Microbiol Immunol 2015; 59: 724–734 doi: 10.1111/1348-0421.12337
ORIGINAL ARTICLE
Mannan-binding lectin at supraphysiological concentrations inhibits differentiation of dendritic cells from human CD14þ monocytes Xiao-Ying Xu1, Hui-Jie Li1, Li-Yun Zhang1, Xiao Lu1, Da-Ming Zuo1, Gui-Qiu Shan2, Tian-Yu Xu1 and Zheng-Liang Chen1 1
Department of Immunology, School of Basic Medical Sciences, Southern Medical University, Guangzhou Avenue North 1838, Guangdong, China and 2Guangzhou General Hospital of Guangzhou Military Command, Liuhua Road 111, Guangzhou, Guangdong, China
ABSTRACT Mannan-binding lectin (MBL), a circulating C-type lectin, is an important member of the defense collagen family. It exhibits a high potential for recognizing broad categories of pathogen-associated molecular patterns and initiating complement cascade responses. DCs are well-known specialist antigen-presenting cells that significantly trigger specific T cell-mediated immune responses. In our previous study, it was observed that high concentrations of MBL significantly attenuate LPS-induced maturation of monocyte-derived DCs (MoDCs). In the current study, it was postulated that MBL at similar supraphysiological concentrations would affect early differentiation of MoDCs in some way. CD14þ monocytes from human peripheral blood mononuclear cells were cultured with granulocytemacrophage colony-stimulating factor and IL-4 in the presence or absence of physiological (1 mg/mL) and supraphysiological concentrations (20 mg/mL) of MBL protein, respectively. Phenotypic analysis indicated that the differentiated DCs incubated with high concentrations of MBL expressed MHC class II and costimulatory molecules (e.g., CD80 and CD40) more weakly than did control groups. The secretion of IL-10 and IL-6 increased markedly, whereas their mixed lymphocyte reaction-stimulating capacity decreased. Members of the signal transducer and activator of transcription family were also found to be differentially regulated. Thus, beyond the role of MBL as an opsonin, our data reveal a possible inhibitory effect of MBL at high concentrations in monocyte-DC transition, which probably provides one way of regulating adaptive immune responses by strict regulation of DCs, making MBL a better prospect for controlling relevant pathological events such as autoimmune diseases. Key words
concentration, dendritic cell differentiation, mannan-binding lectin, monocyte.
Mannan-binding lectin is an important member of the defense collectin family, members of which are defined as possessing an amino-terminal collagen-like domain in combination with a C-type lectin domain at carboxylterminal (1). MBL promptly initiates the lectin pathway of complement cascade responses via autoactivation of
the MBL-associated serine protease in first-line host defense against infections. Mammals that are deficient in MBL are susceptible to various diseases (2, 3). It is noteworthy that several defense collagens (e.g., surfactant proteins A and-D, and C1q) can inhibit both the differentiation and maturation of DCs (4–6). These
Correspondence Zheng-Liang Chen, Department of Immunology, School of Basic Medical Sciences, Southern Medical University, Guangzhou Avenue North 1838, Guangzhou, Guangdong, China. Tel/Fax:þ86 02 06164 8477; email: [email protected] Received 4 August 2015; revised 31 October 2015; accepted 4 November 2015. List of Abbreviations: BCL-2, B cell lymphoma-2; DC, FCM, flow cytometry; GI, GM-CSF and IL-4; GM-CSF, granulocyte-macrophage colonystimulating factor; HSA, human serum albumin; MBL, mannan-binding lectin; MoDC, monocyte-derived DC; STAT, signal transducer and activator of transcription.
724
© 2015 The Societies and Wiley Publishing Asia Pty Ltd
Inhibition of DC differentiation by MBL
findings provide extensive information on how innate immune proteins can influence adaptive immune responses. In particular, MBL can alter cytokine production by monocytes (7) and facilitate clearance of atherogenic lipoproteins by monocytes and macrophages, functions that are highly desirable for clinical immunotherapy (8). Dendritic cells are widely recognized as the most potent professional cells for antigen-presentation (9), serving as crucial activators or regulators of immune responses (10, 11). In contrast to their lymphoid counterparts, myeloid DCs are required for adaptive immune responses because they can trigger rapid and appropriate T cell-induced immunity. Given their limited life span and the lack of specific lineage markers for isolating DCs, various studies have attempted to characterize and propagate DCs ex vivo over the past three decades (11–13). Because DCs have high phenotypic heterogeneity at different stages, leading to differently orchestrated immune responses (14), it is possible to manipulate immunity by regulating the development of DCs. Mannan-binding lectin can bind to both monocytes and DCs. MacDonald et al. were the first to evaluate the influence of MBL on monocyte-to-DC differentiation by using a wide range of physiological concentrations (up to 5000 ng/mL) (15). They found that MBL has no direct influence on cell surface antigen expression or cytokine secretion. However, MBL-exposed DCs exert a proinflammatory effect on T cells. This study demonstrated that MBL can influence cellular immunity and function as an opsonin. Different concentrations may lead to opposing proinflammatory and anti-inflammatory effects of MBL. We have shown that physiological concentrations of MBL have no effect on LPS-induced maturation of MoDCs; however, MBL does have an inhibitory action at considerably high concentrations (10–20 mg/mL) (16). Therefore, MBL at supraphysiological levels counters the effect on LPS-induced maturation of DCs at physiological levels. Later, our laboratory demonstrated that MBL affects monocytes slightly at physiological concentrations and inhibits monocyte proliferation at high concentrations (8–20 mg/mL) (17). However, the effects of natural plasma MBL at high concentrations during early-stage differentiation of MoDCs remain poorly understood. Given the abovementioned concentration-dependent effects, we aimed to determine whether the effects of very high concentrations of MBL are also opposite to those of physiological concentrations of MBL on MoDC differentiation. We demonstrated that MBL at 20 mg/mL, but not in physiological concentrations, markedly downregulates the expression of MHC class II and © 2015 The Societies and Wiley Publishing Asia Pty Ltd
co-stimulatory molecules on MoDC. When cytokine secretions were altered, MBL-treated MoDCs were suppressive in both allogeneic mixed lymphocyte reactions and na€ıve T lymphocyte stimulation. STAT molecules were also found to be involved in MBLregulated MoDC differentiation.
MATERIALS AND METHODS Preparation of MBL Mannan-binding lectin was isolated as reported previously (17), primarily by affinity chromatography from pooled freezing human plasma on a mannan-agarose column (Sigma–Aldrich, St. Louis, MO, USA). Anionexchange chromatography was subsequently performed for further purification using a Mono-Q HR 5/5 column (Pharmacia Biotech Europe, Orsay, France). Given the biases in measurement that could result from the potential block of differentiation of CD14þ monocytes by contamination with endotoxin (LPS), residual endotoxin in the purified MBL was removed using Detoxi-Gel Endotoxin Removing Columns (Pierce, Rockford, IL, USA). The endotoxin concentration was evaluated at 95% and they had high viability (>98%), as determined by Trypan blue exclusion. Monocytes were subsequently seeded in 24well tissue culture plate (Nunc, Kamstrup, Roskilde, Denmark) at a density of 1 106/mL, using RPMI 1640 containing 10% (v/v) heat-inactivated FCS (Gibco BRL, Grand Island, CA, USA). The cultures were allocated to four groups: occasional MBL (0, 1 and 20 mg/mL) and HSA (20 mg/mL) or continuous supplementation with 40 ng/mL recombinant human GM-CSF and IL-4 (GI) (PeproTech, Rocky Hill, NJ, USA). Half of the medium was changed with GI every 3 days; additionally, MBL or HSA were added where indicated at equal concentrations to those used initially. Ethical approval for this study was granted by the Medical Ethics Committee of 725
X.Y. Xu et al.
Guangzhou General Hospital of Guangzhou Military Command.
Table 1. List of the sequences of primers for RT-PCR
Analysis of MBL-binding activity to monocytes
TNF-a
FP RP
21 21
GGGACCTCTCTCTAATCAGCC TGGCCCTTGAAGAGGACCTGG
For the binding test, purified monocytes were incubated with Tris-buffered saline (1% BSA, pH 7.4). MBL (20 mg/mL) labeled with FITC isomer 1 (Sigma, Poole, UK) was added to this system. Cells were harvested after 30 min for evaluation of binding by mean fluorescence intensity calculated by FCM. The group that was incubated with FITC-HSA was set as a parallel control. In addition, two additional groups were cultured under the same conditions except for the addition of 1 or 5 mM CaCl2 to assess Ca2þ-dependence.
