Original Paper Neuropsychobiology 2014;70:23–28 DOI: 10.1159/000363340
Received: October 17, 2013 Accepted after revision: April 28, 2014 Published online: August 21, 2014
Manganese Superoxide Dismutase Gene Expression and Cognitive Functions in Recurrent Depressive Disorder Monika Talarowska a Agata Orzechowska a Janusz Szemraj b Kuan-Pin Su c Michael Maes d, e Piotr Gałecki a Departments of a Adult Psychiatry and b Medical Biochemistry, Medical University of Lodz, Lodz, Poland; c Department of Psychiatry and Mind-Body Interface Laboratory (MBI-Lab), China Medical University Hospital, Taichung, Taiwan, ROC; d Department of Psychiatry, Deakin University, Geelong, Vic., Australia; e Department of Psychiatry, Chulalongkorn University, Bangkok, Thailand
Abstract Background: Recent studies have revealed that recurrent depressive disorders (rDD) are linked with dysregulation of the immune system. Previous studies have found that manganese superoxide dismutase (MnSOD, SOD2) may be a key inflammatory enzyme involved in this disorder. The purpose of this study was to determine the mRNA and protein levels of MnSOD in patients with rDD and to define the relationship between serum MnSOD levels and cognitive performance. Methods: The study comprised 236 subjects, which included patients with rDD (n = 131) and healthy subjects (n = 105, healthy control group, HC). Assessment of cognitive function was based on performance on the Trail Making test (TMT), the Stroop test, the Verbal Fluency test (VFT) and the Auditory Verbal Learning test (AVLT). Results: MnSOD gene expression at mRNA and protein level was significantly lower in rDD patients than in the HC group (p < 0.01). In the rDD and HC groups separately, there were no statistically significant associations between mRNA and protein expression levels of the MnSOD and psychological tests. In the total study group (n = 236), there was a statistically significant correlation be-
© 2014 S. Karger AG, Basel 0302–282X/14/0701–0023$39.50/0 E-Mail [email protected] www.karger.com/nps
tween both MnSOD gene levels and the following tests (p < 0.01): the TMT parts A and B (negative correlation), the Stroop test parts RCNb (reading color names in black) and NCWd (naming color of word – different; negative correlation), the VFT (positive correlation) and the AVLT (positive correlation). Conclusions: Our study provides evidence that the MnSOD enzyme-coding gene and MnSOD expression are important for the regulation of cognitive functioning. © 2014 S. Karger AG, Basel
Introduction
Most researchers agree that there are multiple factors influencing the development of recurrent depressive disorder (rDD). There is now evidence that immune-inflammatory and oxidative and nitrosative stress (O&NS) pathways play a role in depression and staging of depression [1]. Increased levels of proinflammatory cytokines and indicants of O&NS, including changes in antioxidant enzymes, are among the most robust biomarkers of depressive disorders [2–4]. Acute inflammatory reactions and depressive disorders share many symptoms such as fatigue, sleep disturbances, anxiety, depressed mood, loss of appetite, psychomotor retardation and neurocognitive defects [5, 6]. Monika Talarowska Department of Adult Psychiatry, Medical University of Lodz Aleksandrowska 159 PL–91-229 Lodz (Poland) E-Mail talarowskamonika @ wp.pl
Downloaded by: St. Andrews University 138.251.14.35 - 12/4/2014 11:53:20 AM
Key Words Depression · Cognition · Inflammation · Manganese superoxide dismutase
Methods Patients The study was carried out in a group of 236 subjects aged 20–67 years (mean = 39.79, standard deviation, SD = 14.02), which included patients with rDD (n = 131) and a control group of healthy subjects (HC group, n = 105). All the patients were native inhabitants of central Poland and were unrelated to one another. The selection of individuals for the study group was performed randomly without replacement sampling. Table 1 presents characteristics of the case and control groups, including gender, age and education. There were statistically significant differences between the two groups in gender distribution (χ2 = 1.46, p = 0.027), years of education (Z = 3.18, p = 0.001) and age (Z = 10.44, p = 0.001). Experimental Protocol Patients were selected for the study based on the inclusion criteria for rDD outlined in the ICD-10 (F32.0-7.32.2, F33.0-F33.8) [11]. All subjects were examined during the course of their hospitalization and did not present with concurrent diagnoses of somatic diseases or axis I and II disorders other than depressive episodes. Other exclusion criteria included inflammatory or autoimmune disorders, unwillingness to give informed consent and injuries to the central nervous system that could have affected cognitive function. For all subjects, a case history was obtained prior to participation using the standardized Composite International Diagnostic Interview (CIDI) [12]. The HC consisted of 105 healthy subjects without any family history of psychiatric disorders. The HC included community volunteers who were enrolled based on the criteria of the psychiatric CIDI interview [12]. Control subjects with other psychiatric diagnoses, axis I and II disorders, neurological disorders, or substance abuse or dependence were excluded from the study. On the basis of medical records and diagnostic interviews, it was established that none of the participants had been diagnosed
24
Neuropsychobiology 2014;70:23–28 DOI: 10.1159/000363340
Table 1. Demographic characteristics of the rDD group versus the HC group and data concerning the course of the disease
Characteristics
Gender Female Male Age, years Education, years
rDD (n = 131)
HC (n = 105)
n
%
mean ± SD
n
% mean ± SD
76 55 – –
58 42 – –
– – 48.53 ± 11.05 12.46 ± 2.49
69 36 – –
66 34 – –
– – 28.91 ± 8.69 14.71 ± 2.51
with a mental disability or any relevant intellectual deficits. All subjects were free from medical illnesses, including infections and inflammatory or allergic reactions. None of the control subjects or depressed patients was treated with drugs known to influence lipid metabolism, immune response or endocrine function. The control subjects were free of all medications for at least 2 months prior to blood sampling. None of the participants were drinkers or heavy smokers, and none had ever taken psychotropic drugs. Cognitive Function Assessment Assessment of cognitive function was based on the Trail Making test (TMT), the Stroop test, the Auditory Verbal Learning test (AVLT) and the Verbal Fluency test (VFT). Descriptions of these tests have been presented elsewhere [13]. Severity of Depression Depression severity was assessed with the 21-item Hamilton Depression Rating Scale (HDRS) [14, 15]. For the patients with rDD, the HDRS, Stroop Test, TMT, AVLT and VFT were administered at admission during the symptomatic phase, which would generally be either before or shortly after modification of the previous antidepressant drug regimen. In the HC group, neuropsychological tests were performed during a single examination. Examination of patients was conducted by the same person in each case: the same psychologist examined the patients with neuropsychological tests, including an evaluation of the obtained results, while the HDRS test was performed by the same psychiatrist. Determination of Protein Concentration The test protein levels were measured in blood serum levels for each patient. These tests were preceded by a determination of serum total protein. Two measurement techniques were employed [16]. Spectrophotometric Protein Assay Protein levels were detected with a GeneQuest spectrophotometer (Pharmacia Biotech). Absorption measurements were performed automatically at wavelengths of 260, 280 and 320 nm, and protein concentrations were calculated according to the Warburg formula: protein concentration (mg/cm3) = 1.55 (A280–A320) – 0.76 (A260–A320).
Talarowska /Orzechowska /Szemraj /Su / Maes /Gałecki
Downloaded by: St. Andrews University 138.251.14.35 - 12/4/2014 11:53:20 AM
Superoxide dismutases (SOD) play a key role among antioxidant enzymes that protect the brain from ROS. In the human body, there are three isoforms of SOD: copper-zinc SOD (Cu-ZnSOD, SOD1), mitochondrial with manganese inside the active centers of the enzyme (MnSOD, SOD2) and extracellular SOD (EC-SOD, SOD3), which also contains zinc and copper in its structure [7]. The main role of MnSOD is to protect cells from the damaging effects of ROS [8]. Previous studies have found that SOD2 may be a key inflammatory enzyme involved in the development of rDD [9, 10]. The purpose of this study was to determine both mRNA and protein levels of MnSOD in patients with rDD and to investigate the relationship between serum MnSOD levels and cognitive performance. Since inflammatory conditions are accompanied by neurocognitive defects [5], we hypothesized that the levels of MnSOD gene expression might also be associated with cognitive functioning in depression.
