Original Research published: 27 March 2017 doi: 10.3389/fimmu.2017.00303
Macrophage Polarization Modulates Fcγr- and cD13-Mediated Phagocytosis and reactive Oxygen species Production, independently of receptor Membrane expression Elizabeth Mendoza-Coronel and Enrique Ortega* Departamento de Inmunología, Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México, Ciudad Universitaria, Mexico City, Mexico
Received: 05 January 2017 Accepted: 03 March 2017 Published: 27 March 2017
In response to microenvironmental cues, macrophages undergo a profound phenotypic transformation acquiring distinct activation phenotypes ranging from pro-inflammatory (M1) to anti-inflammatory (M2). To study how activation phenotype influences phagocytosis and production of reactive oxygen species (ROS) mediated by receptors for IgG antibodies (Fcγ receptors) and by CD13, human monocyte-derived macrophages were polarized to distinct phenotypes using IFN-γ (Mϕ-IFN-γ), IL-4 (Mϕ-IL-4), or IL-10 (Mϕ-IL-10). Phenotypically, Mϕ-IFN-γ were characterized as CD14+CD80+CD86+ cells, Mϕ-IL-4 as CD209highCD206+CD11b+CD14low, and Mϕ-IL-10 as CD16+CD163+ cells. Compared to non-polarized macrophages, FcγRI expression increased in Mϕ-IFN-γ and Mϕ-IL-10 and FcγRIII expression increased in Mϕ-IL-10. None of the polarizing cytokines modified FcγRII or CD13 expression. Functionally, we found that cytokine-mediated activation significantly and distinctively affected FcγR- and CD13-mediated phagocytosis and ROS generation. Compared to non-polarized macrophages, FcγRI-, FcγRII-, and CD13-mediated phagocytosis was significantly increased in Mϕ-IL-10 and decreased in Mϕ-IFN-γ, although both cytokines significantly upregulated FcγRI expression. IL-10 also increased phagocytosis of Escherichia coli, showing that the effect of IL-10 on macrophage phagocytosis is not specific for a particular receptor. Interestingly, Mϕ-IL-4, which showed poor FcγR- and CD13-mediated phagocytosis, showed very high phagocytosis of E. coli and zymosan. Coupled with phagocytosis, macrophages produce ROS that contribute to microbial killing. As expected, Mϕ-IFN-γ showed significant production of ROS after FcγRI-, FcγRII-, or CD13-mediated phagocytosis. Unexpectedly, we found
Citation: Mendoza-Coronel E and Ortega E (2017) Macrophage Polarization Modulates FcγR- and CD13Mediated Phagocytosis and Reactive Oxygen Species Production, Independently of Receptor Membrane Expression. Front. Immunol. 8:303. doi: 10.3389/fimmu.2017.00303
Abbreviations: ATCC, American Type Culture Collection; Carboxy-H2DFFDA, 5-(and-6)-carboxy-2′,7′difluorodihydrofluorescein diacetate; CD13, cluster of differentiation 13, aminopeptidase N; CFSE, carboxyfluorescein succinimidyl ester; EBS-Fab, sheep red blood cells labeled with CFSE and coated with biotin, streptavidin, and biotin-labeled bivalent antigen-binding fragments of anti-IgG; F(ab′)2, bivalent antigen-binding fragments of antibodies (disulfide bond joined); FcγRs, receptors for the Fc portion of immunoglobulin G; FcγRI, type 1 high-affinity receptor for the Fc portion of immunoglobulin G (CD64); FcγRII, type II receptor for the Fc portion of immunoglobulin G (CD32); FcγRIII, type III receptor for the Fc portion of immunoglobulin G (CD16); Mϕ, macrophage; hMDM, human monocyte-derived macrophage; Mϕ-IFN-γ, IFN-γ-treated macrophages; Mϕ-IL-4, IL-4-treated macrophages; Mϕ-IL-10, IL-10-treated macrophages; M-CSF, macrophage colony-stimulating factor; PI, phagocytic index; ROS, reactive oxygen species; SRBC, sheep red blood cells.
Edited by: Cordula M. Stover, University of Leicester, UK Reviewed by: Rakesh K. Kumar, University of New South Wales, Australia Luisa Martinez-Pomares, University of Nottingham, UK *Correspondence: Enrique Ortega [email protected] Specialty section: This article was submitted to Molecular Innate Immunity, a section of the journal Frontiers in Immunology
Frontiers in Immunology | www.frontiersin.org
1
March 2017 | Volume 8 | Article 303
Mendoza-Coronel and Ortega
Modulation of Phagocytosis in Polarized Macrophages
that Mϕ-IL-10 can also produce ROS after simultaneous stimulation through several phagocytic receptors, as coaggregation of FcγRI/FcγRII/CD13 induced a belated but significant ROS production. Together, these results demonstrate that activation of macrophages by each cytokine distinctly modulates expression of phagocytic receptors, FcγR- and CD13-mediated phagocytosis, and ROS production. Keywords: macrophage activation, cytokines, macrophage effector functions, M1–M2 macrophages, phagocytosis
INTRODUCTION
also modulate phagocytosis mediated by FcγRs (15) and by other receptors (16). In addition, CD13 crosslinking induces ROS production in macrophages (14). Cytokine-mediated activation of macrophages is known to regulate the expression of many different membrane receptors, including the different classes of FcγRs (17, 18). Usually, it is presumed that changes in the expression level of a given receptor results in corresponding changes in the magnitude of the responses mediated by the receptor. However, we (19) and others (20, 21) have reported a lack of correlation between changes in expression levels of FcγRs and phagocytosis or antibody-mediated cell cytotoxicity mediated by them. To test the hypothesis that the ability of a cell to perform specific receptor-mediated functions depends more on the polarization state of the cell than on the expression level of the receptor, we activated human macrophages to three distinct functional phenotypes and comparatively determined the expression levels of FcγRs and CD13, as well as phagocytosis and ROS production mediated by these receptors. Our results demonstrate that the polarization state of macrophages, more than changes in receptor expression, determines the cell’s capacity for phagocytosis and production of ROS.
