JOURNAL OF VIROLOGY, JUIY 1991, p. 3475-3480
Vol. 65, No. 7
0022-538X/91/073475-06$02.00/0 Copyright © 1991, American Society for Microbiology
Mapping of a Neutralizing Antigenic Site of Coxsackievirus B4 by Construction of an Antigen Chimera BIRGIT-YVONNE REIMANN,* ROLAND ZELL, AND REINHARD KANDOLF Max-Planck-Institut fur Biochemie, D-8033 Martinsried, Federal Republic of Germany
Received 24 January 1991/Accepted 29 March 1991
A neutralizing antigenic site of coxsackievirus B4 (CVB4) was identified by construction of an antigen chimera between coxsackievirus B3 (CVB3) and CVB4. This chimera, designated CVB3/4, was constructed by inserting five amino acids of the putative BC loop of the structural protein VP1 of CVB4 into the corresponding loop of CVB3 by site-directed mutagenesis of infectious recombinant CVB3 cDNA. The chimeric cDNA was capable of inducing an infectious cycle upon transfection of permissive host cells. The resulting chimeric virus CVB3/4 was neutralized and precipitated by CVB4 and CVB3 serotype-specific polyclonal antisera, demonstrating that it unifies antigenic properties of both coxsackievirus serotypes. In addition, the chimera elicited antibodies in rabbits which were capable of neutralizing the two coxsackievirus serotypes CVB3 and CVB4. The insertion of the CVB4-specific antigenic site into the BC loop of CVB3 reduces the efficiency of viral replication, resulting in a small-plaque morphology of the virus chimera. In summary, these data give evidence for the presence of a serotype-specific neutralizing antigenic site in the BC loop of VP1 of CVB4 (amino acids 81 to 89). Our findings suggest that the construction of intertypic chimeras can be used as a tool for the identification of antigenic sites of coxsackieviruses. The retained immunogenicity of the mapped CVB4-specific antigenic epitope, when expressed in CVB3, indicates that CVB3 can be used as a RNA virus vector for heterologous antigenic sites. Coxsackieviruses are important human pathogens, causing a remarkable variety of diseases from minor common colds to fatal myocarditis and neurological disorders (1, 15, 18, 19). In particular, distinct variants of coxsackie B viruses have been associated with acute insulin-dependent diabetes mellitus (3, 8). Coxsackieviruses of the Picornaviridae family are small, nonenveloped, icosahedral viruses containing a positivesense, single-stranded RNA genome of about 7,400 nucleotides. Sixty copies of each structural protein, VP1, VP2, VP3, and VP4, constitute the viral capsid (26). Crystal structure analysis of several picornaviruses, including poliovirus (11), mengovirus (24), and rhinovirus (37), has shown that the small structural protein VP4 is located at the inside of the capsid, while distinct parts of the structural proteins VP1, VP2, and VP3 constitute the surface of the virus. VP1, VP2, and VP3 have a common structure which is characterized by a core of an eight-stranded antiparallel beta-barrel. The loops which link the beta-strands within the beta-barrel determine the antigenic features of the virus (12, 38). For poliovirus and rhinovirus it has been proven that the antigenic sites, which were localized by immuno-escape analysis, map to distinct protruding hydrophilic loops on the viral capsid (12, 28, 40). For example, the sequential antigenic site N-Ag I of poliovirus is formed by an exposed loop between beta strands B and C (BC loop) of VP1 (13, 28). Two or more loops contribute to nonsequential antigenic sites, such as antigenic site N-Ag II of poliovirus type 1 (PV1), which includes the EF loop and the carboxyl terminus of VP2 and the GH loop of VP1 (28). Furthermore, it has been demonstrated that a sequential antigenic site can be part of a nonsequential one (30, 44). Although the humoral immune response is essential for protection against picornavirus infections (10), very little is *
known about the epitopes mediating the B-cell response to coxsackieviruses. There is evidence for neutralizing antigenic sites being associated with VP2 (4) and VP1 (35), but so far no antigenic site of coxsackieviruses has been identified. The high homology in tertiary structure among the picornaviruses (38) and the degree of sequence identity of coxsackieviruses and polioviruses (21, 34) suggest that the capsid structure of coxsackieviruses is similar to the poliovirus capsid structure and that homologous loops contribute to antigenic sites. Based on this assumption, chimeras between coxsackievirus B3 (CVB3) and coxsackievirus B4 (CVB4) were constructed regarding the BC loop of VP1, which corresponds to a sequential antigenic site of poliovirus. The insertion of five amino acids of the putative BC loop of CVB4 into the corresponding loop of CVB3 resulted in a viable chimera which unifies immunological properties of both coxsackieviruses. The antigenic features and growth characteristics of this chimera are described. MATERIALS AND METHODS
Viruses and cells. The CVB3 (Nancy strain) used in this study was derived by transfection of HeLa cells with infectious recombinant CVB3 cDNA (17). CVB4 was obtained from the American Type Culture Collection (ATCC VR 184) and plaque-purified as described before (16). Viruses were propagated in HeLa cells maintained in Dulbecco's modified Eagle's minimal medium supplemented with 5% fetal bovine serum.
