ONCOLOGY LETTERS 8: 2305-2309, 2014
MACC1 expression levels as a novel prognostic marker for colorectal cancer HIROFUMI YAMAMOTO1*, NORIKATSU MIYOSHI2*, KOSHI MIMORI3, TOSHIKI HITORA4, MASAYOSHI TOKUOKA5, SHIKI FUJINO2, HALEY L. ELLIS6, HIDESHI ISHII7, SHINGO NOURA2, MASAYUKI OHUE2, MASAHIKO YANO2, YUICHIRO DOKI1 and MASAKI MORI1 1
Department of Gastroenterological Surgery, Osaka University Graduate School of Medicine, Suita, Osaka 565‑0871; Department of Surgery, Osaka Medical Center for Cancer and Cardiovascular Diseases, Nakamichi, Osaka 537‑8511; 3 Department of Molecular and Cellular Biology, Division of Molecular and Surgical Oncology, Kyushu University, Medical Institute of Bioregulation, Beppu, Osaka 874‑0838; 4Department of Surgery, Osaka Rosai Hospital, Sakai, Osaka 591‑8025; 5Department of Surgery, Yao Municipal Hospital, Yao, Osaka 581‑0069, Japan; 6Human Oncology and Pathogenesis Program, Memorial Sloan‑Kettering Cancer Center, New York, NY 10065, USA; 7Department of Frontier Science for Cancer and Chemotherapy, Osaka University, Yamadaoka, Suita, Osaka 565‑0871, Japan
2
Received January 16, 2014; Accepted August 1, 2014 DOI: 10.3892/ol.2014.2460 Abstract. Metastasis‑associated in colon cancer‑1 (MACC1) is key in promoting tumor proliferation and invasion, and is mediated by the hepatocyte growth factor (HGF) and mesenchymal‑epithelial transition factor. Previous reports have revealed that MACC1 is a novel oncogene that is expressed in various types of gastrointestinal cancer. The present study comprised of 174 patients who underwent curative surgery for colorectal cancer (CRC). The correlation between gene expression and clinical parameters of the patients was assessed. It was identified that patients exhibiting high MACC1 expression levels were statistically more susceptible to distant metastases and a poor prognosis, and those exhibiting low MACC1 expression showed improved disease‑free and overall survival than those with high expression. Therefore, the present data indicates that MACC1 expression levels may present as a prognostic factor in CRC patients. Introduction In developed countries where the aging population is increasing, cancer is one of the most prominent diseases with regard to public welfare and health measures. One in four mortalities in
Correspondence to: Dr Norikatsu Miyoshi, Department of Surgery, Osaka Medical Center for Cancer and Cardiovascular Diseases, 1‑3‑3, Nakamichi, Higashinari‑ku, Osaka 537‑8511, Japan E‑mail: [email protected] *
Contributed equally
Key words: metastasis‑associated in colon cancer‑1, prognosis, colorectal cancer
the USA, for example, is due to cancer (1). In the USA, the incidence of colorectal cancer (CRC) has increased significantly in recent years due to the changing lifestyle of the population and is currently one of the most frequently exhibited malignancies and leading causes of cancer‑related mortality. The metastatic dissemination of primary tumors is directly associated with patient survival, and distant metastases, such as of the liver or lungs, are the major cause of mortality in CRC patients. Furthermore, metastatic disease is the most frequent reason for treatment failure (2). Therefore, the identification of genes that are responsible for the development and progression of CRC, and comprehension of the clinical significance of these genes is critical for the diagnosis and adequate treatment of CRC. The characterization of these key molecules is promising for the development of novel treatment strategies for CRC. T he hepato cy t e g row t h fa ctor (H GF )/mesenchymal‑epithelial transition factor (MET) signaling pathway was reported to have a key role in cellular growth, invasiveness and metastasis (3‑5). The metastasis‑associated in colon cancer‑1 (MACC1) induces MET expression and promotes