Macrophages are a phenotypically and functionally heterogeneous group of myeloid cells, with a high degree of plasticity. In tissues, macrophages respond to the local cytokine milieu with the acquisition of distinct functional phenotypes. In response to TLRs ligands and IFN-γ, macrophages undergo classical M1 activation, whereas they undergo alternative M2 activation after stimulation by IL-4/IL-13 or other stimuli. The M1-M2 model of macrophage polarization was proposed to reflect the Th1–Th2 polarization of T cells’ responses (1). The M1 phenotype is characterized by secretion of high levels of pro-inflammatory cytokines, high production of reactive nitrogen and oxygen intermediates, promotion of Th1 responses, and strong microbicidal and tumoricidal activity (2–5). On the other hand, M2 phenotype, originally designating the phenotype obtained by treatment of macrophages with IL-4, has been subdivided into various phenotypes: M2a (induced by IL-4 or IL-13), M2b (induced by immune complexes plus bacterial LPS), and M2c (induced by IL-10, glucocorticoids, and TGF-β) (2). M2a macrophages are characterized by the expression of mannose receptors and production of ornithine and polyamines through the arginase pathway, and are important in infections by parasites, allergy, and type II inflammation. M2c macrophages are characterized by high expression of scavenger receptors and higher production of IL-10, and are important in immunoregulatory functions and tissue remodeling (3, 5, 6). Phagocytosis, endocytosis, secretion, and microbial killing are among the main functions of macrophages both in homeostasis and during microbial or damage-related threats (7). Phagocytosis is an essential function for the removal of dead or dying cells, tissue remodeling, and host defense. Phagocytosis is an actin-dependent process used by phagocytes to internalize particles greater than 0.5 μm in diameter (8–10). In monocytes and macrophages, phagocytosis can be mediated by a wide variety of phagocytic receptors, including receptors for IgG antibodies (FcγRs) and CD13. FcγRs are among the best characterized phagocytic receptors. Binding of IgG-opsonized particles to FcγRs on the surface of a phagocyte induces crosslinking of the receptors and triggers a series of cellular responses that are important for inflammation and immunity. These responses include phagocytosis, production of reactive oxygen species (ROS), antibody-dependent cell-mediated cytotoxicity, release of pro-inflammatory mediators, and production of cytokines (11, 12). For its part, CD13 is a membrane peptidase, which participates in a wide variety of functions (13). CD13 is highly expressed on myeloid cells, and we have recently shown that in human monocytes and macrophages, CD13 is a competent phagocytic receptor capable of mediating phagocytosis, independently of other receptors (14). CD13 can
Frontiers in Immunology | www.frontiersin.org
MATERIALS AND METHODS Reagents and Antibodies
Fetal bovine serum (FBS), RPMI-1640 medium, sodium pyruvate solution, MEM non-essential amino acids solution, l-glutamine, penicillin, and streptomycin were purchased from Gibco Life Technologies (Carlsbad, CA, USA). Lymphoprep was from Axis-Shield PoC AS (Oslo, Norway). Recombinant human IFN-γ (rhIFN-γ), recombinant human IL-10 (rhIL-10), and recombinant human IL-4 (rhIL-4) were purchased from PeproTech (Rocky Hill, NJ, USA). Carboxy-H2DFFDA and carboxyfluorescein succinimidyl ester (CFSE) were from Molecular Probes by Life Technologies (Eugene, OR, USA). Sulfo-NHS-Biotin was from Thermo Scientific (Waltham, MA, USA); streptavidin was from Calbiochem (San Diego, CA, USA), and bovine serum albumin (BSA) was from Sigma (St. Louis, MO, USA). All culture media were supplemented with 10% heat-inactivated FBS and 1 mM sodium pyruvate, 0.1 mM non-essential amino acids solution, 0.1 mM l-glutamine, 100 U/mL penicillin, and 100 μg/mL streptomycin (complete media). Cultures were maintained in a humidified atmosphere at 37°C with 5% CO2. Murine monoclonal anti-hCD13 (clone 452, IgG1) was purified in our laboratory from culture supernatants of the hybridoma, kindly donated by Dr. Meenhard Herlyn (Wistar Institute of Anatomy and Biology, Philadelphia, PA, USA). Murine monoclonal IgG1 anti-human FcγRI (clone 32.2) and murine monoclonal IgG2a anti-human
2
March 2017 | Volume 8 | Article 303
Mendoza-Coronel and Ortega
Modulation of Phagocytosis in Polarized Macrophages
different donor were polarized in independent experiments. Non-polarized macrophages are referred to as M0 macrophages, and hMDMs polarized with IFN-γ, IL-4, or IL-10 are referred to as Mϕ-IFN-γ, Mϕ-IL-4, or Mϕ-IL-10, respectively.
FcγRII (clone IV.3) mAbs were purified in our laboratory from supernatants of the corresponding hybridomas obtained from American Type Culture Collection. Fab fragments of the antibodies were prepared with immobilized ficin (Pierce, Rockford, IL, USA) following the manufacturer’s instructions. Biotin-F(ab′)2 fragments of goat anti-mouse IgG (H + L) were from Zymed (Invitrogen) and from Life Technologies (Eugene, OR, USA). Goat anti-mouse-FITC, used as a secondary antibody for immunostaining, was from Zymed (Invitrogen). Monoclonal mouse anti-human CD14 (clone RM032, IgG2a) was from Beckman Coulter Company (CA, USA). Monoclonal mouse anti-human CD80 (clone 2D10, IgG1) was from BioLegend (San Diego, CA, USA). Monoclonal mouse anti-human CD209 (clone DCN 47.5, IgG1) was from Miltenyi Biotec (Bergisch Gladbach, Germany). Monoclonal mouse anti-human CD11b (clone ICRF44, IgG1), CD11c (clone B-ly6, IgG1, κ), CD86 (clone 2331 [FUN-1], IgG1), CD206 (clone 19.2, IgG1), CD163 (clone GHI/61, IgG1, κ), and CD16 (clone 3G8, IgG1, κ) were all from BD Pharmingen (San Diego, CA, USA). Trizol, Turbo DNA-free kit, Oligo (dT) 12–18 primers and dNTP Mix 10 nM were from Invitrogen. Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV-RT) was from Promega. SYBR Green PCR Master Mix was from Applied Biosystems.