Construction of antigen chimeras. The location of the VP1 BC loop of CVB3 and CVB4 was predicted by a combination of amino acid and nucleic acid sequence alignments (21), secondary-structure predictions (7), and hydrophilicity calculations (22). The data obtained were interpreted in light of the resolved poliovirus structure. From these secondarystructure predictions, chimeric cDNAs were constructed by oligonucleotide-directed site-specific mutagenesis of recom-
Corresponding author. 3475
3476
J. VIROL.
REIMANN ET AL.
binant infectious CVB3 cDNA (17) by the gapped-duplex DNA approach (41). Two mutations were introduced into recombinant CVB3 cDNA, resulting in plasmids pCB3-M1/ B41 and pCB3-M1/B411. pCB3-M1/B41 was constructed by insertion of 15 CVB4-specific nucleotides into the BC loopencoding region of CVB3 cDNA (mutagenic primer 5'CAGC ATAC CG CTTCAGGTTGTTTG ATTCGGCACCTGAGT T'3). pCB3-M1/B411 was constructed by replacing the VP1 BC loop-encoding sequence of CVB3 with the corresponding sequence of CVB4 (mutagenic primer 5'CCCATTCAG
loop
B NH2 PVI
CVB3
CATACCGCTTCAGGTTGTTTGATTCGGCGCTTGAGT T'3). The structural intactness of the mutated gene region
CVB4
was confirmed by sequencing (6) nucleotides 2650 to 2850 of the viral cDNA (21), which include the mutated gene region. Transfection of cells. Transfection of permissive HeLa cells with chimeric recombinant CVB3 cDNA was done essentially as described before (17). Briefly, 10 p.g of circular, recombinant plasmid DNA was diluted in 500 jLl of HEPES (N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid)-buffered saline (137 mM NaCl, 6 mM glucose, 5 mM KCl, 0.7 mM Na2HPO4, 0.2 mM EDTA, 20 mM HEPES, adjusted to pH 7.0) and precipitated by addition of 2.5 M CaCl2 to a final concentration of 125 mM. The precipitate was incubated for at least 4 h with 8 x 105 HeLa cells, followed by treatment with 15% glycerol for 45 s. Total lysis of cells was observed within 2 to 3 days. Virus titers and plaque morphology were determined by plaque assays (16). Direct sequencing of viral genomes. The RNA sequence of viral genomes was determined by the chain termination method with avian myeloblastosis virus reverse transcriptase (9). The optimized concentrations of dideoxynucleotides for sequencing CVB3 RNA were 0.1 mM ddCTP, 0.1 mM ddGTP, 0.4 mM ddTTP, and 0.4 mM ddATP. Total RNA (15 p.g) isolated from infected HeLa cells was primed with a 32P-labeled, 5'-phosphorylated oligonucleotide complementary to nucleotides 2790 to 2811 of the viral genome (21). Sequencing reactions were performed at the optimal temperature of 51°C. Neutralization assay. Serotype-specific antisera (27) and sera obtained from immunized rabbits were tested for their ability to neutralize CVB3, CVB4, and the chimeric virus CVB3/4 in plaque reduction assays. Serial serum dilutions were incubated with 100 PFU of virus for 1 h at 37°C and then for 16 h at 4°C. After this treatment, the amount of nonneutralized virus was quantified by plaque assays. The reciprocal of the serum dilution resulting in 50% plaque reduction compared with the preimmune control serum was considered the neutralization titer of the antiserum. Immunoprecipitation. A total of 108 PFU of wild-type CVB3, CVB4, and the chimeric virus CVB3/4 was immunoprecipitated by serotype-specific antisera at 4°C overnight. The protein components of the precipitate were separated by discontinuous sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (23) and transferred onto nitrocellulose filters (42). Filters were incubated with a polyclonal