IL-1a
FP RP
21 21
GCCATCGCCAATGACTCAGAG ATGTAATGCAGCAGCCGTGAG
IL-1b
FP RP
21 21
ATGCTGGTTCCCTGCCCACAG TTTTGCTGTGAGTCCCGGAGC
IL-6
FP RP
20 20
AAGCAGCAAAGAGGCACTGG CTGCACAGCTCTGGCTTGTT
IL-10
FP RP
21 21
AAGGCGCATGTGAACTCCCTG GCTCCACGGCCTTGCTCTTGT
IL-12 (p40)
FP RP
18 17
TGCCCATTCGCTCCAAGA CGGTCATCTGCCGCAAA
GAPDH
FP RP
22 21
CTCCTCCTGTTCGACAGTCAGC CCCAATACGACCAAATCCGTT
Genes
Multiparameter FCM Expression of cell surface molecules was analyzed by FCM on Days 2 and 6 of culture. MoDCs were washed with PBS containing 1% BSA and 0.02% NaN3 and then stained with the following monoclonal antibodies: FITC isomer 1-conjugated anti-human CD14, anti-CD83, anti-CD40 and anti-HLA-DR antibodies; allophycocyanin-conjugated anti-human CD3 (e-Biosciences, San Diego, CA, USA); and phycoerythrin-conjugated antihuman CD1a, anti-CD86, anti-CD11b and anti-CD80 antibodies (BD Biosciences, San Jose, CA, USA). Corresponding isotype mouse IgG (e-Biosciences, San Diego, CA, USA) was also used. Forward/side scatter was first set for primary gating cells of interest followed by further definition using antigen-specific fluorescent labeling using FCM. Apoptosis test To analyze apoptosis, MoDCs were harvested for splicing to conduct Trypan blue staining after being cultured for 6 days. In parallel, cells were bi-labeled with Annexin V and propidium iodide using an Annexin V-FITC Apoptosis Detection Kit (KeyGen Biotech, Nanjing, China) according to the manufacturer's instructions. Subsequently, the percentage of apoptotic cells in each group was evaluated by FCM. Analysis of gene expression Total RNA was extracted from MoDC using Trizol reagent (Invitrogen, Carlsbad, CA, US) according to the manufacturer's instructions. RT-PCR was performed using a RevertAid First Strand cDNA Synthesis Kit (Fermentas, Glen Bumie, MD, USA). Primers (Table 1) were designed to evaluate expressions of TNF-a, IL-1a, 726
Length (bp)
Sequences (50 to30 )
FP, forward primer; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; RP, reversed primer
IL-1b, IL-6, IL-10, and IL-12 (p40). RT-PCR was conducted in a Rotor-Gene 6000 real-time PCR detection system (Qiagen, Hilden, Germany) with 20 mL reaction volume containing a mixture of cDNA, specific primers, and SYBR Green Master Mix (Takara, Otsu, Shiga, Japan). The fold changes in gene expression were quantified relative to the expression of glyceraldehyde-3-phosphate dehydrogenase. Normalization was calculated using the standard 2(DDCT) method on the basis of the gene expression of the GI control group. Analysis of cytokines in culture supernatants Supernatants of MoDC cultures were collected on Day 6 and then measured by ELISA for the expression of TNF-a, IL-1a, IL-1b, IL-6, IL-10, and IL-12 (p40). ELISA was also performed to quantify the secretion of IFN-g by T cells immediately after coculture with MoDC or after restimulation by immobilized anti-CD3 and anti-CD28 monoclonal antibodies (e-Biosciences, San Diego, CA, USA) according to the manufacturer's instructions. T cell allostimulation assay Peripheral blood mononuclear cells were isolated as described above and T lymphocytes purified (>95% CD3þ) from them by magnetic-activated cell sorting using a Pan T Cell Isolation Kit (Miltenyi Biotec GmbH, © 2015 The Societies and Wiley Publishing Asia Pty Ltd
Inhibition of DC differentiation by MBL
Bergisch Gladbach, Germany). T cells were then cultured in 96-well culture plates at a density of 5 105/mL with MoDCs that had been harvested and treated with mitomycin-C (25 mg/mL) on Day 6 prior to coculture. MoDCs and allogeneic T cells (1 106/mL) were cocultured in a complete RPMI 1640 medium (10% FBS) at serial ratios of 1:5, 1:10, 1:20 and 1:100. After 4 days, T cell proliferation was quantified with a Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan) during the last 4 hr. Mean absorbance values of triplicate wells were measured at 450 nm by using an enzyme mark instrument. Alternatively, CD45RAþ na€ıve T lymphocytes were purified (>95%) by negative sorting using a Na€ıve Pan T cell Isolation Kit (Miltenyi Biotec GmbH, Bergisch Gladbach, Germany) as described above. After 4 days of coculture with MoDCs, na€ıve T cells were restimulated with immobilized antiCD3 (2.5 mg/mL) and anti-CD28 monoclonal antibodies (1 mg/mL) for 8 hr and examined for their proliferation and IFN-g production. Western blotting Monocyte-derived DCs were collected on Days 2 and 6 and then lysed using ice-cold sample buffer (0.12 M Tris–HCl, pH 6.8; 20% glycerol, 6% SDS, 0.2% bromophenol blue, and 5% 2-mercaptoethanol; 1 mM phenylmethylsulfonyl fluoride) followed by quantification with a bicinchoninic acid assay (Santa Cruz, San Diego, CA, USA). Prepared lysates (50 mg) were resolved by 10% SDS-PAGE and transferred onto polyvinylidene difluoride membranes (Millipore, Bedford, MA, USA). The membranes were then blocked using 5% BSA containing 0.1% Tween-20 for 1 hr at 37°C to prevent non-specific binding, after which they were probed overnight with primary polyclonal antibodies against human BCL-2, p-STAT3, STAT3, p-STAT5, STAT5, p-STAT6, STAT6, PU.1, Jak2 and b-actin (CST, Beverly, MA, USA; 1:1000 dilution) at 4°C. The membranes were subsequently incubated with HRP-conjugated goat antimouse IgG (Santa Cruz; 1:1000 dilution) at room temperature for 2 hr. Enhanced chemiluminescence reagents (Thermo Fisher Scientific, Fremont, CA, USA) were used to detect the bands of phosphorylated proteins. Protein expression was quantified using Quantity One software. Statistical analysis One-way anova was performed to test homogeneity of variance. Student's t-test was used to analyze the two groups, and multiple comparisons were accomplished by Bonferroni correction test or Dunnett T3's test by using SPSS 13.0 for Windows (SPSS, Chicago, IL, USA). Data © 2015 The Societies and Wiley Publishing Asia Pty Ltd
are presented as the mean SD. P < 0.05 was considered statistically significant.
RESULTS MBL binds to monocytes directly Mannan-binding lectin can bind to several autologous cell types, including B lymphocytes, monocytes, macrophages and DCs. Binding via both the collagen-like region and the carbohydrate-recognition domain of MBL has been demonstrated (18, 19). Circulating MBL generally forms a complex with MBL-associated serine protease, which impedes purification. To confirm that MBL binds to monocytes, highly purified plasma MBL was produced from human sera (Fig. 1a). Compared with biotinylated HAS, biotinylated MBL protein was found to bind specifically to human monocytes (Fig. 1b). The binding was significantly enhanced by adding Ca2þ. Markedly increased binding was observed in cultures with both 1 and 5 mM of CaCl2. As Ca2þ concentration increased, binding intensity became suboptimal at 1 mM and highly promoted at 5 mM (Fig. 1b). This observation is consistent with the reported Ca2þ-dependence of MBL–monocyte interaction (18). MBL regulated phenotype of MoDC To confirm the effect of MBL on DC phenotype, FCM was performed on Days 2 and 6 of culture with GI medium in the presence of 0, 1 and 20 mg/mL MBL. Cells with the CD1aþ/CD14/dim profile are reportedly generally obtained from cultures using the GI recipe, even at low concentrations of MBL (20). However, in the present study considerably negative-regulated CD1a was observed on MoDCs treated with high concentrations of MBL (20 mg/mL), whereas the percentage of CD1aCD14þ cells was two- to five-fold higher (P < 0.01). Enhanced expression of CD14 was thus sustained throughout the 6 days of culture (Fig. 2). Compared with the control groups, no apparent effect was found in the group treated with MBL at physiological concentrations. Nevertheless, as shown in Figure 3, with MoDCs treated with high concentrations of MBL, mean fluorescence intensity of HLA-DR (MHC II molecule) decreased to almost half of that in the control groups. CD86 expression seemed to remain the same regardless of MBL addition. However, expression of other co-stimulatory and maturation associated molecules, such as CD80 and CD40, decreased sharply. In particular, enhanced expression of CD11b was observed. Also, no changes were evident in the cells treated with lower concentrations of MBL. 727
X.Y. Xu et al.
Fig. 1. Purification and binding of MBL to monocytes. (a) SDS-PAGE and western blot data showing that highly purified plasma MBL protein is mainly in the form of multimers containing fewer dimer chains. (b) Binding of fresh isolated monocytes and biotinylated MBL (20 mg/mL) in Ca2þ-free medium was assessed. The binding intensity obviously increased with increasing concentrations of Ca2þ from 1 to 5 mM. Representative data are from three independent experiments. Values are shown as mean S.D. Bonferroni correction test was used for multiple comparisons ( , P < 0.01).
Regulation by MBL of MoDC differentiation is irrelevant to apoptosis Because the expression of specific surface antigen molecules was markedly reduced, whether the changes resulted from induction of cytotoxicity and/or apoptosis by high concentrations of MBL was subsequently determined. As determined by Trypan blue staining, the viability of MBL (20 mg/mL)-treated MoDCs changed
slightly (P > 0.05) (Fig. 4a). FCM results also indicated a low apoptotic rate in both MBL- and HSA-treated MoDCs. In addition, there were no significant differences between the two groups, as shown by propidium iodide and Annexin-V double staining (P ¼ 0.082) (Fig. 4b). To confirm these findings, expression of BCL-2 was also evaluated; no perceptible changes were found. These findings indicate that inclusion of MBL is unlikely to induce cell apoptosis (Fig. 4c).
Fig. 2. MBL induces generation of CD1a-CD14+ cells. A population with particularly weaker expression of CD1a and sustained expression of CD14 was identified on Days 2 and 6 in GI medium with added MBL at high concentrations (20 mg/mL). Similar data were obtained from three independent experiments. Results are was presented as the mean S.D. , P < 0.01 as compared with cells cultured in GI medium alone. d, day.
728
© 2015 The Societies and Wiley Publishing Asia Pty Ltd
Inhibition of DC differentiation by MBL
Fig. 3. Altered surface markers on MBL-treated MoDCs. As MoDCs matured, high concentrations of MBL downregulated expression of HLADR (MHC II molecule), CD80 and CD40, whereas that of CD11b was enhanced on both Days 2 and 6 of culture. The grey peak of each diagram represents the specific isotype antibody. Results are presented as mean S.D. Representative results from three independent experiments are shown. , P < 0.05; , P < 0.01; , P < 0.001 compared with cells cultured in GI medium alone. d, day.