Expression of Surface Molecules by Flow Cytometry
Expression of surface markers on hMDMs was analyzed by flow cytometry (Attune Acoustic Focusing Flow Cytometer, Applied Biosystem, Foster City, CA, USA). Fluorochrome-labeled monoclonal antibodies specific for CD14, CD11b, CD11c, CD80, CD86, CD206, CD209, CD163, CD64, CD32, CD16, and CD13 were used. Equivalent concentrations of matched isotype controls were included. Before staining, Fc receptors were blocked with 10% autologous human serum. Cells were fixed in 1% paraformaldehyde and analyzed by flow cytometry. The surface expression levels of each marker were measured on polarized and non-polarized macrophages of each individual donor. The panel of surface molecules was selected based on the reports of human cells (22–31), as well as potential involvement of specific molecules in macrophage activation. Data were analyzed with Attune® Cytometric Software version 1.2.5, compatible with both Blue/Violet and Blue/Red configurations. Values are expressed as the mean fluorescence intensity (MFI) of the marker of interest and as the ratio of the MFI of the marker over the MFI of the same marker on non-polarized cells from the same donor.
Human Monocyte-Derived Macrophages (hMDMs) and In Vitro Polarization
Buffy coats from healthy male donors were obtained from the Central Blood Bank of the Centro Médico Nacional Siglo XXI, IMSS, which also approved of their use for these experiments. All experiments carried out with cells from human donors were performed following the Ethical Guidelines of the Instituto de Investigaciones Biomédicas, UNAM, Ciudad de México, México. PBMCs were isolated from buffy coats by gradient centrifugation with Lymphoprep. PBMCs were washed three times with PBS, pH 7.4, and were seeded (8–10 × 107 PBMCs/plate) in 100 mm × 20-mm cell culture-treated polystyrene culture dishes (Corning 430167, New York, NY, USA), in RPMI-1640 medium supplemented with 10% (v/v) heat-inactivated autologous plasma-derived serum, 1 mM sodium pyruvate solution, 2 mM MEM non-essential amino acid solution, 0.1 mM l-glutamine, 100 U/mL penicillin, and 100 μg/mL streptomycin for 1 h at 37°C in a humidified atmosphere with 5% CO2, to allow monocytes to adhere to the plastic plate. Non-adherent cells were eliminated by washing, and adherent cells, enriched for monocytes (≥95% purity, as determined by flow cytometry by use of CD14 as a marker of the monocytic population), were cultured for 6 days for differentiation into macrophages, in RPMI-1640 medium supplemented with 10% (v/v) heat-inactivated FBS, 1 mM sodium pyruvate solution, 2 mM MEM non-essential amino acid solution, 0.1 mM l-glutamine, 100 U/mL penicillin, 100 μg/mL streptomycin, and recombinant human (rh) M-CSF at 5 ng/mL, at 37°C in a humidified atmosphere with 5% CO2. The resulting hMDMs were polarized by incubation with rhIFN-γ (30 ng/ mL), or rhIL-4 (50 ng/mL), or rhIL-10 (20 ng/mL) for 48 h. The concentration of the cytokines was established in dose–response experiments. For experiments, polarized or non-polarized macrophages were harvested by gentle pipetting. Less than 1% cell death was observed in all conditions. Macrophages from each
Frontiers in Immunology | www.frontiersin.org
RNA Isolation, DNase Treatment, and cDNA Synthesis
Polarized or non-polarized macrophages (3 × 106) were harvested and lysed in TRIZOL (Invitrogen). Total RNA was extracted according to the manufacturer’s protocol. The precipitated RNA was dissolved in RNase-free water. The quality of the RNA was assessed by measuring the ratio of absorbance at 260 and 280 nm and by visualization of the integrity of the 28S and 18S bands in agarose gels. RNA samples were treated with DNase to remove contaminating DNA. Briefly, 10 μg total RNA was treated with TURBO DNase for 30 min at 37°C. Digestion was stopped by addition of DNase inactivation reagent, for 5 min at room temperature. The samples were centrifuged, and the supernatant containing RNA was recovered. For first-strand synthesis of cDNA from RNA molecules, 1 μg RNA was incubated with oligo-dT 12–18 primer for 5 min at 70°C, and dNTPs and M-MLV-RT were added. The mixture was incubated for 60 min at 37°C and for 15 min at 75°C.