rabbit antiserum which was raised against the bacterially synthesized structural protein VP1 of CVB3 (43). This antiserum has been shown to cross-react with VP1 of various enterovirus serotypes, including CVB3 and CVB4 (43). Trapped antibodies were probed with alkaline phosphataseconjugated swine anti-rabbit immunoglobulin (D-362; Dakopatts). Immunization. A total of 2 x 1010 PFU of UV-irradiated virus was emulsified in Freund's complete adjuvant and injected subcutaneously into rabbits. Equal doses resuspended in Freund's incomplete adjuvant were administered
CVB3/4
C
/OOH 96
83
RGACVTIMTVDNP ASTTNKDKL
70
RSACVYFTEYKNS
83
KR
YAEWV
SAESNNLKR
YAEWV
GA -
70
81
70
83
70
83* *****
RSACVIY--IKYS
RSACVYFTEYKNS
CVB3/411 RSACVYFTEYKNS
FAVWK
***** GAESNNLKR YAEWV
SAESNNLKR
YAEWV
FIG. 1. Amino acid sequence alignment of VP1 of PV1 (36), CVB3 (21), CVB4 (14), and the two chimeras CVB3/4 and CVB3/411 in the region of the beta-strands B and C. The resolved secondary structure of PV1 in this region is shown at the top. Amino acid positions are indicated, and amino acids which were inserted or changed by site-directed mutagenesis are marked by asterisks. Apparently the putative BC loop of CVB4 is nine amino acids long, while the corresponding loop of CVB4 is four amino acids long. This is due to five additional amino acids in the BC loop of CVB4. The viable virus chimera CVB3/4 was constructed by inserting these five amino acids (ESNNL) into the corresponding loop of CVB3. In contrast, CVB3/411 resulted in the replacement of the putative BC loop of CVB3 by all nine amino acids of the putative BC loop of CVB4. This construct is not infectious, although its amino acid sequence differs only in the exchange of glycine by serine at position 83 from that of the viable construct CVB3/4.
subcutaneously three times at 12-day intervals. Two weeks after the final boost, antisera were tested for their neutralizing activity. RESULTS Experimental outline. The strong homology in the tertiary structure of various picornaviruses suggests that the capsid structure of coxsackieviruses is similar to that of other picornaviruses and that homologous regions contribute to antigenic sites. Based on this assumption, the BC loop of VP1 is of special interest, because it contributes to a sequential antigenic site in various picornaviruses (13, 28, 40). The putative VP1 BC loop of CVB3 and CVB4 was identified by aligning the amino acid sequences of CVB3, CVB4, and PV1 (21, 34). These alignments were interpreted on the basis of the resolved poliovirus structure (11). In addition, secondary-structure predictions and hydrophilicity calculations were performed for VP1 of CVB3 and CVB4 (data not shown). A combination of both methods led to the prediction for the location of the VP1 BC loop and its flanking beta-strands in CVB3 and CVB4. As shown in Fig. 1, the two coxsackievirus serotypes show an important difference in the length of the putative BC loop of VP1. While the predicted BC loop of CVB3 spans four amino acids, the corresponding loop of CVB4 is nine amino acids long. This is due to the presence of five additional amino acids (ESNNL) in the putative BC loop of CVB4, which should mediate a CVB4-associated immune response if the BC loop contributes to an antigenic site. This hypothesis was examined by the construction of two coxsackievirus chimeras (CVB3/4 and CVB3/4II; Fig. 1) with regard to the BC loop region. Distinct peptides which
VOL. 65, 1991
COXSACKIEVIRUS B3/B4 ANTIGEN CHIMERA
3477
CVB3/4
A
T C G A
TCA
awS1 G
C A C
e
-.