Determination of Serum SOD2 Protein Level For the quantitative detection of serum SOD2 protein levels, a commercial kit, NWLSSTM MnSOD ELISA, was used (Northwest Life Science Specialties LLC, Vancouver, Wash., USA). Measurement of mRNA Expression: Quantitative Real-Time PCR RNA Purification and RT-PCR Amplification The human MnSOD and GADPH expression was quantified by real-time PCR using ABI Prism 7000 Sequence Detection System (Applied Biosystems, Foster City, Calif., USA) according to the manufacturer’s protocol. Total cellular RNAs were extracted from whole blood cells of patients using the Trizol reagent (Invitrogen, Groningen, the Netherlands) method, a single-step purification protocol. Concentration and purity of the RNA were measured by UV spectrophotometry. Polyadenylated RNA was isolated using an Oligotex kit (Qiagen, Chatsworth, Calif., USA); 50 ng poly(A) RNA was then used for cDNA synthesis using the TaqMan reverse transcription reagent kit (Applied Biosystems) according to the manufacturer’s protocol. Briefly, 2.5, 2.0, 1.5, 1.0, 0.5 and 0.25 μl of synthesized cDNA were amplified in triplicate for both GADPH and each of the target genes to create a standard curve. Likewise, 2 μl of cDNA was amplified in triplicate in all isolated samples for each primer/probe combination and GADPH. Each sample was supplemented with both respective 0.3 μM forward and reverse primers and fluorescent probe, and made up to 50 μl using qPCR Master Mix for SYBRTM Green I (Eurogentec, Seraing, Belgium). All following PCR primers were designed using Primer Express software (Applied Biosystems): forward 5′ CTGGACAAACCTCAGCCCTA 3′, reverse 5′ TGATGGCTTCCAGCAACTC 3′ and forward 5′ AGCCACATCGCTCAGACAC 3′, reverse 5′ GCCCAATACGACCAAATCC 3′, specific for mRNA of human MnSOD and GADPH, respectively. The housekeeping gene GADPH was used as an active and endogenous reference to correct for differences in the amount of total RNA added to the reaction solution and to compensate for different levels of inhibition during reverse transcription of RNA and during PCR. Each target probe was amplified in separate 96-well plates. All samples were incubated at 50 ° C for 2 min and at 95 ° C for 10 min and then cycled at 95 ° C for 30 s, 56 ° C for 1 min and 72 ° C for 1 min for 40 cycles. SYBR Green I fluorescence emission data were captured and mRNA levels were quantified using the critical threshold (Ct) value. Analyses were performed with ABI Prism 7000 (SDS Software). Controls without reverse transcription and with no template cDNA were performed with each assay. To compensate for variations in input RNA amounts and efficiency of reverse transcription, GADPH mRNA was quantified and results were normalized to these values. Relative gene expression levels were obtained using the ∆∆Ct method [17]. Amplification-specific transcripts were further confirmed by obtaining melting curve profiles. The chance of developing the disease in people having one of the evaluated genotypes in comparison to people lacking this genotype, i.e. the correlation power, was calculated with relative risk.
MnSOD and Cognition
Statistical Analysis Statistical analysis of the collected material included calculation of both descriptive and inferential statistics. A two-tailed critical region was employed in the statistical hypothesis testing. Qualitative characteristics of the experimental and control groups are expressed as frequencies shown as percentages. To characterize the average values for quantitative features, the arithmetical mean and median were calculated. The measures of statistical dispersion included the range of values between the minimum and the maximum, as well as the SD. Distributions were analyzed using the Shapiro-Wilk test. To compare nonparametric variables in the test groups, the following tests were used: the Pearson χ2 for qualitative variables, the Wilcoxon signed-rank test for two related groups for quantitative variables, and the Mann-Whitney U test for two independent groups to determine the coincidence of distributions. To evaluate the relations between analyzed variables, Spearman’s R rank order correlation coefficients were estimated. For all analyses, statistical significance was defined as p < 0.05 [18]. All data analyses were performed using STATISTICA version 10. Ethics Before deciding to participate in the study, subjects were informed of the study purpose, assured of voluntary participation and guaranteed personal data confidentiality. Written informed consent was obtained according to the study protocol approved by the Bioethical Committee of the Medical University of Lodz (No. RNN/603/08/KB).
Results
Upon admission, 7 subjects met the HDRS score criteria for a mild depressive episode, 17 for a moderate depressive episode, 85 for a severe depressive episode and 22 for a very severe depressive episode. On the day of discharge, 85 subjects did not meet the HDRS criteria for depressive disorder, 36 met the criteria for mild depression and 10 met the criteria for moderate depression. There were significant differences in the severity of depression symptoms as measured by the HDRS in the rDD group at the onset of therapy (rDD-I) versus after 8 weeks of treatment (rDD-II). MnSOD gene expression at mRNA and protein level was significantly higher in the HC group compared to the rDD group (p < 0.01). Table 2 presents the correlation between MnSOD expression and the results of the neuropsychological tests for the rDD and HC groups. In both the rDD and HG groups, there was no statistically significant association between mRNA and protein expression levels of the MnSOD and psychological tests. Table 2 also demonstrates a correlation (nonsignificant) between the HDRS and serum MnSOD levels. Table 2 also shows the correlation between both MnSOD mRNA and protein levels and the neuropsychoNeuropsychobiology 2014;70:23–28 DOI: 10.1159/000363340
25
Downloaded by: St. Andrews University 138.251.14.35 - 12/4/2014 11:53:20 AM
BCA Protein Assay A quantity of 0.2 cm3 of BCA reagent (Pierce) was added to 0.01 cm3 of the protein solution (standard and sample) and incubated for 30 min at 37 ° C after thorough mixing. After cooling to room temperature, absorption was measured at a wavelength of 562 nm using a BCA reagent buffer as a control.
Table 2. Spearman’s rank correlation coefficients (R) for the variables tested rDD (n = 131)
TMT A B RCNb Time NCWd Time VFT Animals Sharp objects Letter k AVLT First attempt No of words in 30 min Average of 5 tests HDRS I II
HC (n = 105)
Total (n = 236)
MnSOD mRNA 0.54 ± 0.17 R
MnSOD protein 175.37 ± 64.74
MnSOD mRNA 0.91 ± 0.21 R
MnSOD protein 326.89 ± 87.78
0.9 0.12
0.07 0.10
0.11 0.14
0.17 0.18
–0.35* –0.43*
–0.34* –0.42*
0.04
0.03
–0.14
–0.13
–0.38*
–0.38*
0.11
0.09
0.03
0.06
–0.36*
–0.36*
–0.05 –0.12 –0.04
–0.05 –0.12 –0.04
0.06 –0.01 –0.06
0.06 0.02 –0.08
0.39* 0.22* 0.25*
0.39* 0.23* 0.24*
0.12
0.10
0.04
0.01
0.27*
0.26*
–0.02 0.02
–0.03 0.04
0.11 –0.05
0.07 –0.09
0.26* 0.25*
0.25* 0.25*
0.11 0.07
0.24 0.41
– –
– –
MnSOD mRNA 0.71 ± 0.26 R
MnSOD protein 242.78 ± 106.88
– –
– –
logical tests for the entire group (n = 236). There was a statistically significant correlation between both MnSOD gene levels and the following tests: the TMT parts A and B (negative correlation), the Stroop test parts RCNb (reading color names in black) and NCWd (naming color of word – different; negative correlation), the VFT (positive correlation) and the AVLT (positive correlation).