Gene Expression Analysis by Quantitative Real-time PCR
Quantitative real-time PCR was performed using gene-specific primers designed using Primer Express (Applied Biosystems). The primers are shown in Table 1. Quantitative RT-PCR (qRT-PCR) analyses were set up using 1.0 μL cDNA, 5 μL of SYBR®Green PCR Master Mix (Life Technologies), 0.25 μL of each forward and reverse primer (250 nM), 0.2 μL of uracil-N-glycosylase (Applied Biosystems), and 3.5 μL of injectable water, totalizing a final volume of 10 μL. Reactions were run in a 7500 Fast Real-Time PCR
3
March 2017 | Volume 8 | Article 303
Mendoza-Coronel and Ortega
Modulation of Phagocytosis in Polarized Macrophages
Phagocytosis through FcγRI, FcγRII, or CD13 (Selective Phagocytosis)
Table 1 | Primers pairs used for determination of gene expression by qRT-PCR. Gene
Specific primers pair
bp
Exon
HPRT
Forward: TTATGGACAGGACTGAACGTCTTG
24
2–3
Reverse: CCAGCAGGTCAGCAAAGAATT
Sheep red blood cells (SRBCs) were maintained in Alsever’s solution until used. Modified SRBCs were prepared as described previously (14). In brief, erythrocytes (at 1.2 × 109/mL in PBSBSA 0.1%) were stained with 10 mM CFSE. The stained SRBCs were incubated with 250 μg/mL Sulfo-NHS-biotin for 20 min at 4°C. After washing, they were coated with 35 μg/mL streptavidin for 20 min at 4°C. The biotin-streptavidin-coated erythrocytes were washed and incubated with biotinylated F(ab′)2 fragments of goat anti-mouse IgG for 30 min. SRBCs labeled with CFSE and coated with biotin, streptavidin, and fragments of biotinylated anti-IgG antibodies are henceforth designated EBSFab. For phagocytosis assays, 1 × 106 hMDMs were incubated with 2 μg of Fab fragments of mAb452 (anti-human CD13), or 4 μg Fab fragments of mAb32.2 (anti-human FcγRI), or 4 μg Fab fragments of mAbIV.3 (anti-human FcγRII), or 4 μg IgG1 (isotype-matched control), or without treatment (control) for 30 min at 4°C, washed, and incubated with EBS-Fab at a ratio of 1 monocytic cell:20 EBS-Fab, at 37°C for 30 min. Equivalent samples were incubated at 4°C as negative controls of phagocytosis. Non-internalized erythrocytes were lysed by hypotonic shock. Phagocytosis was quantified by flow cytometry (Attune acoustic focusing flow cytometer; Applied Biosystems, Foster City, CA, USA), with addition of Trypan blue 0.02% in PBS 1× (pH 4.5), to quench extracellular fluorescence from attached but not internalized erythrocytes. Data are expressed as the percentage of CFSE-positive cells (i.e., cells that have ingested at least one erythrocyte) and as phagocytic index (PI), calculated using the following formula: PI = (% CFSE-positive cells) × (MFI of cells containing erythrocytes). Results were analyzed using Attune® Cytometric Software version 1.2.5, compatible with both Blue/ Violet and Blue/Red configurations.
21 Product: 114 bp
FCGR1
Forward: GGGCAAGTGGACACCACAA
19
Reverse: TGCAAGGTTACGGTTTCCTCTT
22
1–2
Product: 83 bp FCGR2A
Forward: GGCTTCTGCAGACAGTCAAGC
21
Reverse: CCTGGAGCACGTTGATCCAC
20
2–3
Product: 80–77 bp FCGR2B
Forward: GCAGTTCCAAAAGAGAAGGTTTCT Reverse: TCGGTTATTTGGGACCATATTGT
24
8
23 Product: 97 bp
FCGR3A
Forward: GGTGCAGCTAGAAGTCCATATCG
23
Reverse: GAATAGGGTCTTCCTCCTTGAACA
24
4–5
Product: 77 bp
system (Applied Biosystems) under the following conditions: 50°C for 2 min, 95°C for 10 min, 40 cycles of 95°C for 15 s, and 60°C for 1 min. Melting curve analysis was carried out at the end of each PCR to confirm the specificity of PCR products. Results were analyzed using the 7500 software (7500/7500 Fast Real-time PCR System) and were normalized using the endogenous gene HPTR-1 and the ΔΔcycle threshold method. Data are expressed in terms of relative mRNA levels in polarized macrophages to mRNA levels in non-polarized cells (M0). Ten replicates per experimental condition were performed, and differences were assessed with one-way ANOVA test with Tukey post hoc test.
Phagocytosis of Escherichia coli and Zymosan Particles
Human monocyte-derived macrophages were treated or not treated with rhIFN-γ, rhIL-4, or rhIL-10 for 48 h. The hMDM suspension (1 × 106 polarized or non-polarized cells) was incubated with 20 μL of fluorescein-conjugated heat-killed E. coli suspension or with 40 μg/mL of fluorescein-conjugated zymosan particles for 30 min at 37°C. Negative controls were prepared in identical conditions but incubated at 4°C. Phagocytosis was stopped by washing the suspension of hMDM and bacteria or zymosan particles with ice-cold PBS. Each sample was analyzed immediately after addition of Trypan Blue 0.02% in PBS 1× (pH 4.5), to quench extracellular fluorescence from attached but not internalized bacteria or particle. Data are expressed as the percentage of FITC-positive cells. Results were analyzed using Attune® Cytometric Software version 1.2.5, compatible with both Blue/Violet and Blue/Red configurations.
Cytokine Secretion
To analyze the cytokine secretion profile of non-stimulated polarized macrophages, hMDMs were treated or not treated with rhIFN-γ, rhIL-4, or rhIL-10 for 48 h. The cells were collected and washed three times with PBS, pH 7.4; fresh media was added, and the cells were incubated for additional 24 h. The cell-free culture supernatants were collected and used to quantitatively measure IL-8, IL-1β, IL-6, IL-10, TNF-α, and IL-12p70 protein levels using the Cytometric Bead Array (CBA) Human Inflammatory Cytokines Kit. To determine the cytokine secretion by stimulation, polarized macrophages were stimulated for 24 h with LPS, a ligand for cell surface TLR4. The cell-free culture supernatants were used to quantitatively measure IL-8, IL-1β, IL-6, IL-10, TNF-α, and IL-12p70 protein levels by CBA. The assays were performed according to the manufacturer’s instructions and analyzed using flow cytometry. The amount of each cytokine in the supernatant was extrapolated using a standard curve based of the known amounts of the recombinant cytokine. The concentrations of the standards ranged from 20 to 5,000 pg/mL.