HGF‑induced scattering, which the mitogen‑activated protein kinase (MAPK) signaling pathway prevents (6). This indicates that MACC1 expression in primary tumors is associated with metastasis and results in a poor prognosis. The aim of the present study was to analyze the correlation between MACC1 expression levels, in tissue obtained from CRC patients, with their clinicopathological factors, and to investigate the possible functions of MACC1 in the metastasis of CRC. Materials and methods Clinical tissue samples. One hundred and seventy‑four patients (99 males and 75 females) with CRC underwent curative surgery of CRC and distant metastases (if present) at the Department of Gastroenterological Surgery, Osaka University Graduate School of Medicine and Medical Institute of Bioregulation at Kyusyu
2306
YAMAMOTO et al: MACC1 IN CRC
University (Osaka, Japan) between 1994 and 2003. No patients had received chemotherapy or radiotherapy prior to surgery. Primary CRC specimens and adjacent normal colorectal mucosa were obtained from patients following receipt of written informed consent, which was in accordance with the institutional ethical guidelines. The surgical specimens were fixed in formalin, processed through graded ethanol, and embedded in paraffin. The sections were stained with hematoxylin and eosin and Elastica van Gieson stain (Merck Millipore, Billerica, MA, USA), and the degree of histological differentiation, lymphatic invasion, and venous invasion was examined. Additionally, samples of each specimen were frozen in liquid nitrogen immediately after resection and stored at ‑80˚C until RNA extraction. Following surgery, the patients underwent follow‑up blood examinations to assess the tumor markers, serum carcinoembryonic antigen and cancer antigen 19‑9 and imaging, such as abdominal ultrasonography, computed tomography and chest X‑rays were conducted every 3‑6 months. Postoperatively, stage III and IV patients received 5‑fluorouracil‑based chemotherapy [mFOLFOX6; 85 mg/m 2 oxaliplatin and 2800 mg/m2 5‑fluorouracil, for two weeks for a total of 12 courses of treatment; 300 mg/m2/day UFT, for 28 days for five weeks for five courses of treatment; 2500 mg/m 2/day capecitabine for 14 days for three weeks for 8 courses of treatment, and/or 80 mg/m2/day TS-1 (tegafur, gimestat and otastat potassium) for 28 days for six weeks and four courses of treatment]. Adjuvant therapeutic strategies were performed, except for stage I and II patients who received no chemotherapy, according to the guidelines laid out by the Japanese Society for Cancer of the Colon and Rectum (7). Clinicopathological factors were assessed according to the tumor node metastasis (TNM) classification system of the International Union Against Cancer (8). This study was approved by the ethics committee of Osaka University Graduate School of Medicine (Osaka, Japan). RNA preparation and expression analysis. Total RNA was prepared using TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) or using DNase and a modified acid guanidinium‑phenol‑chloroform procedure (9). Reverse transcription (RT) was performed with SuperScript™ II (Invitrogen Life Technologies) or by the methods reported previously (10) and an MACC1 fragment was amplified by polymerase chain reaction (PCR). Two human MACC1 oligonucleotide primers were designed as follows: Forward, 5'‑T TCT T T TGAT TCCTCCG GTGA‑3' a nd reverse, 5'‑ACTCTGATGGGCATGTGCTG‑3'. A PCR kit (Takara Ex Taq; Takara Bio Inc., Shiga, Japan) on a GeneAMP® PCR System 9600 (PE Applied Biosystems, Foster City, CA, USA) was used to perform 35 cycles of PCR with the following parameters: 95˚C for 40 sec, 45˚C for 40 sec and 72˚C for 60 sec. An 8‑µl aliquot of each reaction mixture was size‑fractionated in a 1.5% agarose gel and visualized with ethidium bromide staining. To ensure the RNA was not degraded, a PCR assay with primers specific for the glyceraldehydes‑3‑phosphate dehydrogenase (GAPDH) gene was performed for 1 min at 95˚C, 1 min at 56˚C, and 1 min at 72˚C for 30 cycles. The GAPDH primers were as follows: Forward, 5'‑TTGGTATCGTGGAAGGACTCA‑3' and reverse, 5'‑TGTCATCATATTGGCAGGTT‑3' and produced a 270‑bp amplicon. Complementary DNA (cDNA) from Human Reference Total RNA (Clontech Laboratories, Mountain View,