Discussion
The results of this study demonstrate that both mRNA and protein levels of MnSOD gene expression were lower in the rDD group than in controls. The decrease of these parameters in the rDD group in comparison to HC may indicate the importance of MnSOD in the etiology of recurrent depression. Increased levels of SOD2 in rDD patients in comparison to healthy subjects have been observed in many stud26
Neuropsychobiology 2014;70:23–28 DOI: 10.1159/000363340
ies [9, 10, 19]. However, Herken et al. [20] and Selek et al. [21] obtained opposite results. Selek et al. [21] included patients with depressive phase of bipolar disorder (n = 30). In this group levels of SOD2 were decreased (compared to HC) at the research start point and an increase was observed after 30 days of pharmacological treatment. Gałecki et al. [22] demonstrated that the polymorphisms of the MnSOD gene (Ile-58Thr and Ala-9Val) in rDD patients are associated with the development and course of disease. Cumurcu et al. [23] indicated that the patients with bipolar I disorders (n = 82), major depressive disorder (n = 80) and the controls (n = 96) had a similar distribution of the genotypes and alleles in the Ala-9Val MnSOD gene polymorphism. However, according to the authors one of the limitations of the study is that the sample size was too small. Decreased levels of MnSOD in the group of patients with depression compared to the control group may therefore indicate a dysregulation of defense systems against the negative effects of oxidative Talarowska /Orzechowska /Szemraj /Su / Maes /Gałecki
Downloaded by: St. Andrews University 138.251.14.35 - 12/4/2014 11:53:20 AM
MnSOD mRNA: mean ± SD (2-ΔΔCt method). MnSOD protein: mean ± SD (pg/ml). RCNb = reading color names in black; NCWd = naming color of word – different; HDRS-I = HDRS at therapy onset; HDRS-II = HDRS on day of discharge. * p < 0.05: statistically significant.
stress. The results, which may seem contradictory, can be explained by differences in the duration of illness and severity of depressive disorders in the cited papers [23]. An important finding in our study is the link between cognitive functions and MnSOD mRNA and serum protein levels in the total study group (n = 236) but not in patients with rDD separately. Thus, in the entire group statistically significant correlations occurred between both mRNA and protein levels and all psychological tests. Decreased MnSOD expression was correlated with a worse cognitive functioning in all of these domains. This suggests that both MnSOD mRNA and protein levels affect visual and auditory-verbal working memory, attention span, verbal fluency and auditory-verbal immediate memory, delayed memory and learning ability. A negative correlation between MnSOD expression and ‘frontal’ functions was also found for all participants in this study, which is consistent with previous findings. Thus, further studies should concentrate on MnSOD expression during the course of rDD and examine whether the MnSOD level changes across the various stages of the disorder. The effects of MnSOD on neurocognitive functions may be explained by the known relationships between antioxidant enzymes, increased O&NS, cellular damage by O&NS and neuroprogressive pathways [1, 24]. Neuroprogression entails the neurocognitive decline in depression in relation to reduced brain volume, apoptosis, lowered neurogenesis and neurodegenerative processes. MnSOD (SOD2) forms the first line of defense against damages caused by the excessive mitochondrial production of superoxide anion radicals [25]. Recent studies indicate that MnSOD protects cells in the hippocampal CA1 region from apoptosis [26]. Moreover, MnSOD prevents the release of free radicals in the hippocampal CA3 region during excessive glutamatergic activity [27]. Studies in animal models show that mice with reduced MnSOD levels are more exposed to oxidative stress and have an increased mortality rate [28]. Reduced expression of MnSOD in neurons in the cerebral cortex, cerebellum and basal ganglia is associated with increased neurodegeneration [29]. Moreover, Michel et al. [30] showed that reduced volume of the prefrontal cortex and hippocampus in patients with major depressive disorder is associated with changes in the concentration of MnSOD. No previous reports are available that combine mRNA expression and/or the protein level of MnSOD with cognitive functioning. Significant effects of aberrant MnSOD expression on aging processes have been described in numerous animal [31–33] and human [34] studies. The latter authors [34] emphasize positive correlations between
single nucleotide polymorphism rs4880 (CC/CT) of the MnSOD gene and results of the MMSE and length of life among 1,650 respondents aged over 90 years. Dumont et al. [35] showed in animal studies that the expression of MnSOD is an important factor in the reduction of oxidative stress, visual-spatial memory and prevention of Alzheimer’s disease. Deficiencies in the antioxidant effects of MnSOD led to increased deposition of amyloid plaques [36] and higher phosphorylation of tau protein [37] and accelerated the onset of behavioral changes [38] in animal models of Alzheimer’s disease. The results of our study, in conjunction with the existing literature [24], suggest that weakened antioxidative defenses may be observed in patients with depressive disorders. These factors may lead to alterations in protein and fatty acid structure, cellular and mitochondrial DNA damage and, consequently, neuroprogression, including increased apoptosis and neurodegeneration [24]. It is important to investigate gene expression in the whole blood supply as well as the central nervous system, as these enzymes are mainly expressed in the periphery and this blood is more accessible. There is also strong evidence that peripheral molecules can also affect neurons. Peripheral blood cells share more than 80% of the transcription with 9 tissues, including the brain [39].
MnSOD and Cognition
Neuropsychobiology 2014;70:23–28 DOI: 10.1159/000363340
Conclusion
Our study provides evidence that the MnSOD enzyme-coding gene and MnSOD expression are important for the regulation of cognitive functioning. Acknowledgments
References
1 Leonard B, Maes M: Mechanistic explanations how cell-mediated immune activation, inflammation and oxidative and nitrosative stress pathways and their sequels and concomitants play a role in the pathophysiology of unipolar depression. Neurosci Biobehav Rev 2012;36:764–785. 2 Dowlati Y, Hermann N, Swardfager W, Liu H, Sham L, Reim EK, Lanctot KL: A meta-analysis of cytokines in major depression. Biol Psychiatry 2010;67:446–457.
27
Downloaded by: St. Andrews University 138.251.14.35 - 12/4/2014 11:53:20 AM
This study was supported by funding from the Medical University of Lodz (grant No. 502-03/5-062-02/502-54-065) and scientific research grants from the National Science Centre (No. 2011/01/D/HS6/05484 and 2012/05/B/NZ5/01452).