Frontiers in Immunology | www.frontiersin.org
Quantification of ROS Production
Human monocyte-derived macrophages, non-polarized or treated with rhIFN-γ, rhIL-4, or rhIL-10, were collected and washed with HBSS. Cell suspensions (1 × 106 hMDM) were 4
March 2017 | Volume 8 | Article 303
Mendoza-Coronel and Ortega
Modulation of Phagocytosis in Polarized Macrophages
on membrane expression of the markers. Macrophages treated with IL-10 (Mϕ-IL-10) showed a specific upregulation of the expression of the scavenger receptor CD163 (mean 5.2-fold increase) (p
Macrophage Polarization Modulates Fcγr- and cD13-Mediated Phagocytosis and reactive Oxygen species Production, independently of receptor Membrane expression Elizabeth Mendoza-Coronel and Enrique Ortega* Departamento de Inmunología, Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México, Ciudad Universitaria, Mexico City, Mexico
Received: 05 January 2017 Accepted: 03 March 2017 Published: 27 March 2017
In response to microenvironmental cues, macrophages undergo a profound phenotypic transformation acquiring distinct activation phenotypes ranging from pro-inflammatory (M1) to anti-inflammatory (M2). To study how activation phenotype influences phagocytosis and production of reactive oxygen species (ROS) mediated by receptors for IgG antibodies (Fcγ receptors) and by CD13, human monocyte-derived macrophages were polarized to distinct phenotypes using IFN-γ (Mϕ-IFN-γ), IL-4 (Mϕ-IL-4), or IL-10 (Mϕ-IL-10). Phenotypically, Mϕ-IFN-γ were characterized as CD14+CD80+CD86+ cells, Mϕ-IL-4 as CD209highCD206+CD11b+CD14low, and Mϕ-IL-10 as CD16+CD163+ cells. Compared to non-polarized macrophages, FcγRI expression increased in Mϕ-IFN-γ and Mϕ-IL-10 and FcγRIII expression increased in Mϕ-IL-10. None of the polarizing cytokines modified FcγRII or CD13 expression. Functionally, we found that cytokine-mediated activation significantly and distinctively affected FcγR- and CD13-mediated phagocytosis and ROS generation. Compared to non-polarized macrophages, FcγRI-, FcγRII-, and CD13-mediated phagocytosis was significantly increased in Mϕ-IL-10 and decreased in Mϕ-IFN-γ, although both cytokines significantly upregulated FcγRI expression. IL-10 also increased phagocytosis of Escherichia coli, showing that the effect of IL-10 on macrophage phagocytosis is not specific for a particular receptor. Interestingly, Mϕ-IL-4, which showed poor FcγR- and CD13-mediated phagocytosis, showed very high phagocytosis of E. coli and zymosan. Coupled with phagocytosis, macrophages produce ROS that contribute to microbial killing. As expected, Mϕ-IFN-γ showed significant production of ROS after FcγRI-, FcγRII-, or CD13-mediated phagocytosis. Unexpectedly, we found
Citation: Mendoza-Coronel E and Ortega E (2017) Macrophage Polarization Modulates FcγR- and CD13Mediated Phagocytosis and Reactive Oxygen Species Production, Independently of Receptor Membrane Expression. Front. Immunol. 8:303. doi: 10.3389/fimmu.2017.00303
Abbreviations: ATCC, American Type Culture Collection; Carboxy-H2DFFDA, 5-(and-6)-carboxy-2′,7′difluorodihydrofluorescein diacetate; CD13, cluster of differentiation 13, aminopeptidase N; CFSE, carboxyfluorescein succinimidyl ester; EBS-Fab, sheep red blood cells labeled with CFSE and coated with biotin, streptavidin, and biotin-labeled bivalent antigen-binding fragments of anti-IgG; F(ab′)2, bivalent antigen-binding fragments of antibodies (disulfide bond joined); FcγRs, receptors for the Fc portion of immunoglobulin G; FcγRI, type 1 high-affinity receptor for the Fc portion of immunoglobulin G (CD64); FcγRII, type II receptor for the Fc portion of immunoglobulin G (CD32); FcγRIII, type III receptor for the Fc portion of immunoglobulin G (CD16); Mϕ, macrophage; hMDM, human monocyte-derived macrophage; Mϕ-IFN-γ, IFN-γ-treated macrophages; Mϕ-IL-4, IL-4-treated macrophages; Mϕ-IL-10, IL-10-treated macrophages; M-CSF, macrophage colony-stimulating factor; PI, phagocytic index; ROS, reactive oxygen species; SRBC, sheep red blood cells.
Edited by: Cordula M. Stover, University of Leicester, UK Reviewed by: Rakesh K. Kumar, University of New South Wales, Australia Luisa Martinez-Pomares, University of Nottingham, UK *Correspondence: Enrique Ortega [email protected] Specialty section: This article was submitted to Molecular Innate Immunity, a section of the journal Frontiers in Immunology
Frontiers in Immunology | www.frontiersin.org
1
March 2017 | Volume 8 | Article 303
Mendoza-Coronel and Ortega
Modulation of Phagocytosis in Polarized Macrophages
that Mϕ-IL-10 can also produce ROS after simultaneous stimulation through several phagocytic receptors, as coaggregation of FcγRI/FcγRII/CD13 induced a belated but significant ROS production. Together, these results demonstrate that activation of macrophages by each cytokine distinctly modulates expression of phagocytic receptors, FcγR- and CD13-mediated phagocytosis, and ROS production. Keywords: macrophage activation, cytokines, macrophage effector functions, M1–M2 macrophages, phagocytosis
INTRODUCTION
also modulate phagocytosis mediated by FcγRs (15) and by other receptors (16). In addition, CD13 crosslinking induces ROS production in macrophages (14). Cytokine-mediated activation of macrophages is known to regulate the expression of many different membrane receptors, including the different classes of FcγRs (17, 18). Usually, it is presumed that changes in the expression level of a given receptor results in corresponding changes in the magnitude of the responses mediated by the receptor. However, we (19) and others (20, 21) have reported a lack of correlation between changes in expression levels of FcγRs and phagocytosis or antibody-mediated cell cytotoxicity mediated by them. To test the hypothesis that the ability of a cell to perform specific receptor-mediated functions depends more on the polarization state of the cell than on the expression level of the receptor, we activated human macrophages to three distinct functional phenotypes and comparatively determined the expression levels of FcγRs and CD13, as well as phagocytosis and ROS production mediated by these receptors. Our results demonstrate that the polarization state of macrophages, more than changes in receptor expression, determines the cell’s capacity for phagocytosis and production of ROS.
