k.j 1992 Oxford University Press

1160 Nucleic Acids Research, Vol. 20, No. 5

MaelIl polymorphism in sequence encoding 3' untranslated region of the MCO gene

A new polymorphic probe on 5q1 1.2- 13.3: ECB306Bgl2.1 (D5S21 5)

J.Heighway, P.R.Hoban and A.H.Wyllie1 CRC Department of Cancer Genetics, Paterson Institute of Cancer Research, Wilmslow Road, Manchester, M20 8BX and 1Cancer Research Campaign Laboratories, Department of Pathology, University of Edinburgh, Medical Building, Teviot Place, Edinburgh, EH8 9AG, UK

K.Ruther and B.Wirth* Institute of Human Genetics, Wilhelmstrasse 31, D-5300 Bonn 1, FRG

Source/Description: PCR primers for the amplification of 1440bp fragment encoding part of the 3' untranslated region of the MCC gene at 5q21 (1). Mutation of this gene has been implicated in colon tumorigenesis and it lies within a region frequently subject to acquired allelic deletion in colon cancers. Primers: 37A 5' CCAATGAAACTTCGCTTTAATCAG 3' 37B 5' GTGGAATTTGTATCATGCTCTG 3' Polymorphism/Frequency: Sequencing of multiple alleles revealed a T/C polymorphism which results in a simple two allele MaeHI system. Observed fragments on a 2.3% agarose gel: Frequency Digest Products 0.52 Cl 430, 400, 270, 190, 170bp 0.48 430, 400, 270, 180, 170bp C2 (observed heterozygosity 15/32 unrelated individuals) Mendelian Inheritance: Co-dominant segregation demonstrated in three families (14 individuals). PCR Conditions: IlAg of genomic DNA was amplified in a 100IO reaction mix containing dNTPs (0.25 mM), 0.5kg of each oligo and Taq buffer (BCL). After heating for 2.5 min at 97°C, 2.5 units of Taq polymerase (BCL) was added and reactions cycled 30 times at 94°C for 1min, 55°C for 1min and 74°C for 4min (Grant Autogene II). Comment: As the polymorphism is within a region of the gene encoded within the MCC mRNA molecule it can be used to analyze both cDNA, in studying allele specific expression and chromosomal DNA in studying somatically acquired allele loss at 5q21 in sporadic colorectal carcinomas. Acknowledgements: This work was supported by the Cancer Research Campaign. References: 1) Kinzler et al. (1991) Science 251, 1366-1369. 2) Ashton-Richardt et al. (1991) Oncogene 6, 1881-1886.

Figure shows digested amplification products from three individuals. Marker tracks (outer) are OX174 HaeIII digests.

Source/Description: ECB306 Bgl2. 1 (D5S215) is a 2.1 kb BglIH fragment isolated from the phage ECB306, originated from a BssHII endclone library (1) and subcloned in a pBluescript II vector (Stratagene). Polymorphism: EcoRI digestion of genomic DNA and hybridisation with the probe detects a 3 allele polymorphism: 4.0kb (Al); 2.05kb (A2); 1.8kb (A3) and a constant band of 3.4 kb. Frequency: Among 60 chromosomes of unrelated Caucasians. Frequency Size Allele 0.17 4.0 kb Al 0.21 2.05 kb A2 0.62 1.8kb A3 Observed heterozygosity was 0.44 Not Polymorphic For: BamHI, BclI, BglI, BglII, EcoRV, HincII, HindIII, MspI, PvuII, PstI, RsaI, SstI, XbaI, XmnI. Chromosomal Location: Using a panel with somatic cell hybrids, the probe could be localized to 5q1l.2-13.3. Mendelian Inheritance: Co-dominant segregation has been observed in 7 two- and three-generation families. Probe Availability: Available for collaborative work, contact B.Wirth at the above address. Acknowledgements: The authors are grateful to Drs.A.-M. Frischauf and L.Varesco for the BssHII endclone library. This work was supported by the Deutsche Forschungsgemeinschaft. Reference: 1) Varesco,L. (1989) Proc. Natl. Acad. Sci USA 86, 10118-10122.

*

To whom correspondence should be addressed

MaeIII polymorphism in sequence encoding 3' untranslated region of the MCC gene.

k.j 1992 Oxford University Press 1160 Nucleic Acids Research, Vol. 20, No. 5 MaelIl polymorphism in sequence encoding 3' untranslated region of the...
153KB Sizes 0 Downloads 0 Views