28
18 Kirkwood B, Sterne J: Essential Medical Statistics, ed 2. Wiley-Bleckwell, 2003. 19 Szuster-Ciesielska A, Słotwińska M, Stachura A, Marmurowska-Michałowska H, Dubas-Slemp H, Bojarska-Junak A, KandeferSzerszeń M: Accelerated apoptosis of blood leukocytes and oxidative stress in blood of patients with major depression. Prog Neuropsychopharmacol Biol Psychiatry 2008; 32: 686– 694. 20 Herken H, Gurel A, Selek S, Armutcu F, Ozen ME, Bulut M, Kap O, Yumru M, Savas HA, Akyol O: Adenosine deaminase, nitric oxide, superoxide dismutase, and xanthine oxidase in patients with major depression: impact of antidepressant treatment. Arch Med Res 2007;38:247–252. 21 Selek S, Savas HA, Gergerlioglu HS, Bulbul F, Uz E, Yumru M: The course of nitric oxide and superoxide dismutase during treatment of bipolar depressive episode. J Affect Disord 2008;107:89–94. 22 Gałecki P, Szemraj J, Bieńkiewicz M, Florkowski A, Gałecka E: Lipid peroxidation and antioxidant protection in patients during acute depressive episodes and in remission after fluoxetine treatment. Pharmacol Rep 2009;61:436–447. 23 Cumurcu BE, Ozyurt H, Ates O, Gul IG, Demir S, Karlıdag R: Analysis of manganese superoxide dismutase (MnSOD: Ala-9Val) and glutathione peroxidase (GSH-Px: Pro 197 Leu) gene polymorphisms in mood disorders. Bosn J Basic Med Sci 2013;13:109–113. 24 Maes M: Depression is an inflammatory disease, but cell-mediated immune activation is the key component of depression. Prog Neuropsychopharmacol Biol Psychiatry 2011; 35: 664–675. 25 Valko M, Leibfritz D, Moncol J, Cronin MT, Mazur M, Telser J: Free radicals and antioxidants in normal physiological functions and human disease. Int J Biochem Cell Biol 2007; 39:44–84. 26 Müller GJ, Lassmann H, Johansen FF: Antiapoptotic signaling and failure of apoptosis in the ischemic rat hippocampus. Neurobiol Dis 2007;25:582–593. 27 Radenović L, Selaković V, Kartelija G: Mitochondrial superoxide production and MnSOD activity after exposure to agonist and antagonists of ionotropic glutamate receptors in hippocampus. Ann NY Acad Sci 2005; 1048: 363–365. 28 Li Y, Huang TT, Carlson EJ, Melov S, Ursell PC, Olson JL, Noble LJ, Yoshimura MP, Berger C, Chan PH, Wallace DC, Epstein CJ: Dilated cardiomyopathy and neonatal lethality in mutant mice lacking manganese superoxide dismutase. Nat Genet 1995; 11: 376– 381. 29 Herring A, Blome M, Ambrée O, Sachser N, Paulus W, Keyvani K: Reduction of cerebral oxidative stress following environmental enrichment in mice with Alzheimer-like pathology. Brain Pathol 2010;20:166–175.
Neuropsychobiology 2014;70:23–28 DOI: 10.1159/000363340
30 Michel TM, Frangou S, Thiemeyer D, Camara S, Jecel J, Nara K, Brunklaus A, Zoechling R, Riederer P: Evidence for oxidative stress in the frontal cortex in patients with recurrent depressive disorder – a postmortem study. Psychiatry Res 2007;151:145–150. 31 Fabrizio P, Liou LL, Moy VN, Diaspro A, Valentine JS, Gralla EB, Longo VD: SOD2 functions downstream of Sch9 to extend longevity in yeast. Genetics 2003;163:35–46. 32 Hinerfeld D, Traini MD, Weinberger RP, Cochran B, Doctrow SR, Harry J, Melov S: Endogenous mitochondrial oxidative stress: neurodegeneration, proteomic analysis, specific respiratory chain defects, and efficacious antioxidant therapy in superoxide dismutase 2 null mice. J Neurochem 2004;88:657–667. 33 Hu D, Cao P, Thiels E, Chu CT, Wu GY, Oury TD, Klann E: Hippocampal long-term potentiation, memory, and longevity in mice that overexpress mitochondrial superoxide dismutase. Neurobiol Learn Mem 2007; 87: 372– 384. 34 Soerensen M, Christensen K, Stevnsner T, Christiansen L: The Mn-superoxide dismutase single nucleotide polymorphism rs4880 and the glutathione peroxidase 1 single nucleotide polymorphism rs1050450 are associated with aging and longevity in the oldest old. Mech Ageing Dev 2009;130:308–314. 35 Dumont M, Wille E, Stack C, Calingasan NY, Beal MF, Lin MT: Reduction of oxidative stress, amyloid deposition, and memory deficit by manganese superoxide dismutase overexpression in a transgenic mouse model of Alzheimer’s disease. FASEB J 2009; 23: 2459– 2466. 36 Li F, Calingasan NY, Yu F, Mauck WM, Toidze M, Almeida CG, Takahashi RH, Carlson GA, Flint Beal M, Lin MT, Gouras GK: Increased plaque burden in brains of APP mutant MnSOD heterozygous knockout mice. J Neurochem 2004;89:1308–1312. 37 Melov S, Adlard PA, Morten K, Johnson F, Golden TR, Hinerfeld D, Schilling B, Mavros C, Masters CL, Volitakis I, Li QX, Laughton K, Hubbard A, Cherny RA, Gibson B, Bush AI: Mitochondrial oxidative stress causes hyperphosphorylation of tau. PLoS One 2007; 2:e536. 38 Esposito L, Raber J, Kekonius L, Yan F, Yu GQ, Bien-Ly N, Puolivali J, Scearce-Levie K, Masliah E, Mucke L: Reduction in mitochondrial superoxide dismutase modulates Alzheimer’s disease-like pathology and accelerates the onset of behavioral changes in human amyloid precursor protein transgenic mice. J Neurosci 2006;26:5167–5179. 39 Mehta D, Menke A, Binder EB: Gene expression studies in major depression. Cur Psychiatry Rep 12010;2:135–144.
Talarowska /Orzechowska /Szemraj /Su / Maes /Gałecki
Downloaded by: St. Andrews University 138.251.14.35 - 12/4/2014 11:53:20 AM
3 Maes M, Gałecki P, Chang YS, Berk M: A review on the oxidative and nitrosative stress (O&NS) pathways in major depression and their possible contribution to the (neuro)degenerative processes in that illness. Prog Neuropsychopharmacol Biol Psychiatry 2011; 35: 676–692. 4 Raison CL, Capuron L, Miller AH: Cytokines sing the blues: inflammation and the pathogenesis of depression. Trends Immunol 2006; 27:24–31. 5 Maes M, Berk M, Goehler L, Song C, Anderson G, Gałecki P, Leonard B: Depression and sickness behavior are Janus-faced responses to shared inflammatory pathways. BMC Med 2012;10:66. 6 Dantzer R, O’Connor JC, Freund GG, Johnson RW, Kelley KW: From inflammation to sickness and depression: when the immune system subjugates the brain. Nat Rev Neurosci 2008;9:46–56. 7 Johnson F, Giulivi C: Superoxide dismutases and their impact upon human health. Mol Aspect Med 2005;26:340–352. 8 Halliwell B: Oxidative stress and neurodegeneration: where are we now? J Neurochem 2006;97:1634–1658. 9 Khanzode SD, Dakhale GN, Khanzode SS, Saoji A, Palasodkar R: Oxidative damage and major depression: the potential antioxidant action of selective serotonin re-uptake inhibitors. Redox Rep 2003;8:365–370. 10 Sarandol A, Sarandol E, Eker SS, Erdinc S, Vatansever E, Kirli S: Major depressive disorder is accompanied with oxidative stress: short-term antidepressant treatment does not alter oxidative-antioxidative systems. Hum Psychopharmacol 2007;22:67–73. 11 ICD-10 Classification of Mental and Behavioural Disorders. Geneva, World Health Organization, 1993. 12 Patten SB: Performance of the Composite International Diagnostic Interview Short Form for major depression in community and clinical samples. Chronic Dis Can 1997; 18: 109– 112. 13 Talarowska M, Gałecki P, Maes M, Bobińska K, Kowalczyk E: Total antioxidant status correlates with cognitive impairment in patients with recurrent depressive disorder. Neurochem Res 2012;37:1761–1767. 14 Hamilton M: A rating scale for depression. J Neurol Neurosurg Psychiatry 1960;23:56–62. 15 Demyttenaere K, De Fruyt J: Getting what you ask for: on the selectivity of depression rating scales. Psychother Psychosom 2003;72:61–70. 16 Chomczyński P, Sacchi N: Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987;162:156–159. 17 Winer J, Jung CK, Shackel I, Williams PM: Development and validation of real-time quantitative reverse transcriptase-polymerase chain reaction for monitoring gene expression in cardiac myocytes in vitro. Anal Biochem 1999;270:41–49.