Macrophages are a phenotypically and functionally heterogeneous group of myeloid cells, with a high degree of plasticity. In tissues, macrophages respond to the local cytokine milieu with the acquisition of distinct functional phenotypes. In response to TLRs ligands and IFN-γ, macrophages undergo classical M1 activation, whereas they undergo alternative M2 activation after stimulation by IL-4/IL-13 or other stimuli. The M1-M2 model of macrophage polarization was proposed to reflect the Th1–Th2 polarization of T cells’ responses (1). The M1 phenotype is characterized by secretion of high levels of pro-inflammatory cytokines, high production of reactive nitrogen and oxygen intermediates, promotion of Th1 responses, and strong microbicidal and tumoricidal activity (2–5). On the other hand, M2 phenotype, originally designating the phenotype obtained by treatment of macrophages with IL-4, has been subdivided into various phenotypes: M2a (induced by IL-4 or IL-13), M2b (induced by immune complexes plus bacterial LPS), and M2c (induced by IL-10, glucocorticoids, and TGF-β) (2). M2a macrophages are characterized by the expression of mannose receptors and production of ornithine and polyamines through the arginase pathway, and are important in infections by parasites, allergy, and type II inflammation. M2c macrophages are characterized by high expression of scavenger receptors and higher production of IL-10, and are important in immunoregulatory functions and tissue remodeling (3, 5, 6). Phagocytosis, endocytosis, secretion, and microbial killing are among the main functions of macrophages both in homeostasis and during microbial or damage-related threats (7). Phagocytosis is an essential function for the removal of dead or dying cells, tissue remodeling, and host defense. Phagocytosis is an actin-dependent process used by phagocytes to internalize particles greater than 0.5 μm in diameter (8–10). In monocytes and macrophages, phagocytosis can be mediated by a wide variety of phagocytic receptors, including receptors for IgG antibodies (FcγRs) and CD13. FcγRs are among the best characterized phagocytic receptors. Binding of IgG-opsonized particles to FcγRs on the surface of a phagocyte induces crosslinking of the receptors and triggers a series of cellular responses that are important for inflammation and immunity. These responses include phagocytosis, production of reactive oxygen species (ROS), antibody-dependent cell-mediated cytotoxicity, release of pro-inflammatory mediators, and production of cytokines (11, 12). For its part, CD13 is a membrane peptidase, which participates in a wide variety of functions (13). CD13 is highly expressed on myeloid cells, and we have recently shown that in human monocytes and macrophages, CD13 is a competent phagocytic receptor capable of mediating phagocytosis, independently of other receptors (14). CD13 can
Frontiers in Immunology | www.frontiersin.org
MATERIALS AND METHODS Reagents and Antibodies
Fetal bovine serum (FBS), RPMI-1640 medium, sodium pyruvate solution, MEM non-essential amino acids solution, l-glutamine, penicillin, and streptomycin were purchased from Gibco Life Technologies (Carlsbad, CA, USA). Lymphoprep was from Axis-Shield PoC AS (Oslo, Norway). Recombinant human IFN-γ (rhIFN-γ), recombinant human IL-10 (rhIL-10), and recombinant human IL-4 (rhIL-4) were purchased from PeproTech (Rocky Hill, NJ, USA). Carboxy-H2DFFDA and carboxyfluorescein succinimidyl ester (CFSE) were from Molecular Probes by Life Technologies (Eugene, OR, USA). Sulfo-NHS-Biotin was from Thermo Scientific (Waltham, MA, USA); streptavidin was from Calbiochem (San Diego, CA, USA), and bovine serum albumin (BSA) was from Sigma (St. Louis, MO, USA). All culture media were supplemented with 10% heat-inactivated FBS and 1 mM sodium pyruvate, 0.1 mM non-essential amino acids solution, 0.1 mM l-glutamine, 100 U/mL penicillin, and 100 μg/mL streptomycin (complete media). Cultures were maintained in a humidified atmosphere at 37°C with 5% CO2. Murine monoclonal anti-hCD13 (clone 452, IgG1) was purified in our laboratory from culture supernatants of the hybridoma, kindly donated by Dr. Meenhard Herlyn (Wistar Institute of Anatomy and Biology, Philadelphia, PA, USA). Murine monoclonal IgG1 anti-human FcγRI (clone 32.2) and murine monoclonal IgG2a anti-human
2
March 2017 | Volume 8 | Article 303
Mendoza-Coronel and Ortega
Modulation of Phagocytosis in Polarized Macrophages
different donor were polarized in independent experiments. Non-polarized macrophages are referred to as M0 macrophages, and hMDMs polarized with IFN-γ, IL-4, or IL-10 are referred to as Mϕ-IFN-γ, Mϕ-IL-4, or Mϕ-IL-10, respectively.
FcγRII (clone IV.3) mAbs were purified in our laboratory from supernatants of the corresponding hybridomas obtained from American Type Culture Collection. Fab fragments of the antibodies were prepared with immobilized ficin (Pierce, Rockford, IL, USA) following the manufacturer’s instructions. Biotin-F(ab′)2 fragments of goat anti-mouse IgG (H + L) were from Zymed (Invitrogen) and from Life Technologies (Eugene, OR, USA). Goat anti-mouse-FITC, used as a secondary antibody for immunostaining, was from Zymed (Invitrogen). Monoclonal mouse anti-human CD14 (clone RM032, IgG2a) was from Beckman Coulter Company (CA, USA). Monoclonal mouse anti-human CD80 (clone 2D10, IgG1) was from BioLegend (San Diego, CA, USA). Monoclonal mouse anti-human CD209 (clone DCN 47.5, IgG1) was from Miltenyi Biotec (Bergisch Gladbach, Germany). Monoclonal mouse anti-human CD11b (clone ICRF44, IgG1), CD11c (clone B-ly6, IgG1, κ), CD86 (clone 2331 [FUN-1], IgG1), CD206 (clone 19.2, IgG1), CD163 (clone GHI/61, IgG1, κ), and CD16 (clone 3G8, IgG1, κ) were all from BD Pharmingen (San Diego, CA, USA). Trizol, Turbo DNA-free kit, Oligo (dT) 12–18 primers and dNTP Mix 10 nM were from Invitrogen. Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV-RT) was from Promega. SYBR Green PCR Master Mix was from Applied Biosystems.