a S
_
AG
S
FIG. 2. Plaque morphology of first-passage transfection-derived wild-type CVB3 (A), transfection-derived first-passage chimera CVB3/4 (B), second-passage chimera CVB3/4 (C), and third-passage chimera CVB3/4 (D). Compared with cDNA-generated wild-type CVB3 (A), the transfection-derived first-passage chimera CVB3/4 (B) exhibits a small-plaque morphology. Continued passaging of the chimera resulted in accumulation of large-plaque variants (C and D), which following plaque purification again gave rise to large plaques.
represent parts of the putative CVB4 BC loop were inserted into the corresponding region of CVB3 by site-directed mutagenesis of recombinant CVB3 cDNA (17, 21). Construction and growth characteristics of coxsackievirus chimeras. In the first mutagenesis, 15 nucleotides coding for the CVB4-specific amino acid sequence ESNNL of the VP1 BC loop of CVB4 were inserted into the BC loop-coding region of recombinant CVB3 cDNA, resulting in plasmid pCB3-M1/B4I. In a second mutagenesis, the BC loop-encoding sequence of CVB3 cDNA was replaced by the complete BC loop-encoding region of CVB4. This construct, designated pCB3-M1/B411, takes account of the fact that the putative BC loop of CVB4 starts with serine instead of glycine (Fig. 1). The infectivity of both constructs was tested by transfection of permissive HeLa cells with circular plasmid DNA. The construct pCB3-Ml/B41, which codes for the insertion of five amino acids of CVB4 into the BC loop of CVB3, was capable of inducing an infectious cycle resulting in a viable virus chimera, which was designated CVB3/4. In contrast, the construct pCB3-M1/B4II, encoding the replacement of the CVB3 BC loop by the complete putative CVB4 BC loop, was not capable of inducing an infectious cycle, although its deduced amino acid sequence differs only in a substitution of glycine by serine from the infectious construct pCB3-M1/ B41. This single amino-acid substitution at the beginning of the BC loop of VP1 (amino acid 83) appears to be lethal (five different transfection experiments with the same cDNA clone), although at present another lethal mutation within the nonsequenced gene region cannot be excluded. First-passage stocks of the transfection-derived viable
C ET T A S G T T N T G T N T G G L A C K R
T T C G C C
MP
I-3
_
_ '.
*p _
-
-
a
I_ -
a_ws
of-
-.
FIG. 3. RNA sequence of a plaque-purified large-plaque variant of the chimera CVB3/4 (fourth passage). Genomic RNA was primed with a 5'-labeled oligonucleotide complementary to nucleotides 2790 to 2811 of the CVB3 genome (21) and sequenced by the chain termination method (9). The fact that the 15 nucleotides which were inserted by site-directed mutagenesis (highlighted by boldface letters) are present in the genome demonstrates the stability of the constructed sequence. Identical sequences were determined for another five independently isolated large- and small-plaque variants.
chimera CVB3/4 exhibited a small-plaque morphology in comparison to the large-plaque morphology of wild-type cDNA-generated CVB3 (Fig. 2A and B). Interestingly, continued passaging of the chimera resulted in an accumulation of large-plaque variants (Fig. 2C and D). To exclude the possibility that the occurrence of large-plaque variants was due to mutation or reversion of the mutated gene region, the chimeric viral genome was analyzed by direct RNA sequencing. The determined RNA sequences of various plaquepurified large- and small-plaque variants of CVB3/4 were consistently identical and correspond to the RNA sequence of the fourth-passage large-plaque variant shown in Fig. 3, which comprises the 15 inserted nucleotides. In addition, no mutations were found between nucleotides 2600 and 2800, demonstrating that the inserted mutation is stable and that the occurrence of large-plaque variants is not due to reversion. Antigenicity of the chimeric virus CVB3/4. The antigenic properties of the chimera CVB3/4 were investigated in plaque reduction assays as well as in immunoprecipitation experiments with polyclonal neutralizing antisera, which
3478
REIMANN ET AL.