Fig. 4. Effects of MBL (20 mg/mL) on apoptosis of MoDC. (a) Apoptotic cells were counted under phase contrast microscopy after Trypan blue staining; o lack of effect on viability of MBL-treated MoDCs is shown. (b) No detectable differences between MBL-treated MoDCs and those cultured in GI medium were observed using PI/annexin V double staining assay. (c) Expression of BCL-2 did not change relative to internal control of b-actin. Results are representative of three independent experiments. , P < 0.01 as compared with cells cultured in GI medium alone.
© 2015 The Societies and Wiley Publishing Asia Pty Ltd
729
X.Y. Xu et al.
MBL facilitates IL-10 and IL-6 production by MoDCs Next, whether MBL-treated MoDCs have altered cytokine profiles was examined. After a culture period of 6 days, the supernatants were collected for ELISA analysis and the MoDCs harvested for RT-PCR analysis. In the high-concentration group, MBL treatment induced accumulated expression of IL-10, which was 2.5 fold higher than that of the control group at the gene level (P ¼ 0.001). IL-6 was also significantly increased. However, other proinflammatory cytokines, including IL-a, IL-1b, TNF-a and IL-12, showed no variations between groups (Fig. 5a). Similar results concerning cytokine secretion were determined by ELISA (Fig. 5b). The combined data suggest that supraphysiological concentrations of MBL can especially impair the potency of MoDCs in initiating innate immune responses by skewing the amounts of regulatory and proinflammatory cytokines. MBL-treated MoDCs inhibit proliferation and IFN-g secretion by allogeneic T cells Activation of T cell-mediated immunity is one of the key functions of DC. To this end, proliferation of and cytokine production by allogeneic CD3þ T cells were monitored after coculture with MoDCs. Proliferation of T cells was significantly reduced when stimulated by MoDCs treated with high concentrations of MBL, as shown in Figure 6a. This finding is consistent with impaired expression of important surface molecules, which results in diminished ability of MBL-treated MoDCs to present antigens and pass activation signals. Meanwhile, profound T cell proliferation was observed in the group treated with MBL at physiological
concentrations. Production of IFN-g also appeared to be inhibited when allogeneic T cells were cocultured with MoDCs treated with high concentrations of MBL, allowing MBL to impair subsequent Th1 immunity. The ability of MBL-treated MoDCs to stimulate na€ıve T cells was accordingly analyzed. Similarly, CD45RAþ T cells were cocultured with MoDCs that had been precultured under distinct conditions. After 4 days, T cells were restimulated by both anti-CD3 and anti-CD28. The average degree of proliferation of na€ıve T cells cocultured with MBL (20 mg/mL but not 1 mg/mL)treated MoDCs was also lower and they released less IFN-g (Fig. 6b). Differentially regulated STAT signaling pathways are involved in MoDCs treated with high concentrations of MBL Collections of cellular molecules were identified during signaling monocyte differentiation mediated by the IL-10 and IL-6 family of cytokines, such as the STAT family. These molecules are involved in cell survival, expansion and differentiation via transducing intracellular signals. Functional experiments demonstrated slight influences of physiological concentrations of MBL on MoDC differentiation; thus, the degree of expression of STAT3, STAT5 and STAT6 with MoDCs treated with high concentrations of MBL was selectively checked. In contrast to controls, MBL-treated MoDCs exhibited markedly accumulated amounts of tyrosinephosphorylated STAT3. In particular, the most intensive relative expression was found on Day 2 (Fig. 7a). Activation of STAT5 is crucial to GM-CSF-dependent myeloid lineage cell development. The finding of sustained phosphorylation of STAT5 in all groups supports its important role in DC differentiation and
Fig. 5. Identification of cytokine profile of MBL-treated MoDCs. (a) In contrast to cultures without MBL, RT-PCR showed that IL-10 and IL-6 were stimulated by high concentrations of MBL-treated MoDCs, whereas expression of other proinflammatory cytokines remained at basal levels. (b) Estimation of cytokine secretion by ELISA. Results from three independent experiments are presented as the mean S.D. , P < 0.01; , P < 0.001 as compared with cells cultured in GI medium alone.
730
© 2015 The Societies and Wiley Publishing Asia Pty Ltd
Inhibition of DC differentiation by MBL
Fig. 6. Proliferation of and IFN-g production by allogeneic T lymphocytes with stimulation of MoDCs. (a) MoDCs treated with high concentrations of MBL are less active in simulating T cell proliferation and IFN-g production. (b) MoDCs treated with high concentrations of MBL suppress activation of CD45RAþ na€ıve T cells re-stimulated by soluble anti-CD3 and anti-CD28. X-axis indicates the ratio of amount of MoDCs to T cells. Representative data are shown as the mean S.D from three independent experiments. , P < 0.05; , P < 0.01 as compared with cells cultured in GI medium alone.
survival. Nevertheless, in the MBL-treated group, phosphorylation of both STAT5 and Jak2 decreased significantly (Figs. 7a, 7b). The data from Days 2 and 6 suggest that this inhibition was constantly retained (MBL was present throughout the duration of culture). Markedly increased expression of downstream PU.1 was also indicated (Fig. 7b). Therefore, the putative break of GM-CSF signaling may be partially mediated by interference in the STAT5-PU.1 path. Besides, no difference in the expression of STAT6 was observed. In this study, lLow phosphorylation was found among all groups.
DISCUSSION We found that MBL at supraphysiological concentrations affects early-stage DC differentiation ex vivo, resulting in altered phenotypes and functions. A previous study by MacDonald et al. demonstrated that rhMBL has no direct influence on DC differentiation (15). With the aim of maintaining protein conformation and biological activity, we used naturally purified MBL protein in the current study. To collect cells more accurately, we also varied the culture © 2015 The Societies and Wiley Publishing Asia Pty Ltd
conditions, including the approach to monocyte isolation. Regardless of the differences in conditions, we obtained similar negligible changes in DC phenotypes after exposure to MBL at physiological concentrations. However, we further tested the influences of MBL at supraphysiological concentrations. Among healthy individuals, MBL plasma concentrations range from 5 to 10000 ng/mL (21), increasing up to three-fold during acute phase responses. Therefore, supraphysiological concentration may be reached under certain clinical conditions and most likely in some individuals with wild-type MBL genotypes. Our group has shown that only high concentrations inhibit LPS-induced DC maturation and secretion of proinflammatory cytokines (16). Therefore, we presumed that, under inflammatory conditions, the inhibitory effects of supraphysiological MBL concentrations on DC differentiation also function as a negative immunoregulatory mechanism by limiting monocyte–DC transition and concomitant T-cell immune responses. Impaired monocyte–DC transition was initially noticed because of the occurrence of a cell population that retained a monocyte-like phenotype. Early in 1994, CD1aþCD14 immature DCs generated by GI culture 731
X.Y. Xu et al.
Fig. 7. The effects of MBL (20 mg/mL) on expression of signal molecules associated with MoDC development. (a) Phosphorylation of STAT3, STAT5 and STAT6 are differently regulated by MBL. The expression intensities were normalized by comparing to their total proteins individually. (b) Compared with internal controls, expression of PU.1 and inhibition of Jak2 is enhanced by MBL-treated MoDCs. b-actin was set to confirm equal protein loading for all western blot tests. Data are shown as mean S.D for one representative experiment out of three independent measurements from different donors. , P < 0.05; , P < 0.01; , P < 0.001 as compared with cells cultured in GI medium alone. d, day.
732
© 2015 The Societies and Wiley Publishing Asia Pty Ltd
Inhibition of DC differentiation by MBL
were reported (22). By contrast, the occurrence of up to 30% of MoDCs expressing CD14 and dim CD1a in the present study suggests that expression and/or translation of both genes deviates when they are incubated with MBL at supraphysiological concentrations. A similar phenomenon has been observed when IL-10 was added at the initiation of culture (23), which possibly explains the mechanism by which MBL affects differentiation (as discussed below). Our group has previously documented the arrest of monocytes in the G0/G1 phase of a cell cycle by MBL treatment (17). Cell apoptosis was one of the effects of the interaction between monocytes and MBL in that study. However, in this study it was not the factor leading to inhibited induction of MBL-treated MoDC. Therefore, MBL acts distinctly on myeloid lineage cells. After exposure to C1q, monocytes fail to downregulate their typical markers, such as CD14 and CD16, and upregulate co-stimulatory molecules in GI medium (24). Similarly, rather low expression of co-stimulatory molecules, indicating maturing DCs, was observed with MoDCs treated with high concentrations of MBL. The subsequent inefficient activation of allogeneic T cells may be attributable to this phenomenon. The defense collagen family of proteins has long been known to modulate cytokine production by myeloid cells (7, 25). Under inflammatory conditions, MBL increases secretion of IL-10, IL-6, IL-1 receptor antagonist and monocyte chemoattractant protein-1 of peripheral blood mononuclear cells (7). In particular, IL-10 can limit excess immunity by hampering the generation and function of DCs. Silvia et al. have reported the limited spontaneous maturation of DC resulting from endogenous IL-10, even in low concentrations. Therefore, production of IL-12 and TNF-a, Ag presentation, and Th1 responses are negatively regulated (26). In the current study, promotion of autocrine IL-10 enabled MBL to potentially skew the balance of Th1/Th2 responses indirectly. This immunosuppressive property of MBL-treated MoDCs probably also results from the autocrine effect of IL-6: IL-6 is proinflammatory in some cases but regulates myeloid lineage cell responses during infections (27). It is also reciprocal with the production of IL-10 when MoDC generation and differentiation is prevented (23, 28). Identification of the intracellular molecules involved in MBL-modified MoDC differentiation is vital. Previous studies have suggested activation of STAT3 in cells with tolerogenic phenotype, including the IL-10 signalinvolved negative regulation of DC activation (29, 30). A DC-specific STAT3 knockout study reported that STAT3 possibly dominates the path of autocrine IL10 (31). The present study suggests the involvement of STAT3 activation at high concentrations of MBL© 2015 The Societies and Wiley Publishing Asia Pty Ltd
mediated autocrine of IL-10. Given the share of the critical region determining STAT3 recruitment between the receptors of IL-10 and IL-6 (32), we reasoned that, although not as intensive as that of IL-10, secretion of IL-6 shown in this study probably participated in activating STAT3. In addition, another seemingly controversial result obtained in this study is the Jak2independent expression of STAT3 and STAT6 with respect to the completed Jak2-deficient model (33). Thus, the compensatory effects from other redundant signal molecules require further investigation. The precise control of STAT5 activity in determining the development of CD34þ hematopoietic progenitorderived DCs at distinct stages has previously been described (34); this directly relates to the expression of CD1a. In this context, the sustained expression of STAT5 confirms its key role in GM-CSF-driven induction. The enhanced expression of PU.1, the downstream transcriptional factor of STAT5, is also comparable to previously reported findings. Expression of CD11b was thus upregulated because CD11b is transcriptionally regulated via the effective binding of PU.1 to its specific promoter site (35). In summary, the present study has revealed an inhibitory action of MBL at supraphysiological concentrations (20 mg/mL) on MoDC differentiation. Given the immense medical significance of DCs, this study contributes to knowledge about the indirect regulation of adaptive immunity by MBL; however, the influence of MBL—especially during the acute phase—at the inflammatory site needs further investigation. Likewise, this study may elucidate potential DC-based therapy (MBL supplemented) for controlling autoimmune diseases or allograft rejection by limiting exaggerated inflammatory responses.