Expression of Surface Molecules by Flow Cytometry
Expression of surface markers on hMDMs was analyzed by flow cytometry (Attune Acoustic Focusing Flow Cytometer, Applied Biosystem, Foster City, CA, USA). Fluorochrome-labeled monoclonal antibodies specific for CD14, CD11b, CD11c, CD80, CD86, CD206, CD209, CD163, CD64, CD32, CD16, and CD13 were used. Equivalent concentrations of matched isotype controls were included. Before staining, Fc receptors were blocked with 10% autologous human serum. Cells were fixed in 1% paraformaldehyde and analyzed by flow cytometry. The surface expression levels of each marker were measured on polarized and non-polarized macrophages of each individual donor. The panel of surface molecules was selected based on the reports of human cells (22–31), as well as potential involvement of specific molecules in macrophage activation. Data were analyzed with Attune® Cytometric Software version 1.2.5, compatible with both Blue/Violet and Blue/Red configurations. Values are expressed as the mean fluorescence intensity (MFI) of the marker of interest and as the ratio of the MFI of the marker over the MFI of the same marker on non-polarized cells from the same donor.
Human Monocyte-Derived Macrophages (hMDMs) and In Vitro Polarization
Buffy coats from healthy male donors were obtained from the Central Blood Bank of the Centro Médico Nacional Siglo XXI, IMSS, which also approved of their use for these experiments. All experiments carried out with cells from human donors were performed following the Ethical Guidelines of the Instituto de Investigaciones Biomédicas, UNAM, Ciudad de México, México. PBMCs were isolated from buffy coats by gradient centrifugation with Lymphoprep. PBMCs were washed three times with PBS, pH 7.4, and were seeded (8–10 × 107 PBMCs/plate) in 100 mm × 20-mm cell culture-treated polystyrene culture dishes (Corning 430167, New York, NY, USA), in RPMI-1640 medium supplemented with 10% (v/v) heat-inactivated autologous plasma-derived serum, 1 mM sodium pyruvate solution, 2 mM MEM non-essential amino acid solution, 0.1 mM l-glutamine, 100 U/mL penicillin, and 100 μg/mL streptomycin for 1 h at 37°C in a humidified atmosphere with 5% CO2, to allow monocytes to adhere to the plastic plate. Non-adherent cells were eliminated by washing, and adherent cells, enriched for monocytes (≥95% purity, as determined by flow cytometry by use of CD14 as a marker of the monocytic population), were cultured for 6 days for differentiation into macrophages, in RPMI-1640 medium supplemented with 10% (v/v) heat-inactivated FBS, 1 mM sodium pyruvate solution, 2 mM MEM non-essential amino acid solution, 0.1 mM l-glutamine, 100 U/mL penicillin, 100 μg/mL streptomycin, and recombinant human (rh) M-CSF at 5 ng/mL, at 37°C in a humidified atmosphere with 5% CO2. The resulting hMDMs were polarized by incubation with rhIFN-γ (30 ng/ mL), or rhIL-4 (50 ng/mL), or rhIL-10 (20 ng/mL) for 48 h. The concentration of the cytokines was established in dose–response experiments. For experiments, polarized or non-polarized macrophages were harvested by gentle pipetting. Less than 1% cell death was observed in all conditions. Macrophages from each
Frontiers in Immunology | www.frontiersin.org
RNA Isolation, DNase Treatment, and cDNA Synthesis
Polarized or non-polarized macrophages (3 × 106) were harvested and lysed in TRIZOL (Invitrogen). Total RNA was extracted according to the manufacturer’s protocol. The precipitated RNA was dissolved in RNase-free water. The quality of the RNA was assessed by measuring the ratio of absorbance at 260 and 280 nm and by visualization of the integrity of the 28S and 18S bands in agarose gels. RNA samples were treated with DNase to remove contaminating DNA. Briefly, 10 μg total RNA was treated with TURBO DNase for 30 min at 37°C. Digestion was stopped by addition of DNase inactivation reagent, for 5 min at room temperature. The samples were centrifuged, and the supernatant containing RNA was recovered. For first-strand synthesis of cDNA from RNA molecules, 1 μg RNA was incubated with oligo-dT 12–18 primer for 5 min at 70°C, and dNTPs and M-MLV-RT were added. The mixture was incubated for 60 min at 37°C and for 15 min at 75°C.