J. VIROL.
TABLE 1. Neutralization of the antigen chimera CVB3/4 by serotype-specific antisera" NT with antiserumb:
Virus
Anti-CVB3
CVB3/4 CVB3 CVB4
75
Anti-CVB4
26,000 30,000
500
Vol. 65, No. 7
0022-538X/91/073475-06$02.00/0 Copyright © 1991, American Society for Microbiology
Mapping of a Neutralizing Antigenic Site of Coxsackievirus B4 by Construction of an Antigen Chimera BIRGIT-YVONNE REIMANN,* ROLAND ZELL, AND REINHARD KANDOLF Max-Planck-Institut fur Biochemie, D-8033 Martinsried, Federal Republic of Germany
Received 24 January 1991/Accepted 29 March 1991
A neutralizing antigenic site of coxsackievirus B4 (CVB4) was identified by construction of an antigen chimera between coxsackievirus B3 (CVB3) and CVB4. This chimera, designated CVB3/4, was constructed by inserting five amino acids of the putative BC loop of the structural protein VP1 of CVB4 into the corresponding loop of CVB3 by site-directed mutagenesis of infectious recombinant CVB3 cDNA. The chimeric cDNA was capable of inducing an infectious cycle upon transfection of permissive host cells. The resulting chimeric virus CVB3/4 was neutralized and precipitated by CVB4 and CVB3 serotype-specific polyclonal antisera, demonstrating that it unifies antigenic properties of both coxsackievirus serotypes. In addition, the chimera elicited antibodies in rabbits which were capable of neutralizing the two coxsackievirus serotypes CVB3 and CVB4. The insertion of the CVB4-specific antigenic site into the BC loop of CVB3 reduces the efficiency of viral replication, resulting in a small-plaque morphology of the virus chimera. In summary, these data give evidence for the presence of a serotype-specific neutralizing antigenic site in the BC loop of VP1 of CVB4 (amino acids 81 to 89). Our findings suggest that the construction of intertypic chimeras can be used as a tool for the identification of antigenic sites of coxsackieviruses. The retained immunogenicity of the mapped CVB4-specific antigenic epitope, when expressed in CVB3, indicates that CVB3 can be used as a RNA virus vector for heterologous antigenic sites. Coxsackieviruses are important human pathogens, causing a remarkable variety of diseases from minor common colds to fatal myocarditis and neurological disorders (1, 15, 18, 19). In particular, distinct variants of coxsackie B viruses have been associated with acute insulin-dependent diabetes mellitus (3, 8). Coxsackieviruses of the Picornaviridae family are small, nonenveloped, icosahedral viruses containing a positivesense, single-stranded RNA genome of about 7,400 nucleotides. Sixty copies of each structural protein, VP1, VP2, VP3, and VP4, constitute the viral capsid (26). Crystal structure analysis of several picornaviruses, including poliovirus (11), mengovirus (24), and rhinovirus (37), has shown that the small structural protein VP4 is located at the inside of the capsid, while distinct parts of the structural proteins VP1, VP2, and VP3 constitute the surface of the virus. VP1, VP2, and VP3 have a common structure which is characterized by a core of an eight-stranded antiparallel beta-barrel. The loops which link the beta-strands within the beta-barrel determine the antigenic features of the virus (12, 38). For poliovirus and rhinovirus it has been proven that the antigenic sites, which were localized by immuno-escape analysis, map to distinct protruding hydrophilic loops on the viral capsid (12, 28, 40). For example, the sequential antigenic site N-Ag I of poliovirus is formed by an exposed loop between beta strands B and C (BC loop) of VP1 (13, 28). Two or more loops contribute to nonsequential antigenic sites, such as antigenic site N-Ag II of poliovirus type 1 (PV1), which includes the EF loop and the carboxyl terminus of VP2 and the GH loop of VP1 (28). Furthermore, it has been demonstrated that a sequential antigenic site can be part of a nonsequential one (30, 44). Although the humoral immune response is essential for protection against picornavirus infections (10), very little is *
known about the epitopes mediating the B-cell response to coxsackieviruses. There is evidence for neutralizing antigenic sites being associated with VP2 (4) and VP1 (35), but so far no antigenic site of coxsackieviruses has been identified. The high homology in tertiary structure among the picornaviruses (38) and the degree of sequence identity of coxsackieviruses and polioviruses (21, 34) suggest that the capsid structure of coxsackieviruses is similar to the poliovirus capsid structure and that homologous loops contribute to antigenic sites. Based on this assumption, chimeras between coxsackievirus B3 (CVB3) and coxsackievirus B4 (CVB4) were constructed regarding the BC loop of VP1, which corresponds to a sequential antigenic site of poliovirus. The insertion of five amino acids of the putative BC loop of CVB4 into the corresponding loop of CVB3 resulted in a viable chimera which unifies immunological properties of both coxsackieviruses. The antigenic features and growth characteristics of this chimera are described. MATERIALS AND METHODS
Viruses and cells. The CVB3 (Nancy strain) used in this study was derived by transfection of HeLa cells with infectious recombinant CVB3 cDNA (17). CVB4 was obtained from the American Type Culture Collection (ATCC VR 184) and plaque-purified as described before (16). Viruses were propagated in HeLa cells maintained in Dulbecco's modified Eagle's minimal medium supplemented with 5% fetal bovine serum.