ACKNOWLEDGEMENTS This study was granted by the National Natural Science Foundation of China (Grant no. 30972679). We would like to thank Guangzhou General Hospital of Guangzhou Military Area Command of Chinese PLA, China for the free supply of human blood cells and plasma.
DISCLOSURE The authors declare that they do not have any conflicts of interest to disclose.
REFERENCES 1. Kilpatrick D.C. (2002) Mannan-binding lectin and its role in innate immunity. Transfus Med 12: 335–52.
733
X.Y. Xu et al.
2. Kilpatrick D.C. (2002) Mannan-binding lectin: clinical significance and applications. Biochim Biophys Acta 1572: 401–13. 3. Stuart L.M., Takahashi K., Shi L., Savill J., Ezekowitz R.A. (2005) Mannose-binding lectin-deficient mice display defective apoptotic cell clearance but no autoimmune phenotype. J Immunol 174: 3220–6. 4. Brinker K.G., Garner H., Wright J.R. (2003) Surfactant protein A modulates the differentiation of murine bone marrow-derived dendritic cells. Am J Physiol Lung Cell Mol Physiol 284: L232–41. 5. Brinker K.G., Martin E., Borron P., Mostaghel E., Doyle C., Harding C.V., Wright J.R. (2001) Surfactant protein D enhances bacterial antigen presentation by bone marrow-derived dendritic cells. Am J Physiol Lung Cell Mol Physiol 281: L1453–63. 6. Castellano G., Woltman A.M., Schlagwein N., Xu W., Schena F.P., Daha M.R., Van Kooten C. (2007) Immune modulation of human dendritic cells by complement. Eur J Immunol 37: 2803–11. 7. Fraser D.A., Bohlson S.S., Jasinskiene N., Rawal N., Palmarini G., Ruiz S., Rochford R., Tenner A.J. (2006) C1q and MBL, components of the innate immune system, influence monocyte cytokine expression. J Leukoc Biol 80: 107–16. 8. Fraser D.A., Tenner A.J. (2010) Innate immune proteins C1q and mannan-binding lectin enhance clearance of atherogenic lipoproteins by human monocytes and macrophages. J Immunol 185: 3932–9. 9. Steinman R.M. (1991) The dendritic cell system and its role in immunogenicity. Annu Rev Immunol 9: 271–96. 10. Sato K., Fujita S. (2007) Dendritic cells: Nature and classification. Allergol Int 56: 183–91. 11. Banchereau J., Steinman R.M. (1998) Dendritic cells and the control of immunity. Nature 392: 245–52. 12. Steinman R.M. (2012) Decisions about dendritic cells: Past, present, and future. Annu Rev Immunol 30: 1–22. 13. Santiago-Schwarz F. (1999) Positive and negative regulation of the myeloid dendritic cell lineage. J Leukoc Biol 66: 209–16. 14. Merad M., Sathe P., Helft J., Miller J., Mortha A. (2013) The dendritic cell lineage: Ontogeny and function of dendritic cells and their subsets in the steady state and the inflamed setting. Annu Rev Immunol 31: 563–604. 15. Macdonald S.L., Downing I., Atkinson A.P., Gallagher R.C., Turner M.L., Kilpatrick D.C. (2010) Dendritic cells previously exposed to mannan-binding lectin enhance cytokine production in allogeneic mononuclear cell cultures. Hum Immunol 71: 1077–83. 16. Wang M., Zhang Y., Chen Y., Zhang L., Lu X., Chen Z. (2011) Mannan-binding lectin regulates dendritic cell maturation and cytokine production induced by lipopolysaccharide. BMC Immunol 12: 1. 17. Wang Y., Chen A.D., Lei Y.M., Shan G.Q., Zhang L.Y., Lu X., Chen Z.L. (2013) Mannose-binding lectin inhibits monocyte proliferation through transforming growth factor-beta1 and p38 signaling pathways. PLoS ONE 8: e72505. 18. Downing I., Macdonald S.L., Turner M.L., Kilpatrick D.C. (2005) Detection of an autologous ligand for mannan-binding lectin on human B lymphocytes. Scand J Immunol 62: 507–14. 19. Ogden C.A., Decathelineau A., Hoffmann P.R., Bratton D., Ghebrehiwet B., Fadok V.A., Henson P.M. (2001) C1q and mannose binding lectin engagement of cell surface calreticulin and CD91 initiates macropinocytosis and uptake of apoptotic cells. J Exp Med 194: 781–95. 20. Sallusto F., Lanzavecchia, A. (1994) Efficient presentation of soluble antigen by cultured human dendritic cells is maintained
734
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha. J Exp Med 179: 1109–18. Petersen K.A., Matthiesen F., Agger T., Kongerslev L., Thiel S., Cornelissen K., Axelsen M. (2006) Phase I safety, tolerability, and pharmacokinetic study of recombinant human mannanbinding lectin. J Clin Immunol 26: 465–75. Romani N., Gruner S., Brang D., Kampgen E., Lenz A., Trockenbacher B., Konwalinka G., Fritsch P.O., Steinman R.M., Schuler G. (1994) Proliferating dendritic cell progenitors in human blood. J Exp Med 180: 83–93. Buelens C., Verhasselt V., De Groote D., Thielemans K., Goldman M., Willems F. (1997) Interleukin-10 prevents the generation of dendritic cells from human peripheral blood mononuclear cells cultured with interleukin-4 and granulocyte/ macrophage-colony-stimulating factor. Eur J Immunol 27: 756–62. Hosszu K.K., Santiago-Schwarz F., Peerschke E.I., Ghebrehiwet B. (2010) Evidence that a C1q/C1qR system regulates monocyte-derived dendritic cell differentiation at the interface of innate and acquired immunity. Innate Immun 16: 115–27. Zhang R., Becnel L., Li M., Chen C., Yao Q. (2006) C-reactive protein impairs human CD14þ monocyte-derived dendritic cell differentiation, maturation and function. Eur J Immunol 36: 2993–3006. Corinti S., Albanesi C., La Sala A., Pastore S., Girolomoni G. (2001) Regulatory activity of autocrine IL-10 on dendritic cell functions. J Immunol 166: 4312–18. Nagabhushanam V., Solache A., Ting L.M., Escaron C.J., Zhang J.Y., Ernst J.D. (2003) Innate inhibition of adaptive immunity: Mycobacterium tuberculosis-induced IL-6 inhibits macrophage responses to IFN-gamma. J Immunol 171: 4750–7. Hegde S., Pahne J., Smola-Hess S. (2004) Novel immunosuppressive properties of interleukin-6 in dendritic cells: Inhibition of NF-kappaB binding activity and CCR7 expression. FASEB J 18: 1439–41. Moore K.W., De Waal Malefyt R., Coffman R.L., O'garra A. (2001) Interleukin-10 and the interleukin-10 receptor. Annu Rev Immunol 19: 683–765. Wolfle S.J., Strebovsky J., Bartz H., Sahr A., Arnold C., Kaiser C., Dalpke A.H., Heeg K. (2011) PD-L1 expression on tolerogenic APCs is controlled by STAT-3. Eur J Immunol 41: 413–24. Melillo J.A., Song L., Bhagat G., Blazquez A.B., Plumlee C.R., Lee C., Berin C., Reizis B., Schindler C. (2010) Dendritic cell (DC)-specific targeting reveals Stat3 as a negative regulator of DC function. J Immunol 184: 2638–45. Riley J.K., Takeda K., Akira S., Schreiber R.D. (1999) Interleukin-10 receptor signaling through the JAK-STAT pathway. Requirement for two distinct receptor-derived signals for anti-inflammatory action. J Biol Chem 274: 16513–21. Zhong J., Yang P., Muta K., Dong R., Marrero M., Gong F. Wang C.Y. (2010) Loss of Jak2 selectively suppresses DCmediated innate immune response and protects mice from lethal dose of LPS-induced septic shock. PLoS ONE 5: e9593. Van De Laar L., Van Den Bosch A., Wierenga A.T., Janssen H.L., Coffer P.J., Woltman A.M. (2011) Tight control of STAT5 activity determines human CD34-derived interstitial dendritic cell and langerhans cell development. J Immunol 186: 7016–24. Pahl H.L., Scheibe R.J., Zhang D.E., Chen H.M., Galson D.L., Maki R.A., Tenen D.G. (1993) The proto-oncogene PU.1 regulates expression of the myeloid-specific CD11b promoter. J Biol Chem 268: 5014–20.