Received: October 17, 2013 Accepted after revision: April 28, 2014 Published online: August 21, 2014
Manganese Superoxide Dismutase Gene Expression and Cognitive Functions in Recurrent Depressive Disorder Monika Talarowska a Agata Orzechowska a Janusz Szemraj b Kuan-Pin Su c Michael Maes d, e Piotr Gałecki a Departments of a Adult Psychiatry and b Medical Biochemistry, Medical University of Lodz, Lodz, Poland; c Department of Psychiatry and Mind-Body Interface Laboratory (MBI-Lab), China Medical University Hospital, Taichung, Taiwan, ROC; d Department of Psychiatry, Deakin University, Geelong, Vic., Australia; e Department of Psychiatry, Chulalongkorn University, Bangkok, Thailand
Abstract Background: Recent studies have revealed that recurrent depressive disorders (rDD) are linked with dysregulation of the immune system. Previous studies have found that manganese superoxide dismutase (MnSOD, SOD2) may be a key inflammatory enzyme involved in this disorder. The purpose of this study was to determine the mRNA and protein levels of MnSOD in patients with rDD and to define the relationship between serum MnSOD levels and cognitive performance. Methods: The study comprised 236 subjects, which included patients with rDD (n = 131) and healthy subjects (n = 105, healthy control group, HC). Assessment of cognitive function was based on performance on the Trail Making test (TMT), the Stroop test, the Verbal Fluency test (VFT) and the Auditory Verbal Learning test (AVLT). Results: MnSOD gene expression at mRNA and protein level was significantly lower in rDD patients than in the HC group (p < 0.01). In the rDD and HC groups separately, there were no statistically significant associations between mRNA and protein expression levels of the MnSOD and psychological tests. In the total study group (n = 236), there was a statistically significant correlation be-
© 2014 S. Karger AG, Basel 0302–282X/14/0701–0023$39.50/0 E-Mail [email protected] www.karger.com/nps
tween both MnSOD gene levels and the following tests (p < 0.01): the TMT parts A and B (negative correlation), the Stroop test parts RCNb (reading color names in black) and NCWd (naming color of word – different; negative correlation), the VFT (positive correlation) and the AVLT (positive correlation). Conclusions: Our study provides evidence that the MnSOD enzyme-coding gene and MnSOD expression are important for the regulation of cognitive functioning. © 2014 S. Karger AG, Basel
Introduction
Most researchers agree that there are multiple factors influencing the development of recurrent depressive disorder (rDD). There is now evidence that immune-inflammatory and oxidative and nitrosative stress (O&NS) pathways play a role in depression and staging of depression [1]. Increased levels of proinflammatory cytokines and indicants of O&NS, including changes in antioxidant enzymes, are among the most robust biomarkers of depressive disorders [2–4]. Acute inflammatory reactions and depressive disorders share many symptoms such as fatigue, sleep disturbances, anxiety, depressed mood, loss of appetite, psychomotor retardation and neurocognitive defects [5, 6]. Monika Talarowska Department of Adult Psychiatry, Medical University of Lodz Aleksandrowska 159 PL–91-229 Lodz (Poland) E-Mail talarowskamonika @ wp.pl
Downloaded by: St. Andrews University 138.251.14.35 - 12/4/2014 11:53:20 AM
Key Words Depression · Cognition · Inflammation · Manganese superoxide dismutase
Methods Patients The study was carried out in a group of 236 subjects aged 20–67 years (mean = 39.79, standard deviation, SD = 14.02), which included patients with rDD (n = 131) and a control group of healthy subjects (HC group, n = 105). All the patients were native inhabitants of central Poland and were unrelated to one another. The selection of individuals for the study group was performed randomly without replacement sampling. Table 1 presents characteristics of the case and control groups, including gender, age and education. There were statistically significant differences between the two groups in gender distribution (χ2 = 1.46, p = 0.027), years of education (Z = 3.18, p = 0.001) and age (Z = 10.44, p = 0.001). Experimental Protocol Patients were selected for the study based on the inclusion criteria for rDD outlined in the ICD-10 (F32.0-7.32.2, F33.0-F33.8) [11]. All subjects were examined during the course of their hospitalization and did not present with concurrent diagnoses of somatic diseases or axis I and II disorders other than depressive episodes. Other exclusion criteria included inflammatory or autoimmune disorders, unwillingness to give informed consent and injuries to the central nervous system that could have affected cognitive function. For all subjects, a case history was obtained prior to participation using the standardized Composite International Diagnostic Interview (CIDI) [12]. The HC consisted of 105 healthy subjects without any family history of psychiatric disorders. The HC included community volunteers who were enrolled based on the criteria of the psychiatric CIDI interview [12]. Control subjects with other psychiatric diagnoses, axis I and II disorders, neurological disorders, or substance abuse or dependence were excluded from the study. On the basis of medical records and diagnostic interviews, it was established that none of the participants had been diagnosed
24
Neuropsychobiology 2014;70:23–28 DOI: 10.1159/000363340
Table 1. Demographic characteristics of the rDD group versus the HC group and data concerning the course of the disease
Characteristics
Gender Female Male Age, years Education, years
rDD (n = 131)
HC (n = 105)
n
%
mean ± SD
n
% mean ± SD
76 55 – –
58 42 – –
– – 48.53 ± 11.05 12.46 ± 2.49
69 36 – –
66 34 – –
– – 28.91 ± 8.69 14.71 ± 2.51
with a mental disability or any relevant intellectual deficits. All subjects were free from medical illnesses, including infections and inflammatory or allergic reactions. None of the control subjects or depressed patients was treated with drugs known to influence lipid metabolism, immune response or endocrine function. The control subjects were free of all medications for at least 2 months prior to blood sampling. None of the participants were drinkers or heavy smokers, and none had ever taken psychotropic drugs. Cognitive Function Assessment Assessment of cognitive function was based on the Trail Making test (TMT), the Stroop test, the Auditory Verbal Learning test (AVLT) and the Verbal Fluency test (VFT). Descriptions of these tests have been presented elsewhere [13]. Severity of Depression Depression severity was assessed with the 21-item Hamilton Depression Rating Scale (HDRS) [14, 15]. For the patients with rDD, the HDRS, Stroop Test, TMT, AVLT and VFT were administered at admission during the symptomatic phase, which would generally be either before or shortly after modification of the previous antidepressant drug regimen. In the HC group, neuropsychological tests were performed during a single examination. Examination of patients was conducted by the same person in each case: the same psychologist examined the patients with neuropsychological tests, including an evaluation of the obtained results, while the HDRS test was performed by the same psychiatrist. Determination of Protein Concentration The test protein levels were measured in blood serum levels for each patient. These tests were preceded by a determination of serum total protein. Two measurement techniques were employed [16]. Spectrophotometric Protein Assay Protein levels were detected with a GeneQuest spectrophotometer (Pharmacia Biotech). Absorption measurements were performed automatically at wavelengths of 260, 280 and 320 nm, and protein concentrations were calculated according to the Warburg formula: protein concentration (mg/cm3) = 1.55 (A280–A320) – 0.76 (A260–A320).
Talarowska /Orzechowska /Szemraj /Su / Maes /Gałecki
Downloaded by: St. Andrews University 138.251.14.35 - 12/4/2014 11:53:20 AM
Superoxide dismutases (SOD) play a key role among antioxidant enzymes that protect the brain from ROS. In the human body, there are three isoforms of SOD: copper-zinc SOD (Cu-ZnSOD, SOD1), mitochondrial with manganese inside the active centers of the enzyme (MnSOD, SOD2) and extracellular SOD (EC-SOD, SOD3), which also contains zinc and copper in its structure [7]. The main role of MnSOD is to protect cells from the damaging effects of ROS [8]. Previous studies have found that SOD2 may be a key inflammatory enzyme involved in the development of rDD [9, 10]. The purpose of this study was to determine both mRNA and protein levels of MnSOD in patients with rDD and to investigate the relationship between serum MnSOD levels and cognitive performance. Since inflammatory conditions are accompanied by neurocognitive defects [5], we hypothesized that the levels of MnSOD gene expression might also be associated with cognitive functioning in depression.