Construction of antigen chimeras. The location of the VP1 BC loop of CVB3 and CVB4 was predicted by a combination of amino acid and nucleic acid sequence alignments (21), secondary-structure predictions (7), and hydrophilicity calculations (22). The data obtained were interpreted in light of the resolved poliovirus structure. From these secondarystructure predictions, chimeric cDNAs were constructed by oligonucleotide-directed site-specific mutagenesis of recom-
Corresponding author. 3475
3476
J. VIROL.
REIMANN ET AL.
binant infectious CVB3 cDNA (17) by the gapped-duplex DNA approach (41). Two mutations were introduced into recombinant CVB3 cDNA, resulting in plasmids pCB3-M1/ B41 and pCB3-M1/B411. pCB3-M1/B41 was constructed by insertion of 15 CVB4-specific nucleotides into the BC loopencoding region of CVB3 cDNA (mutagenic primer 5'CAGC ATAC CG CTTCAGGTTGTTTG ATTCGGCACCTGAGT T'3). pCB3-M1/B411 was constructed by replacing the VP1 BC loop-encoding sequence of CVB3 with the corresponding sequence of CVB4 (mutagenic primer 5'CCCATTCAG
loop
B NH2 PVI
CVB3
CATACCGCTTCAGGTTGTTTGATTCGGCGCTTGAGT T'3). The structural intactness of the mutated gene region
CVB4
was confirmed by sequencing (6) nucleotides 2650 to 2850 of the viral cDNA (21), which include the mutated gene region. Transfection of cells. Transfection of permissive HeLa cells with chimeric recombinant CVB3 cDNA was done essentially as described before (17). Briefly, 10 p.g of circular, recombinant plasmid DNA was diluted in 500 jLl of HEPES (N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid)-buffered saline (137 mM NaCl, 6 mM glucose, 5 mM KCl, 0.7 mM Na2HPO4, 0.2 mM EDTA, 20 mM HEPES, adjusted to pH 7.0) and precipitated by addition of 2.5 M CaCl2 to a final concentration of 125 mM. The precipitate was incubated for at least 4 h with 8 x 105 HeLa cells, followed by treatment with 15% glycerol for 45 s. Total lysis of cells was observed within 2 to 3 days. Virus titers and plaque morphology were determined by plaque assays (16). Direct sequencing of viral genomes. The RNA sequence of viral genomes was determined by the chain termination method with avian myeloblastosis virus reverse transcriptase (9). The optimized concentrations of dideoxynucleotides for sequencing CVB3 RNA were 0.1 mM ddCTP, 0.1 mM ddGTP, 0.4 mM ddTTP, and 0.4 mM ddATP. Total RNA (15 p.g) isolated from infected HeLa cells was primed with a 32P-labeled, 5'-phosphorylated oligonucleotide complementary to nucleotides 2790 to 2811 of the viral genome (21). Sequencing reactions were performed at the optimal temperature of 51°C. Neutralization assay. Serotype-specific antisera (27) and sera obtained from immunized rabbits were tested for their ability to neutralize CVB3, CVB4, and the chimeric virus CVB3/4 in plaque reduction assays. Serial serum dilutions were incubated with 100 PFU of virus for 1 h at 37°C and then for 16 h at 4°C. After this treatment, the amount of nonneutralized virus was quantified by plaque assays. The reciprocal of the serum dilution resulting in 50% plaque reduction compared with the preimmune control serum was considered the neutralization titer of the antiserum. Immunoprecipitation. A total of 108 PFU of wild-type CVB3, CVB4, and the chimeric virus CVB3/4 was immunoprecipitated by serotype-specific antisera at 4°C overnight. The protein components of the precipitate were separated by discontinuous sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (23) and transferred onto nitrocellulose filters (42). Filters were incubated with a polyclonal