© 2015 The Societies and Wiley Publishing Asia Pty Ltd
ORIGINAL ARTICLE
Mannan-binding lectin at supraphysiological concentrations inhibits differentiation of dendritic cells from human CD14þ monocytes Xiao-Ying Xu1, Hui-Jie Li1, Li-Yun Zhang1, Xiao Lu1, Da-Ming Zuo1, Gui-Qiu Shan2, Tian-Yu Xu1 and Zheng-Liang Chen1 1
Department of Immunology, School of Basic Medical Sciences, Southern Medical University, Guangzhou Avenue North 1838, Guangdong, China and 2Guangzhou General Hospital of Guangzhou Military Command, Liuhua Road 111, Guangzhou, Guangdong, China
ABSTRACT Mannan-binding lectin (MBL), a circulating C-type lectin, is an important member of the defense collagen family. It exhibits a high potential for recognizing broad categories of pathogen-associated molecular patterns and initiating complement cascade responses. DCs are well-known specialist antigen-presenting cells that significantly trigger specific T cell-mediated immune responses. In our previous study, it was observed that high concentrations of MBL significantly attenuate LPS-induced maturation of monocyte-derived DCs (MoDCs). In the current study, it was postulated that MBL at similar supraphysiological concentrations would affect early differentiation of MoDCs in some way. CD14þ monocytes from human peripheral blood mononuclear cells were cultured with granulocytemacrophage colony-stimulating factor and IL-4 in the presence or absence of physiological (1 mg/mL) and supraphysiological concentrations (20 mg/mL) of MBL protein, respectively. Phenotypic analysis indicated that the differentiated DCs incubated with high concentrations of MBL expressed MHC class II and costimulatory molecules (e.g., CD80 and CD40) more weakly than did control groups. The secretion of IL-10 and IL-6 increased markedly, whereas their mixed lymphocyte reaction-stimulating capacity decreased. Members of the signal transducer and activator of transcription family were also found to be differentially regulated. Thus, beyond the role of MBL as an opsonin, our data reveal a possible inhibitory effect of MBL at high concentrations in monocyte-DC transition, which probably provides one way of regulating adaptive immune responses by strict regulation of DCs, making MBL a better prospect for controlling relevant pathological events such as autoimmune diseases. Key words
concentration, dendritic cell differentiation, mannan-binding lectin, monocyte.
Mannan-binding lectin is an important member of the defense collectin family, members of which are defined as possessing an amino-terminal collagen-like domain in combination with a C-type lectin domain at carboxylterminal (1). MBL promptly initiates the lectin pathway of complement cascade responses via autoactivation of
the MBL-associated serine protease in first-line host defense against infections. Mammals that are deficient in MBL are susceptible to various diseases (2, 3). It is noteworthy that several defense collagens (e.g., surfactant proteins A and-D, and C1q) can inhibit both the differentiation and maturation of DCs (4–6). These
Correspondence Zheng-Liang Chen, Department of Immunology, School of Basic Medical Sciences, Southern Medical University, Guangzhou Avenue North 1838, Guangzhou, Guangdong, China. Tel/Fax:þ86 02 06164 8477; email: [email protected] Received 4 August 2015; revised 31 October 2015; accepted 4 November 2015. List of Abbreviations: BCL-2, B cell lymphoma-2; DC, FCM, flow cytometry; GI, GM-CSF and IL-4; GM-CSF, granulocyte-macrophage colonystimulating factor; HSA, human serum albumin; MBL, mannan-binding lectin; MoDC, monocyte-derived DC; STAT, signal transducer and activator of transcription.
724
© 2015 The Societies and Wiley Publishing Asia Pty Ltd
Inhibition of DC differentiation by MBL
findings provide extensive information on how innate immune proteins can influence adaptive immune responses. In particular, MBL can alter cytokine production by monocytes (7) and facilitate clearance of atherogenic lipoproteins by monocytes and macrophages, functions that are highly desirable for clinical immunotherapy (8). Dendritic cells are widely recognized as the most potent professional cells for antigen-presentation (9), serving as crucial activators or regulators of immune responses (10, 11). In contrast to their lymphoid counterparts, myeloid DCs are required for adaptive immune responses because they can trigger rapid and appropriate T cell-induced immunity. Given their limited life span and the lack of specific lineage markers for isolating DCs, various studies have attempted to characterize and propagate DCs ex vivo over the past three decades (11–13). Because DCs have high phenotypic heterogeneity at different stages, leading to differently orchestrated immune responses (14), it is possible to manipulate immunity by regulating the development of DCs. Mannan-binding lectin can bind to both monocytes and DCs. MacDonald et al. were the first to evaluate the influence of MBL on monocyte-to-DC differentiation by using a wide range of physiological concentrations (up to 5000 ng/mL) (15). They found that MBL has no direct influence on cell surface antigen expression or cytokine secretion. However, MBL-exposed DCs exert a proinflammatory effect on T cells. This study demonstrated that MBL can influence cellular immunity and function as an opsonin. Different concentrations may lead to opposing proinflammatory and anti-inflammatory effects of MBL. We have shown that physiological concentrations of MBL have no effect on LPS-induced maturation of MoDCs; however, MBL does have an inhibitory action at considerably high concentrations (10–20 mg/mL) (16). Therefore, MBL at supraphysiological levels counters the effect on LPS-induced maturation of DCs at physiological levels. Later, our laboratory demonstrated that MBL affects monocytes slightly at physiological concentrations and inhibits monocyte proliferation at high concentrations (8–20 mg/mL) (17). However, the effects of natural plasma MBL at high concentrations during early-stage differentiation of MoDCs remain poorly understood. Given the abovementioned concentration-dependent effects, we aimed to determine whether the effects of very high concentrations of MBL are also opposite to those of physiological concentrations of MBL on MoDC differentiation. We demonstrated that MBL at 20 mg/mL, but not in physiological concentrations, markedly downregulates the expression of MHC class II and © 2015 The Societies and Wiley Publishing Asia Pty Ltd
co-stimulatory molecules on MoDC. When cytokine secretions were altered, MBL-treated MoDCs were suppressive in both allogeneic mixed lymphocyte reactions and na€ıve T lymphocyte stimulation. STAT molecules were also found to be involved in MBLregulated MoDC differentiation.
MATERIALS AND METHODS Preparation of MBL Mannan-binding lectin was isolated as reported previously (17), primarily by affinity chromatography from pooled freezing human plasma on a mannan-agarose column (Sigma–Aldrich, St. Louis, MO, USA). Anionexchange chromatography was subsequently performed for further purification using a Mono-Q HR 5/5 column (Pharmacia Biotech Europe, Orsay, France). Given the biases in measurement that could result from the potential block of differentiation of CD14þ monocytes by contamination with endotoxin (LPS), residual endotoxin in the purified MBL was removed using Detoxi-Gel Endotoxin Removing Columns (Pierce, Rockford, IL, USA). The endotoxin concentration was evaluated at 95% and they had high viability (>98%), as determined by Trypan blue exclusion. Monocytes were subsequently seeded in 24well tissue culture plate (Nunc, Kamstrup, Roskilde, Denmark) at a density of 1 106/mL, using RPMI 1640 containing 10% (v/v) heat-inactivated FCS (Gibco BRL, Grand Island, CA, USA). The cultures were allocated to four groups: occasional MBL (0, 1 and 20 mg/mL) and HSA (20 mg/mL) or continuous supplementation with 40 ng/mL recombinant human GM-CSF and IL-4 (GI) (PeproTech, Rocky Hill, NJ, USA). Half of the medium was changed with GI every 3 days; additionally, MBL or HSA were added where indicated at equal concentrations to those used initially. Ethical approval for this study was granted by the Medical Ethics Committee of 725
X.Y. Xu et al.
Guangzhou General Hospital of Guangzhou Military Command.
Table 1. List of the sequences of primers for RT-PCR
Analysis of MBL-binding activity to monocytes
TNF-a
FP RP
21 21
GGGACCTCTCTCTAATCAGCC TGGCCCTTGAAGAGGACCTGG
For the binding test, purified monocytes were incubated with Tris-buffered saline (1% BSA, pH 7.4). MBL (20 mg/mL) labeled with FITC isomer 1 (Sigma, Poole, UK) was added to this system. Cells were harvested after 30 min for evaluation of binding by mean fluorescence intensity calculated by FCM. The group that was incubated with FITC-HSA was set as a parallel control. In addition, two additional groups were cultured under the same conditions except for the addition of 1 or 5 mM CaCl2 to assess Ca2þ-dependence.
