., Tamura, F., Mabuchi, K., Miki, T., and Futai, M. (1980) Proc. Natl. Acad. Sci. USA 77, 7005-7009. H., Horiuchi, Y., Takagi, M., Ishino, Y., and Futai, M. 23. Kanazawa, (1980) J. Biochem. (Tokyo) 88,695-703. 24. Berus, K. I., and Thomas, C. A. (1965) J. Mol. Biol. 11, 476-490. 25. Saiki, R. K., Gelfand, Horn, G. T., Mullis, 487-491.

D. H., Stoffel, S., Scharf, S. J., Higuchi, R., K. B., and Erlich, H. A. (1988) Science 239,

26. Futai, M., Sternweis, P. C., and Heppel, Acad.Sci. USA 71,2725-2729. 27. Lowry, (1951)

0. H., Rosebrough, N. J., Farr, J. Biol. Chem. 193,265-275.

L. A. (1974)

Proc.

A. L., and Randall,

Natl. R. J.

28. Noumi, T., Azuma, M., Shimomura, S., Maeda, M., and Futai, M. (1987) J. Biol. Chem. 262, 14,978-14,982. B., Jarausch, J., Hartmann, R., and Merle, P. (1983) --. Kadenbach, Anal. Biochem. 129,517-521. 30. Kanazawa, H., Kayano, Biophys. Res. Commun. 31. Branden, C.-I., Eklund, EMBO J. 3, 1307-1310.

T., Kiyasu,

T., and Futai,

M. (1982)

Biochem.

105,1257-1264. H., Cambillau,

32. Ohta, S., Tomura, H., Matsuda, Chem. 263, 11,257-11,262. 33. Ohta, S., Yohda, M., Ishizuka, wara-Hamamoto, Y., Matsuda, Biophys. Acta 933, 141-155.

C., and Pryor,

K., and Kagawa,

A. J. (1984)

Y. (1988)

M., Hirata, H., Hamamoto, K., and Kagawa, Y. (1988)

J. Biol. T., OtaBiochim.

34. Krumholz, L. R., Esser, U., and Simoni, R. D. (1989) Nucleic Acids Res. 17,7993-7994. 35. Masaki, T., Nakamura, K., Isono, M., and Soejima, M. (1978) Agric. Biol. Chem. (Tokyo) 42,1443-1445. 36. Drapeau, G. R., Boily, Y., and Houmard, J. (1972) J. Biol. Chem. 247,6720-6726. 37. Oakley, B. R., Kirsch, D. R., and Morris, N. R. (1980) Anal. Biochem.

105,361-363. 38. Kyte, J., and Doolittle, R. F. (1982) J. Mol. 39. Aggeler, R., Mendel-Hartvig, J., and Capaldi, istry 29, 10,387-10,393. 40. Hori,

H., and Osawa,

S. (1987)

Mol.

Biol.

Biol. 157, 105-132. R. A. (1990) Biochem-

Euol. 4, 445-472.