rabbit antiserum which was raised against the bacterially synthesized structural protein VP1 of CVB3 (43). This antiserum has been shown to cross-react with VP1 of various enterovirus serotypes, including CVB3 and CVB4 (43). Trapped antibodies were probed with alkaline phosphataseconjugated swine anti-rabbit immunoglobulin (D-362; Dakopatts). Immunization. A total of 2 x 1010 PFU of UV-irradiated virus was emulsified in Freund's complete adjuvant and injected subcutaneously into rabbits. Equal doses resuspended in Freund's incomplete adjuvant were administered
CVB3/4
C
/OOH 96
83
RGACVTIMTVDNP ASTTNKDKL
70
RSACVYFTEYKNS
83
KR
YAEWV
SAESNNLKR
YAEWV
GA -
70
81
70
83
70
83* *****
RSACVIY--IKYS
RSACVYFTEYKNS
CVB3/411 RSACVYFTEYKNS
FAVWK
***** GAESNNLKR YAEWV
SAESNNLKR
YAEWV
FIG. 1. Amino acid sequence alignment of VP1 of PV1 (36), CVB3 (21), CVB4 (14), and the two chimeras CVB3/4 and CVB3/411 in the region of the beta-strands B and C. The resolved secondary structure of PV1 in this region is shown at the top. Amino acid positions are indicated, and amino acids which were inserted or changed by site-directed mutagenesis are marked by asterisks. Apparently the putative BC loop of CVB4 is nine amino acids long, while the corresponding loop of CVB4 is four amino acids long. This is due to five additional amino acids in the BC loop of CVB4. The viable virus chimera CVB3/4 was constructed by inserting these five amino acids (ESNNL) into the corresponding loop of CVB3. In contrast, CVB3/411 resulted in the replacement of the putative BC loop of CVB3 by all nine amino acids of the putative BC loop of CVB4. This construct is not infectious, although its amino acid sequence differs only in the exchange of glycine by serine at position 83 from that of the viable construct CVB3/4.
subcutaneously three times at 12-day intervals. Two weeks after the final boost, antisera were tested for their neutralizing activity. RESULTS Experimental outline. The strong homology in the tertiary structure of various picornaviruses suggests that the capsid structure of coxsackieviruses is similar to that of other picornaviruses and that homologous regions contribute to antigenic sites. Based on this assumption, the BC loop of VP1 is of special interest, because it contributes to a sequential antigenic site in various picornaviruses (13, 28, 40). The putative VP1 BC loop of CVB3 and CVB4 was identified by aligning the amino acid sequences of CVB3, CVB4, and PV1 (21, 34). These alignments were interpreted on the basis of the resolved poliovirus structure (11). In addition, secondary-structure predictions and hydrophilicity calculations were performed for VP1 of CVB3 and CVB4 (data not shown). A combination of both methods led to the prediction for the location of the VP1 BC loop and its flanking beta-strands in CVB3 and CVB4. As shown in Fig. 1, the two coxsackievirus serotypes show an important difference in the length of the putative BC loop of VP1. While the predicted BC loop of CVB3 spans four amino acids, the corresponding loop of CVB4 is nine amino acids long. This is due to the presence of five additional amino acids (ESNNL) in the putative BC loop of CVB4, which should mediate a CVB4-associated immune response if the BC loop contributes to an antigenic site. This hypothesis was examined by the construction of two coxsackievirus chimeras (CVB3/4 and CVB3/4II; Fig. 1) with regard to the BC loop region. Distinct peptides which
VOL. 65, 1991
COXSACKIEVIRUS B3/B4 ANTIGEN CHIMERA
3477
CVB3/4
A
T C G A
TCA
awS1 G
C A C
e
-.