Determination of Serum SOD2 Protein Level For the quantitative detection of serum SOD2 protein levels, a commercial kit, NWLSSTM MnSOD ELISA, was used (Northwest Life Science Specialties LLC, Vancouver, Wash., USA). Measurement of mRNA Expression: Quantitative Real-Time PCR RNA Purification and RT-PCR Amplification The human MnSOD and GADPH expression was quantified by real-time PCR using ABI Prism 7000 Sequence Detection System (Applied Biosystems, Foster City, Calif., USA) according to the manufacturer’s protocol. Total cellular RNAs were extracted from whole blood cells of patients using the Trizol reagent (Invitrogen, Groningen, the Netherlands) method, a single-step purification protocol. Concentration and purity of the RNA were measured by UV spectrophotometry. Polyadenylated RNA was isolated using an Oligotex kit (Qiagen, Chatsworth, Calif., USA); 50 ng poly(A) RNA was then used for cDNA synthesis using the TaqMan reverse transcription reagent kit (Applied Biosystems) according to the manufacturer’s protocol. Briefly, 2.5, 2.0, 1.5, 1.0, 0.5 and 0.25 μl of synthesized cDNA were amplified in triplicate for both GADPH and each of the target genes to create a standard curve. Likewise, 2 μl of cDNA was amplified in triplicate in all isolated samples for each primer/probe combination and GADPH. Each sample was supplemented with both respective 0.3 μM forward and reverse primers and fluorescent probe, and made up to 50 μl using qPCR Master Mix for SYBRTM Green I (Eurogentec, Seraing, Belgium). All following PCR primers were designed using Primer Express software (Applied Biosystems): forward 5′ CTGGACAAACCTCAGCCCTA 3′, reverse 5′ TGATGGCTTCCAGCAACTC 3′ and forward 5′ AGCCACATCGCTCAGACAC 3′, reverse 5′ GCCCAATACGACCAAATCC 3′, specific for mRNA of human MnSOD and GADPH, respectively. The housekeeping gene GADPH was used as an active and endogenous reference to correct for differences in the amount of total RNA added to the reaction solution and to compensate for different levels of inhibition during reverse transcription of RNA and during PCR. Each target probe was amplified in separate 96-well plates. All samples were incubated at 50 ° C for 2 min and at 95 ° C for 10 min and then cycled at 95 ° C for 30 s, 56 ° C for 1 min and 72 ° C for 1 min for 40 cycles. SYBR Green I fluorescence emission data were captured and mRNA levels were quantified using the critical threshold (Ct) value. Analyses were performed with ABI Prism 7000 (SDS Software). Controls without reverse transcription and with no template cDNA were performed with each assay. To compensate for variations in input RNA amounts and efficiency of reverse transcription, GADPH mRNA was quantified and results were normalized to these values. Relative gene expression levels were obtained using the ∆∆Ct method [17]. Amplification-specific transcripts were further confirmed by obtaining melting curve profiles. The chance of developing the disease in people having one of the evaluated genotypes in comparison to people lacking this genotype, i.e. the correlation power, was calculated with relative risk.
MnSOD and Cognition
Statistical Analysis Statistical analysis of the collected material included calculation of both descriptive and inferential statistics. A two-tailed critical region was employed in the statistical hypothesis testing. Qualitative characteristics of the experimental and control groups are expressed as frequencies shown as percentages. To characterize the average values for quantitative features, the arithmetical mean and median were calculated. The measures of statistical dispersion included the range of values between the minimum and the maximum, as well as the SD. Distributions were analyzed using the Shapiro-Wilk test. To compare nonparametric variables in the test groups, the following tests were used: the Pearson χ2 for qualitative variables, the Wilcoxon signed-rank test for two related groups for quantitative variables, and the Mann-Whitney U test for two independent groups to determine the coincidence of distributions. To evaluate the relations between analyzed variables, Spearman’s R rank order correlation coefficients were estimated. For all analyses, statistical significance was defined as p < 0.05 [18]. All data analyses were performed using STATISTICA version 10. Ethics Before deciding to participate in the study, subjects were informed of the study purpose, assured of voluntary participation and guaranteed personal data confidentiality. Written informed consent was obtained according to the study protocol approved by the Bioethical Committee of the Medical University of Lodz (No. RNN/603/08/KB).
Results
Upon admission, 7 subjects met the HDRS score criteria for a mild depressive episode, 17 for a moderate depressive episode, 85 for a severe depressive episode and 22 for a very severe depressive episode. On the day of discharge, 85 subjects did not meet the HDRS criteria for depressive disorder, 36 met the criteria for mild depression and 10 met the criteria for moderate depression. There were significant differences in the severity of depression symptoms as measured by the HDRS in the rDD group at the onset of therapy (rDD-I) versus after 8 weeks of treatment (rDD-II). MnSOD gene expression at mRNA and protein level was significantly higher in the HC group compared to the rDD group (p < 0.01). Table 2 presents the correlation between MnSOD expression and the results of the neuropsychological tests for the rDD and HC groups. In both the rDD and HG groups, there was no statistically significant association between mRNA and protein expression levels of the MnSOD and psychological tests. Table 2 also demonstrates a correlation (nonsignificant) between the HDRS and serum MnSOD levels. Table 2 also shows the correlation between both MnSOD mRNA and protein levels and the neuropsychoNeuropsychobiology 2014;70:23–28 DOI: 10.1159/000363340
25
Downloaded by: St. Andrews University 138.251.14.35 - 12/4/2014 11:53:20 AM
BCA Protein Assay A quantity of 0.2 cm3 of BCA reagent (Pierce) was added to 0.01 cm3 of the protein solution (standard and sample) and incubated for 30 min at 37 ° C after thorough mixing. After cooling to room temperature, absorption was measured at a wavelength of 562 nm using a BCA reagent buffer as a control.
Table 2. Spearman’s rank correlation coefficients (R) for the variables tested rDD (n = 131)
TMT A B RCNb Time NCWd Time VFT Animals Sharp objects Letter k AVLT First attempt No of words in 30 min Average of 5 tests HDRS I II
HC (n = 105)
Total (n = 236)
MnSOD mRNA 0.54 ± 0.17 R
MnSOD protein 175.37 ± 64.74
MnSOD mRNA 0.91 ± 0.21 R
MnSOD protein 326.89 ± 87.78
0.9 0.12
0.07 0.10
0.11 0.14
0.17 0.18
–0.35* –0.43*
–0.34* –0.42*
0.04
0.03
–0.14
–0.13
–0.38*
–0.38*
0.11
0.09
0.03
0.06
–0.36*
–0.36*
–0.05 –0.12 –0.04
–0.05 –0.12 –0.04
0.06 –0.01 –0.06
0.06 0.02 –0.08
0.39* 0.22* 0.25*
0.39* 0.23* 0.24*
0.12
0.10
0.04
0.01
0.27*
0.26*
–0.02 0.02
–0.03 0.04
0.11 –0.05
0.07 –0.09
0.26* 0.25*
0.25* 0.25*
0.11 0.07
0.24 0.41
– –
– –
MnSOD mRNA 0.71 ± 0.26 R
MnSOD protein 242.78 ± 106.88
– –
– –
logical tests for the entire group (n = 236). There was a statistically significant correlation between both MnSOD gene levels and the following tests: the TMT parts A and B (negative correlation), the Stroop test parts RCNb (reading color names in black) and NCWd (naming color of word – different; negative correlation), the VFT (positive correlation) and the AVLT (positive correlation).