IL-1a
FP RP
21 21
GCCATCGCCAATGACTCAGAG ATGTAATGCAGCAGCCGTGAG
IL-1b
FP RP
21 21
ATGCTGGTTCCCTGCCCACAG TTTTGCTGTGAGTCCCGGAGC
IL-6
FP RP
20 20
AAGCAGCAAAGAGGCACTGG CTGCACAGCTCTGGCTTGTT
IL-10
FP RP
21 21
AAGGCGCATGTGAACTCCCTG GCTCCACGGCCTTGCTCTTGT
IL-12 (p40)
FP RP
18 17
TGCCCATTCGCTCCAAGA CGGTCATCTGCCGCAAA
GAPDH
FP RP
22 21
CTCCTCCTGTTCGACAGTCAGC CCCAATACGACCAAATCCGTT
Genes
Multiparameter FCM Expression of cell surface molecules was analyzed by FCM on Days 2 and 6 of culture. MoDCs were washed with PBS containing 1% BSA and 0.02% NaN3 and then stained with the following monoclonal antibodies: FITC isomer 1-conjugated anti-human CD14, anti-CD83, anti-CD40 and anti-HLA-DR antibodies; allophycocyanin-conjugated anti-human CD3 (e-Biosciences, San Diego, CA, USA); and phycoerythrin-conjugated antihuman CD1a, anti-CD86, anti-CD11b and anti-CD80 antibodies (BD Biosciences, San Jose, CA, USA). Corresponding isotype mouse IgG (e-Biosciences, San Diego, CA, USA) was also used. Forward/side scatter was first set for primary gating cells of interest followed by further definition using antigen-specific fluorescent labeling using FCM. Apoptosis test To analyze apoptosis, MoDCs were harvested for splicing to conduct Trypan blue staining after being cultured for 6 days. In parallel, cells were bi-labeled with Annexin V and propidium iodide using an Annexin V-FITC Apoptosis Detection Kit (KeyGen Biotech, Nanjing, China) according to the manufacturer's instructions. Subsequently, the percentage of apoptotic cells in each group was evaluated by FCM. Analysis of gene expression Total RNA was extracted from MoDC using Trizol reagent (Invitrogen, Carlsbad, CA, US) according to the manufacturer's instructions. RT-PCR was performed using a RevertAid First Strand cDNA Synthesis Kit (Fermentas, Glen Bumie, MD, USA). Primers (Table 1) were designed to evaluate expressions of TNF-a, IL-1a, 726
Length (bp)
Sequences (50 to30 )
FP, forward primer; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; RP, reversed primer
IL-1b, IL-6, IL-10, and IL-12 (p40). RT-PCR was conducted in a Rotor-Gene 6000 real-time PCR detection system (Qiagen, Hilden, Germany) with 20 mL reaction volume containing a mixture of cDNA, specific primers, and SYBR Green Master Mix (Takara, Otsu, Shiga, Japan). The fold changes in gene expression were quantified relative to the expression of glyceraldehyde-3-phosphate dehydrogenase. Normalization was calculated using the standard 2(DDCT) method on the basis of the gene expression of the GI control group. Analysis of cytokines in culture supernatants Supernatants of MoDC cultures were collected on Day 6 and then measured by ELISA for the expression of TNF-a, IL-1a, IL-1b, IL-6, IL-10, and IL-12 (p40). ELISA was also performed to quantify the secretion of IFN-g by T cells immediately after coculture with MoDC or after restimulation by immobilized anti-CD3 and anti-CD28 monoclonal antibodies (e-Biosciences, San Diego, CA, USA) according to the manufacturer's instructions. T cell allostimulation assay Peripheral blood mononuclear cells were isolated as described above and T lymphocytes purified (>95% CD3þ) from them by magnetic-activated cell sorting using a Pan T Cell Isolation Kit (Miltenyi Biotec GmbH, © 2015 The Societies and Wiley Publishing Asia Pty Ltd
Inhibition of DC differentiation by MBL
Bergisch Gladbach, Germany). T cells were then cultured in 96-well culture plates at a density of 5 105/mL with MoDCs that had been harvested and treated with mitomycin-C (25 mg/mL) on Day 6 prior to coculture. MoDCs and allogeneic T cells (1 106/mL) were cocultured in a complete RPMI 1640 medium (10% FBS) at serial ratios of 1:5, 1:10, 1:20 and 1:100. After 4 days, T cell proliferation was quantified with a Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan) during the last 4 hr. Mean absorbance values of triplicate wells were measured at 450 nm by using an enzyme mark instrument. Alternatively, CD45RAþ na€ıve T lymphocytes were purified (>95%) by negative sorting using a Na€ıve Pan T cell Isolation Kit (Miltenyi Biotec GmbH, Bergisch Gladbach, Germany) as described above. After 4 days of coculture with MoDCs, na€ıve T cells were restimulated with immobilized antiCD3 (2.5 mg/mL) and anti-CD28 monoclonal antibodies (1 mg/mL) for 8 hr and examined for their proliferation and IFN-g production. Western blotting Monocyte-derived DCs were collected on Days 2 and 6 and then lysed using ice-cold sample buffer (0.12 M Tris–HCl, pH 6.8; 20% glycerol, 6% SDS, 0.2% bromophenol blue, and 5% 2-mercaptoethanol; 1 mM phenylmethylsulfonyl fluoride) followed by quantification with a bicinchoninic acid assay (Santa Cruz, San Diego, CA, USA). Prepared lysates (50 mg) were resolved by 10% SDS-PAGE and transferred onto polyvinylidene difluoride membranes (Millipore, Bedford, MA, USA). The membranes were then blocked using 5% BSA containing 0.1% Tween-20 for 1 hr at 37°C to prevent non-specific binding, after which they were probed overnight with primary polyclonal antibodies against human BCL-2, p-STAT3, STAT3, p-STAT5, STAT5, p-STAT6, STAT6, PU.1, Jak2 and b-actin (CST, Beverly, MA, USA; 1:1000 dilution) at 4°C. The membranes were subsequently incubated with HRP-conjugated goat antimouse IgG (Santa Cruz; 1:1000 dilution) at room temperature for 2 hr. Enhanced chemiluminescence reagents (Thermo Fisher Scientific, Fremont, CA, USA) were used to detect the bands of phosphorylated proteins. Protein expression was quantified using Quantity One software. Statistical analysis One-way anova was performed to test homogeneity of variance. Student's t-test was used to analyze the two groups, and multiple comparisons were accomplished by Bonferroni correction test or Dunnett T3's test by using SPSS 13.0 for Windows (SPSS, Chicago, IL, USA). Data © 2015 The Societies and Wiley Publishing Asia Pty Ltd
are presented as the mean SD. P < 0.05 was considered statistically significant.
RESULTS MBL binds to monocytes directly Mannan-binding lectin can bind to several autologous cell types, including B lymphocytes, monocytes, macrophages and DCs. Binding via both the collagen-like region and the carbohydrate-recognition domain of MBL has been demonstrated (18, 19). Circulating MBL generally forms a complex with MBL-associated serine protease, which impedes purification. To confirm that MBL binds to monocytes, highly purified plasma MBL was produced from human sera (Fig. 1a). Compared with biotinylated HAS, biotinylated MBL protein was found to bind specifically to human monocytes (Fig. 1b). The binding was significantly enhanced by adding Ca2þ. Markedly increased binding was observed in cultures with both 1 and 5 mM of CaCl2. As Ca2þ concentration increased, binding intensity became suboptimal at 1 mM and highly promoted at 5 mM (Fig. 1b). This observation is consistent with the reported Ca2þ-dependence of MBL–monocyte interaction (18). MBL regulated phenotype of MoDC To confirm the effect of MBL on DC phenotype, FCM was performed on Days 2 and 6 of culture with GI medium in the presence of 0, 1 and 20 mg/mL MBL. Cells with the CD1aþ/CD14/dim profile are reportedly generally obtained from cultures using the GI recipe, even at low concentrations of MBL (20). However, in the present study considerably negative-regulated CD1a was observed on MoDCs treated with high concentrations of MBL (20 mg/mL), whereas the percentage of CD1aCD14þ cells was two- to five-fold higher (P < 0.01). Enhanced expression of CD14 was thus sustained throughout the 6 days of culture (Fig. 2). Compared with the control groups, no apparent effect was found in the group treated with MBL at physiological concentrations. Nevertheless, as shown in Figure 3, with MoDCs treated with high concentrations of MBL, mean fluorescence intensity of HLA-DR (MHC II molecule) decreased to almost half of that in the control groups. CD86 expression seemed to remain the same regardless of MBL addition. However, expression of other co-stimulatory and maturation associated molecules, such as CD80 and CD40, decreased sharply. In particular, enhanced expression of CD11b was observed. Also, no changes were evident in the cells treated with lower concentrations of MBL. 727
X.Y. Xu et al.
Fig. 1. Purification and binding of MBL to monocytes. (a) SDS-PAGE and western blot data showing that highly purified plasma MBL protein is mainly in the form of multimers containing fewer dimer chains. (b) Binding of fresh isolated monocytes and biotinylated MBL (20 mg/mL) in Ca2þ-free medium was assessed. The binding intensity obviously increased with increasing concentrations of Ca2þ from 1 to 5 mM. Representative data are from three independent experiments. Values are shown as mean S.D. Bonferroni correction test was used for multiple comparisons ( , P < 0.01).
Regulation by MBL of MoDC differentiation is irrelevant to apoptosis Because the expression of specific surface antigen molecules was markedly reduced, whether the changes resulted from induction of cytotoxicity and/or apoptosis by high concentrations of MBL was subsequently determined. As determined by Trypan blue staining, the viability of MBL (20 mg/mL)-treated MoDCs changed
slightly (P > 0.05) (Fig. 4a). FCM results also indicated a low apoptotic rate in both MBL- and HSA-treated MoDCs. In addition, there were no significant differences between the two groups, as shown by propidium iodide and Annexin-V double staining (P ¼ 0.082) (Fig. 4b). To confirm these findings, expression of BCL-2 was also evaluated; no perceptible changes were found. These findings indicate that inclusion of MBL is unlikely to induce cell apoptosis (Fig. 4c).
Fig. 2. MBL induces generation of CD1a-CD14+ cells. A population with particularly weaker expression of CD1a and sustained expression of CD14 was identified on Days 2 and 6 in GI medium with added MBL at high concentrations (20 mg/mL). Similar data were obtained from three independent experiments. Results are was presented as the mean S.D. , P < 0.01 as compared with cells cultured in GI medium alone. d, day.
728
© 2015 The Societies and Wiley Publishing Asia Pty Ltd
Inhibition of DC differentiation by MBL
Fig. 3. Altered surface markers on MBL-treated MoDCs. As MoDCs matured, high concentrations of MBL downregulated expression of HLADR (MHC II molecule), CD80 and CD40, whereas that of CD11b was enhanced on both Days 2 and 6 of culture. The grey peak of each diagram represents the specific isotype antibody. Results are presented as mean S.D. Representative results from three independent experiments are shown. , P < 0.05; , P < 0.01; , P < 0.001 compared with cells cultured in GI medium alone. d, day.