a S
_
AG
S
FIG. 2. Plaque morphology of first-passage transfection-derived wild-type CVB3 (A), transfection-derived first-passage chimera CVB3/4 (B), second-passage chimera CVB3/4 (C), and third-passage chimera CVB3/4 (D). Compared with cDNA-generated wild-type CVB3 (A), the transfection-derived first-passage chimera CVB3/4 (B) exhibits a small-plaque morphology. Continued passaging of the chimera resulted in accumulation of large-plaque variants (C and D), which following plaque purification again gave rise to large plaques.
represent parts of the putative CVB4 BC loop were inserted into the corresponding region of CVB3 by site-directed mutagenesis of recombinant CVB3 cDNA (17, 21). Construction and growth characteristics of coxsackievirus chimeras. In the first mutagenesis, 15 nucleotides coding for the CVB4-specific amino acid sequence ESNNL of the VP1 BC loop of CVB4 were inserted into the BC loop-coding region of recombinant CVB3 cDNA, resulting in plasmid pCB3-M1/B4I. In a second mutagenesis, the BC loop-encoding sequence of CVB3 cDNA was replaced by the complete BC loop-encoding region of CVB4. This construct, designated pCB3-M1/B411, takes account of the fact that the putative BC loop of CVB4 starts with serine instead of glycine (Fig. 1). The infectivity of both constructs was tested by transfection of permissive HeLa cells with circular plasmid DNA. The construct pCB3-Ml/B41, which codes for the insertion of five amino acids of CVB4 into the BC loop of CVB3, was capable of inducing an infectious cycle resulting in a viable virus chimera, which was designated CVB3/4. In contrast, the construct pCB3-M1/B4II, encoding the replacement of the CVB3 BC loop by the complete putative CVB4 BC loop, was not capable of inducing an infectious cycle, although its deduced amino acid sequence differs only in a substitution of glycine by serine from the infectious construct pCB3-M1/ B41. This single amino-acid substitution at the beginning of the BC loop of VP1 (amino acid 83) appears to be lethal (five different transfection experiments with the same cDNA clone), although at present another lethal mutation within the nonsequenced gene region cannot be excluded. First-passage stocks of the transfection-derived viable
C ET T A S G T T N T G T N T G G L A C K R
T T C G C C
MP
I-3
_
_ '.
*p _
-
-
a
I_ -
a_ws
of-
-.
FIG. 3. RNA sequence of a plaque-purified large-plaque variant of the chimera CVB3/4 (fourth passage). Genomic RNA was primed with a 5'-labeled oligonucleotide complementary to nucleotides 2790 to 2811 of the CVB3 genome (21) and sequenced by the chain termination method (9). The fact that the 15 nucleotides which were inserted by site-directed mutagenesis (highlighted by boldface letters) are present in the genome demonstrates the stability of the constructed sequence. Identical sequences were determined for another five independently isolated large- and small-plaque variants.
chimera CVB3/4 exhibited a small-plaque morphology in comparison to the large-plaque morphology of wild-type cDNA-generated CVB3 (Fig. 2A and B). Interestingly, continued passaging of the chimera resulted in an accumulation of large-plaque variants (Fig. 2C and D). To exclude the possibility that the occurrence of large-plaque variants was due to mutation or reversion of the mutated gene region, the chimeric viral genome was analyzed by direct RNA sequencing. The determined RNA sequences of various plaquepurified large- and small-plaque variants of CVB3/4 were consistently identical and correspond to the RNA sequence of the fourth-passage large-plaque variant shown in Fig. 3, which comprises the 15 inserted nucleotides. In addition, no mutations were found between nucleotides 2600 and 2800, demonstrating that the inserted mutation is stable and that the occurrence of large-plaque variants is not due to reversion. Antigenicity of the chimeric virus CVB3/4. The antigenic properties of the chimera CVB3/4 were investigated in plaque reduction assays as well as in immunoprecipitation experiments with polyclonal neutralizing antisera, which
3478
REIMANN ET AL.
J. VIROL.
TABLE 1. Neutralization of the antigen chimera CVB3/4 by serotype-specific antisera" NT with antiserumb:
Virus
Anti-CVB3
CVB3/4 CVB3 CVB4
75
Anti-CVB4
26,000 30,000
500