Gene Expression Analysis by Quantitative Real-time PCR
Quantitative real-time PCR was performed using gene-specific primers designed using Primer Express (Applied Biosystems). The primers are shown in Table 1. Quantitative RT-PCR (qRT-PCR) analyses were set up using 1.0 μL cDNA, 5 μL of SYBR®Green PCR Master Mix (Life Technologies), 0.25 μL of each forward and reverse primer (250 nM), 0.2 μL of uracil-N-glycosylase (Applied Biosystems), and 3.5 μL of injectable water, totalizing a final volume of 10 μL. Reactions were run in a 7500 Fast Real-Time PCR
3
March 2017 | Volume 8 | Article 303
Mendoza-Coronel and Ortega
Modulation of Phagocytosis in Polarized Macrophages
Phagocytosis through FcγRI, FcγRII, or CD13 (Selective Phagocytosis)
Table 1 | Primers pairs used for determination of gene expression by qRT-PCR. Gene
Specific primers pair
bp
Exon
HPRT
Forward: TTATGGACAGGACTGAACGTCTTG
24
2–3
Reverse: CCAGCAGGTCAGCAAAGAATT
Sheep red blood cells (SRBCs) were maintained in Alsever’s solution until used. Modified SRBCs were prepared as described previously (14). In brief, erythrocytes (at 1.2 × 109/mL in PBSBSA 0.1%) were stained with 10 mM CFSE. The stained SRBCs were incubated with 250 μg/mL Sulfo-NHS-biotin for 20 min at 4°C. After washing, they were coated with 35 μg/mL streptavidin for 20 min at 4°C. The biotin-streptavidin-coated erythrocytes were washed and incubated with biotinylated F(ab′)2 fragments of goat anti-mouse IgG for 30 min. SRBCs labeled with CFSE and coated with biotin, streptavidin, and fragments of biotinylated anti-IgG antibodies are henceforth designated EBSFab. For phagocytosis assays, 1 × 106 hMDMs were incubated with 2 μg of Fab fragments of mAb452 (anti-human CD13), or 4 μg Fab fragments of mAb32.2 (anti-human FcγRI), or 4 μg Fab fragments of mAbIV.3 (anti-human FcγRII), or 4 μg IgG1 (isotype-matched control), or without treatment (control) for 30 min at 4°C, washed, and incubated with EBS-Fab at a ratio of 1 monocytic cell:20 EBS-Fab, at 37°C for 30 min. Equivalent samples were incubated at 4°C as negative controls of phagocytosis. Non-internalized erythrocytes were lysed by hypotonic shock. Phagocytosis was quantified by flow cytometry (Attune acoustic focusing flow cytometer; Applied Biosystems, Foster City, CA, USA), with addition of Trypan blue 0.02% in PBS 1× (pH 4.5), to quench extracellular fluorescence from attached but not internalized erythrocytes. Data are expressed as the percentage of CFSE-positive cells (i.e., cells that have ingested at least one erythrocyte) and as phagocytic index (PI), calculated using the following formula: PI = (% CFSE-positive cells) × (MFI of cells containing erythrocytes). Results were analyzed using Attune® Cytometric Software version 1.2.5, compatible with both Blue/ Violet and Blue/Red configurations.
21 Product: 114 bp
FCGR1
Forward: GGGCAAGTGGACACCACAA
19
Reverse: TGCAAGGTTACGGTTTCCTCTT
22
1–2
Product: 83 bp FCGR2A
Forward: GGCTTCTGCAGACAGTCAAGC
21
Reverse: CCTGGAGCACGTTGATCCAC
20
2–3
Product: 80–77 bp FCGR2B
Forward: GCAGTTCCAAAAGAGAAGGTTTCT Reverse: TCGGTTATTTGGGACCATATTGT
24
8
23 Product: 97 bp
FCGR3A
Forward: GGTGCAGCTAGAAGTCCATATCG
23
Reverse: GAATAGGGTCTTCCTCCTTGAACA
24
4–5
Product: 77 bp
system (Applied Biosystems) under the following conditions: 50°C for 2 min, 95°C for 10 min, 40 cycles of 95°C for 15 s, and 60°C for 1 min. Melting curve analysis was carried out at the end of each PCR to confirm the specificity of PCR products. Results were analyzed using the 7500 software (7500/7500 Fast Real-time PCR System) and were normalized using the endogenous gene HPTR-1 and the ΔΔcycle threshold method. Data are expressed in terms of relative mRNA levels in polarized macrophages to mRNA levels in non-polarized cells (M0). Ten replicates per experimental condition were performed, and differences were assessed with one-way ANOVA test with Tukey post hoc test.
Phagocytosis of Escherichia coli and Zymosan Particles
Human monocyte-derived macrophages were treated or not treated with rhIFN-γ, rhIL-4, or rhIL-10 for 48 h. The hMDM suspension (1 × 106 polarized or non-polarized cells) was incubated with 20 μL of fluorescein-conjugated heat-killed E. coli suspension or with 40 μg/mL of fluorescein-conjugated zymosan particles for 30 min at 37°C. Negative controls were prepared in identical conditions but incubated at 4°C. Phagocytosis was stopped by washing the suspension of hMDM and bacteria or zymosan particles with ice-cold PBS. Each sample was analyzed immediately after addition of Trypan Blue 0.02% in PBS 1× (pH 4.5), to quench extracellular fluorescence from attached but not internalized bacteria or particle. Data are expressed as the percentage of FITC-positive cells. Results were analyzed using Attune® Cytometric Software version 1.2.5, compatible with both Blue/Violet and Blue/Red configurations.
Cytokine Secretion
To analyze the cytokine secretion profile of non-stimulated polarized macrophages, hMDMs were treated or not treated with rhIFN-γ, rhIL-4, or rhIL-10 for 48 h. The cells were collected and washed three times with PBS, pH 7.4; fresh media was added, and the cells were incubated for additional 24 h. The cell-free culture supernatants were collected and used to quantitatively measure IL-8, IL-1β, IL-6, IL-10, TNF-α, and IL-12p70 protein levels using the Cytometric Bead Array (CBA) Human Inflammatory Cytokines Kit. To determine the cytokine secretion by stimulation, polarized macrophages were stimulated for 24 h with LPS, a ligand for cell surface TLR4. The cell-free culture supernatants were used to quantitatively measure IL-8, IL-1β, IL-6, IL-10, TNF-α, and IL-12p70 protein levels by CBA. The assays were performed according to the manufacturer’s instructions and analyzed using flow cytometry. The amount of each cytokine in the supernatant was extrapolated using a standard curve based of the known amounts of the recombinant cytokine. The concentrations of the standards ranged from 20 to 5,000 pg/mL.
Frontiers in Immunology | www.frontiersin.org
Quantification of ROS Production
Human monocyte-derived macrophages, non-polarized or treated with rhIFN-γ, rhIL-4, or rhIL-10, were collected and washed with HBSS. Cell suspensions (1 × 106 hMDM) were 4
March 2017 | Volume 8 | Article 303
Mendoza-Coronel and Ortega
Modulation of Phagocytosis in Polarized Macrophages
on membrane expression of the markers. Macrophages treated with IL-10 (Mϕ-IL-10) showed a specific upregulation of the expression of the scavenger receptor CD163 (mean 5.2-fold increase) (p