Fig. 4. Effects of MBL (20 mg/mL) on apoptosis of MoDC. (a) Apoptotic cells were counted under phase contrast microscopy after Trypan blue staining; o lack of effect on viability of MBL-treated MoDCs is shown. (b) No detectable differences between MBL-treated MoDCs and those cultured in GI medium were observed using PI/annexin V double staining assay. (c) Expression of BCL-2 did not change relative to internal control of b-actin. Results are representative of three independent experiments. , P < 0.01 as compared with cells cultured in GI medium alone.
© 2015 The Societies and Wiley Publishing Asia Pty Ltd
729
X.Y. Xu et al.
MBL facilitates IL-10 and IL-6 production by MoDCs Next, whether MBL-treated MoDCs have altered cytokine profiles was examined. After a culture period of 6 days, the supernatants were collected for ELISA analysis and the MoDCs harvested for RT-PCR analysis. In the high-concentration group, MBL treatment induced accumulated expression of IL-10, which was 2.5 fold higher than that of the control group at the gene level (P ¼ 0.001). IL-6 was also significantly increased. However, other proinflammatory cytokines, including IL-a, IL-1b, TNF-a and IL-12, showed no variations between groups (Fig. 5a). Similar results concerning cytokine secretion were determined by ELISA (Fig. 5b). The combined data suggest that supraphysiological concentrations of MBL can especially impair the potency of MoDCs in initiating innate immune responses by skewing the amounts of regulatory and proinflammatory cytokines. MBL-treated MoDCs inhibit proliferation and IFN-g secretion by allogeneic T cells Activation of T cell-mediated immunity is one of the key functions of DC. To this end, proliferation of and cytokine production by allogeneic CD3þ T cells were monitored after coculture with MoDCs. Proliferation of T cells was significantly reduced when stimulated by MoDCs treated with high concentrations of MBL, as shown in Figure 6a. This finding is consistent with impaired expression of important surface molecules, which results in diminished ability of MBL-treated MoDCs to present antigens and pass activation signals. Meanwhile, profound T cell proliferation was observed in the group treated with MBL at physiological
concentrations. Production of IFN-g also appeared to be inhibited when allogeneic T cells were cocultured with MoDCs treated with high concentrations of MBL, allowing MBL to impair subsequent Th1 immunity. The ability of MBL-treated MoDCs to stimulate na€ıve T cells was accordingly analyzed. Similarly, CD45RAþ T cells were cocultured with MoDCs that had been precultured under distinct conditions. After 4 days, T cells were restimulated by both anti-CD3 and anti-CD28. The average degree of proliferation of na€ıve T cells cocultured with MBL (20 mg/mL but not 1 mg/mL)treated MoDCs was also lower and they released less IFN-g (Fig. 6b). Differentially regulated STAT signaling pathways are involved in MoDCs treated with high concentrations of MBL Collections of cellular molecules were identified during signaling monocyte differentiation mediated by the IL-10 and IL-6 family of cytokines, such as the STAT family. These molecules are involved in cell survival, expansion and differentiation via transducing intracellular signals. Functional experiments demonstrated slight influences of physiological concentrations of MBL on MoDC differentiation; thus, the degree of expression of STAT3, STAT5 and STAT6 with MoDCs treated with high concentrations of MBL was selectively checked. In contrast to controls, MBL-treated MoDCs exhibited markedly accumulated amounts of tyrosinephosphorylated STAT3. In particular, the most intensive relative expression was found on Day 2 (Fig. 7a). Activation of STAT5 is crucial to GM-CSF-dependent myeloid lineage cell development. The finding of sustained phosphorylation of STAT5 in all groups supports its important role in DC differentiation and
Fig. 5. Identification of cytokine profile of MBL-treated MoDCs. (a) In contrast to cultures without MBL, RT-PCR showed that IL-10 and IL-6 were stimulated by high concentrations of MBL-treated MoDCs, whereas expression of other proinflammatory cytokines remained at basal levels. (b) Estimation of cytokine secretion by ELISA. Results from three independent experiments are presented as the mean S.D. , P < 0.01; , P < 0.001 as compared with cells cultured in GI medium alone.
730
© 2015 The Societies and Wiley Publishing Asia Pty Ltd
Inhibition of DC differentiation by MBL
Fig. 6. Proliferation of and IFN-g production by allogeneic T lymphocytes with stimulation of MoDCs. (a) MoDCs treated with high concentrations of MBL are less active in simulating T cell proliferation and IFN-g production. (b) MoDCs treated with high concentrations of MBL suppress activation of CD45RAþ na€ıve T cells re-stimulated by soluble anti-CD3 and anti-CD28. X-axis indicates the ratio of amount of MoDCs to T cells. Representative data are shown as the mean S.D from three independent experiments. , P < 0.05; , P < 0.01 as compared with cells cultured in GI medium alone.
survival. Nevertheless, in the MBL-treated group, phosphorylation of both STAT5 and Jak2 decreased significantly (Figs. 7a, 7b). The data from Days 2 and 6 suggest that this inhibition was constantly retained (MBL was present throughout the duration of culture). Markedly increased expression of downstream PU.1 was also indicated (Fig. 7b). Therefore, the putative break of GM-CSF signaling may be partially mediated by interference in the STAT5-PU.1 path. Besides, no difference in the expression of STAT6 was observed. In this study, lLow phosphorylation was found among all groups.
DISCUSSION We found that MBL at supraphysiological concentrations affects early-stage DC differentiation ex vivo, resulting in altered phenotypes and functions. A previous study by MacDonald et al. demonstrated that rhMBL has no direct influence on DC differentiation (15). With the aim of maintaining protein conformation and biological activity, we used naturally purified MBL protein in the current study. To collect cells more accurately, we also varied the culture © 2015 The Societies and Wiley Publishing Asia Pty Ltd
conditions, including the approach to monocyte isolation. Regardless of the differences in conditions, we obtained similar negligible changes in DC phenotypes after exposure to MBL at physiological concentrations. However, we further tested the influences of MBL at supraphysiological concentrations. Among healthy individuals, MBL plasma concentrations range from 5 to 10000 ng/mL (21), increasing up to three-fold during acute phase responses. Therefore, supraphysiological concentration may be reached under certain clinical conditions and most likely in some individuals with wild-type MBL genotypes. Our group has shown that only high concentrations inhibit LPS-induced DC maturation and secretion of proinflammatory cytokines (16). Therefore, we presumed that, under inflammatory conditions, the inhibitory effects of supraphysiological MBL concentrations on DC differentiation also function as a negative immunoregulatory mechanism by limiting monocyte–DC transition and concomitant T-cell immune responses. Impaired monocyte–DC transition was initially noticed because of the occurrence of a cell population that retained a monocyte-like phenotype. Early in 1994, CD1aþCD14 immature DCs generated by GI culture 731
X.Y. Xu et al.
Fig. 7. The effects of MBL (20 mg/mL) on expression of signal molecules associated with MoDC development. (a) Phosphorylation of STAT3, STAT5 and STAT6 are differently regulated by MBL. The expression intensities were normalized by comparing to their total proteins individually. (b) Compared with internal controls, expression of PU.1 and inhibition of Jak2 is enhanced by MBL-treated MoDCs. b-actin was set to confirm equal protein loading for all western blot tests. Data are shown as mean S.D for one representative experiment out of three independent measurements from different donors. , P < 0.05; , P < 0.01; , P < 0.001 as compared with cells cultured in GI medium alone. d, day.
732
© 2015 The Societies and Wiley Publishing Asia Pty Ltd
Inhibition of DC differentiation by MBL
were reported (22). By contrast, the occurrence of up to 30% of MoDCs expressing CD14 and dim CD1a in the present study suggests that expression and/or translation of both genes deviates when they are incubated with MBL at supraphysiological concentrations. A similar phenomenon has been observed when IL-10 was added at the initiation of culture (23), which possibly explains the mechanism by which MBL affects differentiation (as discussed below). Our group has previously documented the arrest of monocytes in the G0/G1 phase of a cell cycle by MBL treatment (17). Cell apoptosis was one of the effects of the interaction between monocytes and MBL in that study. However, in this study it was not the factor leading to inhibited induction of MBL-treated MoDC. Therefore, MBL acts distinctly on myeloid lineage cells. After exposure to C1q, monocytes fail to downregulate their typical markers, such as CD14 and CD16, and upregulate co-stimulatory molecules in GI medium (24). Similarly, rather low expression of co-stimulatory molecules, indicating maturing DCs, was observed with MoDCs treated with high concentrations of MBL. The subsequent inefficient activation of allogeneic T cells may be attributable to this phenomenon. The defense collagen family of proteins has long been known to modulate cytokine production by myeloid cells (7, 25). Under inflammatory conditions, MBL increases secretion of IL-10, IL-6, IL-1 receptor antagonist and monocyte chemoattractant protein-1 of peripheral blood mononuclear cells (7). In particular, IL-10 can limit excess immunity by hampering the generation and function of DCs. Silvia et al. have reported the limited spontaneous maturation of DC resulting from endogenous IL-10, even in low concentrations. Therefore, production of IL-12 and TNF-a, Ag presentation, and Th1 responses are negatively regulated (26). In the current study, promotion of autocrine IL-10 enabled MBL to potentially skew the balance of Th1/Th2 responses indirectly. This immunosuppressive property of MBL-treated MoDCs probably also results from the autocrine effect of IL-6: IL-6 is proinflammatory in some cases but regulates myeloid lineage cell responses during infections (27). It is also reciprocal with the production of IL-10 when MoDC generation and differentiation is prevented (23, 28). Identification of the intracellular molecules involved in MBL-modified MoDC differentiation is vital. Previous studies have suggested activation of STAT3 in cells with tolerogenic phenotype, including the IL-10 signalinvolved negative regulation of DC activation (29, 30). A DC-specific STAT3 knockout study reported that STAT3 possibly dominates the path of autocrine IL10 (31). The present study suggests the involvement of STAT3 activation at high concentrations of MBL© 2015 The Societies and Wiley Publishing Asia Pty Ltd
mediated autocrine of IL-10. Given the share of the critical region determining STAT3 recruitment between the receptors of IL-10 and IL-6 (32), we reasoned that, although not as intensive as that of IL-10, secretion of IL-6 shown in this study probably participated in activating STAT3. In addition, another seemingly controversial result obtained in this study is the Jak2independent expression of STAT3 and STAT6 with respect to the completed Jak2-deficient model (33). Thus, the compensatory effects from other redundant signal molecules require further investigation. The precise control of STAT5 activity in determining the development of CD34þ hematopoietic progenitorderived DCs at distinct stages has previously been described (34); this directly relates to the expression of CD1a. In this context, the sustained expression of STAT5 confirms its key role in GM-CSF-driven induction. The enhanced expression of PU.1, the downstream transcriptional factor of STAT5, is also comparable to previously reported findings. Expression of CD11b was thus upregulated because CD11b is transcriptionally regulated via the effective binding of PU.1 to its specific promoter site (35). In summary, the present study has revealed an inhibitory action of MBL at supraphysiological concentrations (20 mg/mL) on MoDC differentiation. Given the immense medical significance of DCs, this study contributes to knowledge about the indirect regulation of adaptive immunity by MBL; however, the influence of MBL—especially during the acute phase—at the inflammatory site needs further investigation. Likewise, this study may elucidate potential DC-based therapy (MBL supplemented) for controlling autoimmune diseases or allograft rejection by limiting exaggerated inflammatory responses.