Discussion
The results of this study demonstrate that both mRNA and protein levels of MnSOD gene expression were lower in the rDD group than in controls. The decrease of these parameters in the rDD group in comparison to HC may indicate the importance of MnSOD in the etiology of recurrent depression. Increased levels of SOD2 in rDD patients in comparison to healthy subjects have been observed in many stud26
Neuropsychobiology 2014;70:23–28 DOI: 10.1159/000363340
ies [9, 10, 19]. However, Herken et al. [20] and Selek et al. [21] obtained opposite results. Selek et al. [21] included patients with depressive phase of bipolar disorder (n = 30). In this group levels of SOD2 were decreased (compared to HC) at the research start point and an increase was observed after 30 days of pharmacological treatment. Gałecki et al. [22] demonstrated that the polymorphisms of the MnSOD gene (Ile-58Thr and Ala-9Val) in rDD patients are associated with the development and course of disease. Cumurcu et al. [23] indicated that the patients with bipolar I disorders (n = 82), major depressive disorder (n = 80) and the controls (n = 96) had a similar distribution of the genotypes and alleles in the Ala-9Val MnSOD gene polymorphism. However, according to the authors one of the limitations of the study is that the sample size was too small. Decreased levels of MnSOD in the group of patients with depression compared to the control group may therefore indicate a dysregulation of defense systems against the negative effects of oxidative Talarowska /Orzechowska /Szemraj /Su / Maes /Gałecki
Downloaded by: St. Andrews University 138.251.14.35 - 12/4/2014 11:53:20 AM
MnSOD mRNA: mean ± SD (2-ΔΔCt method). MnSOD protein: mean ± SD (pg/ml). RCNb = reading color names in black; NCWd = naming color of word – different; HDRS-I = HDRS at therapy onset; HDRS-II = HDRS on day of discharge. * p < 0.05: statistically significant.
stress. The results, which may seem contradictory, can be explained by differences in the duration of illness and severity of depressive disorders in the cited papers [23]. An important finding in our study is the link between cognitive functions and MnSOD mRNA and serum protein levels in the total study group (n = 236) but not in patients with rDD separately. Thus, in the entire group statistically significant correlations occurred between both mRNA and protein levels and all psychological tests. Decreased MnSOD expression was correlated with a worse cognitive functioning in all of these domains. This suggests that both MnSOD mRNA and protein levels affect visual and auditory-verbal working memory, attention span, verbal fluency and auditory-verbal immediate memory, delayed memory and learning ability. A negative correlation between MnSOD expression and ‘frontal’ functions was also found for all participants in this study, which is consistent with previous findings. Thus, further studies should concentrate on MnSOD expression during the course of rDD and examine whether the MnSOD level changes across the various stages of the disorder. The effects of MnSOD on neurocognitive functions may be explained by the known relationships between antioxidant enzymes, increased O&NS, cellular damage by O&NS and neuroprogressive pathways [1, 24]. Neuroprogression entails the neurocognitive decline in depression in relation to reduced brain volume, apoptosis, lowered neurogenesis and neurodegenerative processes. MnSOD (SOD2) forms the first line of defense against damages caused by the excessive mitochondrial production of superoxide anion radicals [25]. Recent studies indicate that MnSOD protects cells in the hippocampal CA1 region from apoptosis [26]. Moreover, MnSOD prevents the release of free radicals in the hippocampal CA3 region during excessive glutamatergic activity [27]. Studies in animal models show that mice with reduced MnSOD levels are more exposed to oxidative stress and have an increased mortality rate [28]. Reduced expression of MnSOD in neurons in the cerebral cortex, cerebellum and basal ganglia is associated with increased neurodegeneration [29]. Moreover, Michel et al. [30] showed that reduced volume of the prefrontal cortex and hippocampus in patients with major depressive disorder is associated with changes in the concentration of MnSOD. No previous reports are available that combine mRNA expression and/or the protein level of MnSOD with cognitive functioning. Significant effects of aberrant MnSOD expression on aging processes have been described in numerous animal [31–33] and human [34] studies. The latter authors [34] emphasize positive correlations between
single nucleotide polymorphism rs4880 (CC/CT) of the MnSOD gene and results of the MMSE and length of life among 1,650 respondents aged over 90 years. Dumont et al. [35] showed in animal studies that the expression of MnSOD is an important factor in the reduction of oxidative stress, visual-spatial memory and prevention of Alzheimer’s disease. Deficiencies in the antioxidant effects of MnSOD led to increased deposition of amyloid plaques [36] and higher phosphorylation of tau protein [37] and accelerated the onset of behavioral changes [38] in animal models of Alzheimer’s disease. The results of our study, in conjunction with the existing literature [24], suggest that weakened antioxidative defenses may be observed in patients with depressive disorders. These factors may lead to alterations in protein and fatty acid structure, cellular and mitochondrial DNA damage and, consequently, neuroprogression, including increased apoptosis and neurodegeneration [24]. It is important to investigate gene expression in the whole blood supply as well as the central nervous system, as these enzymes are mainly expressed in the periphery and this blood is more accessible. There is also strong evidence that peripheral molecules can also affect neurons. Peripheral blood cells share more than 80% of the transcription with 9 tissues, including the brain [39].
MnSOD and Cognition
Neuropsychobiology 2014;70:23–28 DOI: 10.1159/000363340
Conclusion
Our study provides evidence that the MnSOD enzyme-coding gene and MnSOD expression are important for the regulation of cognitive functioning. Acknowledgments
References
1 Leonard B, Maes M: Mechanistic explanations how cell-mediated immune activation, inflammation and oxidative and nitrosative stress pathways and their sequels and concomitants play a role in the pathophysiology of unipolar depression. Neurosci Biobehav Rev 2012;36:764–785. 2 Dowlati Y, Hermann N, Swardfager W, Liu H, Sham L, Reim EK, Lanctot KL: A meta-analysis of cytokines in major depression. Biol Psychiatry 2010;67:446–457.
27
Downloaded by: St. Andrews University 138.251.14.35 - 12/4/2014 11:53:20 AM
This study was supported by funding from the Medical University of Lodz (grant No. 502-03/5-062-02/502-54-065) and scientific research grants from the National Science Centre (No. 2011/01/D/HS6/05484 and 2012/05/B/NZ5/01452).