ACKNOWLEDGEMENTS This study was granted by the National Natural Science Foundation of China (Grant no. 30972679). We would like to thank Guangzhou General Hospital of Guangzhou Military Area Command of Chinese PLA, China for the free supply of human blood cells and plasma.
DISCLOSURE The authors declare that they do not have any conflicts of interest to disclose.
REFERENCES 1. Kilpatrick D.C. (2002) Mannan-binding lectin and its role in innate immunity. Transfus Med 12: 335–52.
733
X.Y. Xu et al.
2. Kilpatrick D.C. (2002) Mannan-binding lectin: clinical significance and applications. Biochim Biophys Acta 1572: 401–13. 3. Stuart L.M., Takahashi K., Shi L., Savill J., Ezekowitz R.A. (2005) Mannose-binding lectin-deficient mice display defective apoptotic cell clearance but no autoimmune phenotype. J Immunol 174: 3220–6. 4. Brinker K.G., Garner H., Wright J.R. (2003) Surfactant protein A modulates the differentiation of murine bone marrow-derived dendritic cells. Am J Physiol Lung Cell Mol Physiol 284: L232–41. 5. Brinker K.G., Martin E., Borron P., Mostaghel E., Doyle C., Harding C.V., Wright J.R. (2001) Surfactant protein D enhances bacterial antigen presentation by bone marrow-derived dendritic cells. Am J Physiol Lung Cell Mol Physiol 281: L1453–63. 6. Castellano G., Woltman A.M., Schlagwein N., Xu W., Schena F.P., Daha M.R., Van Kooten C. (2007) Immune modulation of human dendritic cells by complement. Eur J Immunol 37: 2803–11. 7. Fraser D.A., Bohlson S.S., Jasinskiene N., Rawal N., Palmarini G., Ruiz S., Rochford R., Tenner A.J. (2006) C1q and MBL, components of the innate immune system, influence monocyte cytokine expression. J Leukoc Biol 80: 107–16. 8. Fraser D.A., Tenner A.J. (2010) Innate immune proteins C1q and mannan-binding lectin enhance clearance of atherogenic lipoproteins by human monocytes and macrophages. J Immunol 185: 3932–9. 9. Steinman R.M. (1991) The dendritic cell system and its role in immunogenicity. Annu Rev Immunol 9: 271–96. 10. Sato K., Fujita S. (2007) Dendritic cells: Nature and classification. Allergol Int 56: 183–91. 11. Banchereau J., Steinman R.M. (1998) Dendritic cells and the control of immunity. Nature 392: 245–52. 12. Steinman R.M. (2012) Decisions about dendritic cells: Past, present, and future. Annu Rev Immunol 30: 1–22. 13. Santiago-Schwarz F. (1999) Positive and negative regulation of the myeloid dendritic cell lineage. J Leukoc Biol 66: 209–16. 14. Merad M., Sathe P., Helft J., Miller J., Mortha A. (2013) The dendritic cell lineage: Ontogeny and function of dendritic cells and their subsets in the steady state and the inflamed setting. Annu Rev Immunol 31: 563–604. 15. Macdonald S.L., Downing I., Atkinson A.P., Gallagher R.C., Turner M.L., Kilpatrick D.C. (2010) Dendritic cells previously exposed to mannan-binding lectin enhance cytokine production in allogeneic mononuclear cell cultures. Hum Immunol 71: 1077–83. 16. Wang M., Zhang Y., Chen Y., Zhang L., Lu X., Chen Z. (2011) Mannan-binding lectin regulates dendritic cell maturation and cytokine production induced by lipopolysaccharide. BMC Immunol 12: 1. 17. Wang Y., Chen A.D., Lei Y.M., Shan G.Q., Zhang L.Y., Lu X., Chen Z.L. (2013) Mannose-binding lectin inhibits monocyte proliferation through transforming growth factor-beta1 and p38 signaling pathways. PLoS ONE 8: e72505. 18. Downing I., Macdonald S.L., Turner M.L., Kilpatrick D.C. (2005) Detection of an autologous ligand for mannan-binding lectin on human B lymphocytes. Scand J Immunol 62: 507–14. 19. Ogden C.A., Decathelineau A., Hoffmann P.R., Bratton D., Ghebrehiwet B., Fadok V.A., Henson P.M. (2001) C1q and mannose binding lectin engagement of cell surface calreticulin and CD91 initiates macropinocytosis and uptake of apoptotic cells. J Exp Med 194: 781–95. 20. Sallusto F., Lanzavecchia, A. (1994) Efficient presentation of soluble antigen by cultured human dendritic cells is maintained
734
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha. J Exp Med 179: 1109–18. Petersen K.A., Matthiesen F., Agger T., Kongerslev L., Thiel S., Cornelissen K., Axelsen M. (2006) Phase I safety, tolerability, and pharmacokinetic study of recombinant human mannanbinding lectin. J Clin Immunol 26: 465–75. Romani N., Gruner S., Brang D., Kampgen E., Lenz A., Trockenbacher B., Konwalinka G., Fritsch P.O., Steinman R.M., Schuler G. (1994) Proliferating dendritic cell progenitors in human blood. J Exp Med 180: 83–93. Buelens C., Verhasselt V., De Groote D., Thielemans K., Goldman M., Willems F. (1997) Interleukin-10 prevents the generation of dendritic cells from human peripheral blood mononuclear cells cultured with interleukin-4 and granulocyte/ macrophage-colony-stimulating factor. Eur J Immunol 27: 756–62. Hosszu K.K., Santiago-Schwarz F., Peerschke E.I., Ghebrehiwet B. (2010) Evidence that a C1q/C1qR system regulates monocyte-derived dendritic cell differentiation at the interface of innate and acquired immunity. Innate Immun 16: 115–27. Zhang R., Becnel L., Li M., Chen C., Yao Q. (2006) C-reactive protein impairs human CD14þ monocyte-derived dendritic cell differentiation, maturation and function. Eur J Immunol 36: 2993–3006. Corinti S., Albanesi C., La Sala A., Pastore S., Girolomoni G. (2001) Regulatory activity of autocrine IL-10 on dendritic cell functions. J Immunol 166: 4312–18. Nagabhushanam V., Solache A., Ting L.M., Escaron C.J., Zhang J.Y., Ernst J.D. (2003) Innate inhibition of adaptive immunity: Mycobacterium tuberculosis-induced IL-6 inhibits macrophage responses to IFN-gamma. J Immunol 171: 4750–7. Hegde S., Pahne J., Smola-Hess S. (2004) Novel immunosuppressive properties of interleukin-6 in dendritic cells: Inhibition of NF-kappaB binding activity and CCR7 expression. FASEB J 18: 1439–41. Moore K.W., De Waal Malefyt R., Coffman R.L., O'garra A. (2001) Interleukin-10 and the interleukin-10 receptor. Annu Rev Immunol 19: 683–765. Wolfle S.J., Strebovsky J., Bartz H., Sahr A., Arnold C., Kaiser C., Dalpke A.H., Heeg K. (2011) PD-L1 expression on tolerogenic APCs is controlled by STAT-3. Eur J Immunol 41: 413–24. Melillo J.A., Song L., Bhagat G., Blazquez A.B., Plumlee C.R., Lee C., Berin C., Reizis B., Schindler C. (2010) Dendritic cell (DC)-specific targeting reveals Stat3 as a negative regulator of DC function. J Immunol 184: 2638–45. Riley J.K., Takeda K., Akira S., Schreiber R.D. (1999) Interleukin-10 receptor signaling through the JAK-STAT pathway. Requirement for two distinct receptor-derived signals for anti-inflammatory action. J Biol Chem 274: 16513–21. Zhong J., Yang P., Muta K., Dong R., Marrero M., Gong F. Wang C.Y. (2010) Loss of Jak2 selectively suppresses DCmediated innate immune response and protects mice from lethal dose of LPS-induced septic shock. PLoS ONE 5: e9593. Van De Laar L., Van Den Bosch A., Wierenga A.T., Janssen H.L., Coffer P.J., Woltman A.M. (2011) Tight control of STAT5 activity determines human CD34-derived interstitial dendritic cell and langerhans cell development. J Immunol 186: 7016–24. Pahl H.L., Scheibe R.J., Zhang D.E., Chen H.M., Galson D.L., Maki R.A., Tenen D.G. (1993) The proto-oncogene PU.1 regulates expression of the myeloid-specific CD11b promoter. J Biol Chem 268: 5014–20.
© 2015 The Societies and Wiley Publishing Asia Pty Ltd