28
18 Kirkwood B, Sterne J: Essential Medical Statistics, ed 2. Wiley-Bleckwell, 2003. 19 Szuster-Ciesielska A, Słotwińska M, Stachura A, Marmurowska-Michałowska H, Dubas-Slemp H, Bojarska-Junak A, KandeferSzerszeń M: Accelerated apoptosis of blood leukocytes and oxidative stress in blood of patients with major depression. Prog Neuropsychopharmacol Biol Psychiatry 2008; 32: 686– 694. 20 Herken H, Gurel A, Selek S, Armutcu F, Ozen ME, Bulut M, Kap O, Yumru M, Savas HA, Akyol O: Adenosine deaminase, nitric oxide, superoxide dismutase, and xanthine oxidase in patients with major depression: impact of antidepressant treatment. Arch Med Res 2007;38:247–252. 21 Selek S, Savas HA, Gergerlioglu HS, Bulbul F, Uz E, Yumru M: The course of nitric oxide and superoxide dismutase during treatment of bipolar depressive episode. J Affect Disord 2008;107:89–94. 22 Gałecki P, Szemraj J, Bieńkiewicz M, Florkowski A, Gałecka E: Lipid peroxidation and antioxidant protection in patients during acute depressive episodes and in remission after fluoxetine treatment. Pharmacol Rep 2009;61:436–447. 23 Cumurcu BE, Ozyurt H, Ates O, Gul IG, Demir S, Karlıdag R: Analysis of manganese superoxide dismutase (MnSOD: Ala-9Val) and glutathione peroxidase (GSH-Px: Pro 197 Leu) gene polymorphisms in mood disorders. Bosn J Basic Med Sci 2013;13:109–113. 24 Maes M: Depression is an inflammatory disease, but cell-mediated immune activation is the key component of depression. Prog Neuropsychopharmacol Biol Psychiatry 2011; 35: 664–675. 25 Valko M, Leibfritz D, Moncol J, Cronin MT, Mazur M, Telser J: Free radicals and antioxidants in normal physiological functions and human disease. Int J Biochem Cell Biol 2007; 39:44–84. 26 Müller GJ, Lassmann H, Johansen FF: Antiapoptotic signaling and failure of apoptosis in the ischemic rat hippocampus. Neurobiol Dis 2007;25:582–593. 27 Radenović L, Selaković V, Kartelija G: Mitochondrial superoxide production and MnSOD activity after exposure to agonist and antagonists of ionotropic glutamate receptors in hippocampus. Ann NY Acad Sci 2005; 1048: 363–365. 28 Li Y, Huang TT, Carlson EJ, Melov S, Ursell PC, Olson JL, Noble LJ, Yoshimura MP, Berger C, Chan PH, Wallace DC, Epstein CJ: Dilated cardiomyopathy and neonatal lethality in mutant mice lacking manganese superoxide dismutase. Nat Genet 1995; 11: 376– 381. 29 Herring A, Blome M, Ambrée O, Sachser N, Paulus W, Keyvani K: Reduction of cerebral oxidative stress following environmental enrichment in mice with Alzheimer-like pathology. Brain Pathol 2010;20:166–175.
Neuropsychobiology 2014;70:23–28 DOI: 10.1159/000363340
30 Michel TM, Frangou S, Thiemeyer D, Camara S, Jecel J, Nara K, Brunklaus A, Zoechling R, Riederer P: Evidence for oxidative stress in the frontal cortex in patients with recurrent depressive disorder – a postmortem study. Psychiatry Res 2007;151:145–150. 31 Fabrizio P, Liou LL, Moy VN, Diaspro A, Valentine JS, Gralla EB, Longo VD: SOD2 functions downstream of Sch9 to extend longevity in yeast. Genetics 2003;163:35–46. 32 Hinerfeld D, Traini MD, Weinberger RP, Cochran B, Doctrow SR, Harry J, Melov S: Endogenous mitochondrial oxidative stress: neurodegeneration, proteomic analysis, specific respiratory chain defects, and efficacious antioxidant therapy in superoxide dismutase 2 null mice. J Neurochem 2004;88:657–667. 33 Hu D, Cao P, Thiels E, Chu CT, Wu GY, Oury TD, Klann E: Hippocampal long-term potentiation, memory, and longevity in mice that overexpress mitochondrial superoxide dismutase. Neurobiol Learn Mem 2007; 87: 372– 384. 34 Soerensen M, Christensen K, Stevnsner T, Christiansen L: The Mn-superoxide dismutase single nucleotide polymorphism rs4880 and the glutathione peroxidase 1 single nucleotide polymorphism rs1050450 are associated with aging and longevity in the oldest old. Mech Ageing Dev 2009;130:308–314. 35 Dumont M, Wille E, Stack C, Calingasan NY, Beal MF, Lin MT: Reduction of oxidative stress, amyloid deposition, and memory deficit by manganese superoxide dismutase overexpression in a transgenic mouse model of Alzheimer’s disease. FASEB J 2009; 23: 2459– 2466. 36 Li F, Calingasan NY, Yu F, Mauck WM, Toidze M, Almeida CG, Takahashi RH, Carlson GA, Flint Beal M, Lin MT, Gouras GK: Increased plaque burden in brains of APP mutant MnSOD heterozygous knockout mice. J Neurochem 2004;89:1308–1312. 37 Melov S, Adlard PA, Morten K, Johnson F, Golden TR, Hinerfeld D, Schilling B, Mavros C, Masters CL, Volitakis I, Li QX, Laughton K, Hubbard A, Cherny RA, Gibson B, Bush AI: Mitochondrial oxidative stress causes hyperphosphorylation of tau. PLoS One 2007; 2:e536. 38 Esposito L, Raber J, Kekonius L, Yan F, Yu GQ, Bien-Ly N, Puolivali J, Scearce-Levie K, Masliah E, Mucke L: Reduction in mitochondrial superoxide dismutase modulates Alzheimer’s disease-like pathology and accelerates the onset of behavioral changes in human amyloid precursor protein transgenic mice. J Neurosci 2006;26:5167–5179. 39 Mehta D, Menke A, Binder EB: Gene expression studies in major depression. Cur Psychiatry Rep 12010;2:135–144.
Talarowska /Orzechowska /Szemraj /Su / Maes /Gałecki
Downloaded by: St. Andrews University 138.251.14.35 - 12/4/2014 11:53:20 AM
3 Maes M, Gałecki P, Chang YS, Berk M: A review on the oxidative and nitrosative stress (O&NS) pathways in major depression and their possible contribution to the (neuro)degenerative processes in that illness. Prog Neuropsychopharmacol Biol Psychiatry 2011; 35: 676–692. 4 Raison CL, Capuron L, Miller AH: Cytokines sing the blues: inflammation and the pathogenesis of depression. Trends Immunol 2006; 27:24–31. 5 Maes M, Berk M, Goehler L, Song C, Anderson G, Gałecki P, Leonard B: Depression and sickness behavior are Janus-faced responses to shared inflammatory pathways. BMC Med 2012;10:66. 6 Dantzer R, O’Connor JC, Freund GG, Johnson RW, Kelley KW: From inflammation to sickness and depression: when the immune system subjugates the brain. Nat Rev Neurosci 2008;9:46–56. 7 Johnson F, Giulivi C: Superoxide dismutases and their impact upon human health. Mol Aspect Med 2005;26:340–352. 8 Halliwell B: Oxidative stress and neurodegeneration: where are we now? J Neurochem 2006;97:1634–1658. 9 Khanzode SD, Dakhale GN, Khanzode SS, Saoji A, Palasodkar R: Oxidative damage and major depression: the potential antioxidant action of selective serotonin re-uptake inhibitors. Redox Rep 2003;8:365–370. 10 Sarandol A, Sarandol E, Eker SS, Erdinc S, Vatansever E, Kirli S: Major depressive disorder is accompanied with oxidative stress: short-term antidepressant treatment does not alter oxidative-antioxidative systems. Hum Psychopharmacol 2007;22:67–73. 11 ICD-10 Classification of Mental and Behavioural Disorders. Geneva, World Health Organization, 1993. 12 Patten SB: Performance of the Composite International Diagnostic Interview Short Form for major depression in community and clinical samples. Chronic Dis Can 1997; 18: 109– 112. 13 Talarowska M, Gałecki P, Maes M, Bobińska K, Kowalczyk E: Total antioxidant status correlates with cognitive impairment in patients with recurrent depressive disorder. Neurochem Res 2012;37:1761–1767. 14 Hamilton M: A rating scale for depression. J Neurol Neurosurg Psychiatry 1960;23:56–62. 15 Demyttenaere K, De Fruyt J: Getting what you ask for: on the selectivity of depression rating scales. Psychother Psychosom 2003;72:61–70. 16 Chomczyński P, Sacchi N: Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987;162:156–159. 17 Winer J, Jung CK, Shackel I, Williams PM: Development and validation of real-time quantitative reverse transcriptase-polymerase chain reaction for monitoring gene expression in cardiac myocytes in vitro. Anal Biochem 1999;270:41–49.