Figure 1. MACC1 mRNA expression levels in clinical tissue specimens. Quantitative reverse transcription‑polymerase chain reaction on 174 paired clinical samples showed that 143 cases (82.2%) exhibited higher levels of MACC1 mRNA in tumors than in the paired normal tissues. The mean MACC1 mRNA expression level in the tumor tissues (normalized to glyceraldehydes‑3‑phosphate dehydrogenase gene expression) was significantly different when compared with the corresponding normal tissues (P
MACC1 expression levels as a novel prognostic marker for colorectal cancer HIROFUMI YAMAMOTO1*, NORIKATSU MIYOSHI2*, KOSHI MIMORI3, TOSHIKI HITORA4, MASAYOSHI TOKUOKA5, SHIKI FUJINO2, HALEY L. ELLIS6, HIDESHI ISHII7, SHINGO NOURA2, MASAYUKI OHUE2, MASAHIKO YANO2, YUICHIRO DOKI1 and MASAKI MORI1 1
Department of Gastroenterological Surgery, Osaka University Graduate School of Medicine, Suita, Osaka 565‑0871; Department of Surgery, Osaka Medical Center for Cancer and Cardiovascular Diseases, Nakamichi, Osaka 537‑8511; 3 Department of Molecular and Cellular Biology, Division of Molecular and Surgical Oncology, Kyushu University, Medical Institute of Bioregulation, Beppu, Osaka 874‑0838; 4Department of Surgery, Osaka Rosai Hospital, Sakai, Osaka 591‑8025; 5Department of Surgery, Yao Municipal Hospital, Yao, Osaka 581‑0069, Japan; 6Human Oncology and Pathogenesis Program, Memorial Sloan‑Kettering Cancer Center, New York, NY 10065, USA; 7Department of Frontier Science for Cancer and Chemotherapy, Osaka University, Yamadaoka, Suita, Osaka 565‑0871, Japan
2
Received January 16, 2014; Accepted August 1, 2014 DOI: 10.3892/ol.2014.2460 Abstract. Metastasis‑associated in colon cancer‑1 (MACC1) is key in promoting tumor proliferation and invasion, and is mediated by the hepatocyte growth factor (HGF) and mesenchymal‑epithelial transition factor. Previous reports have revealed that MACC1 is a novel oncogene that is expressed in various types of gastrointestinal cancer. The present study comprised of 174 patients who underwent curative surgery for colorectal cancer (CRC). The correlation between gene expression and clinical parameters of the patients was assessed. It was identified that patients exhibiting high MACC1 expression levels were statistically more susceptible to distant metastases and a poor prognosis, and those exhibiting low MACC1 expression showed improved disease‑free and overall survival than those with high expression. Therefore, the present data indicates that MACC1 expression levels may present as a prognostic factor in CRC patients. Introduction In developed countries where the aging population is increasing, cancer is one of the most prominent diseases with regard to public welfare and health measures. One in four mortalities in
Correspondence to: Dr Norikatsu Miyoshi, Department of Surgery, Osaka Medical Center for Cancer and Cardiovascular Diseases, 1‑3‑3, Nakamichi, Higashinari‑ku, Osaka 537‑8511, Japan E‑mail: [email protected] *
Contributed equally
Key words: metastasis‑associated in colon cancer‑1, prognosis, colorectal cancer
the USA, for example, is due to cancer (1). In the USA, the incidence of colorectal cancer (CRC) has increased significantly in recent years due to the changing lifestyle of the population and is currently one of the most frequently exhibited malignancies and leading causes of cancer‑related mortality. The metastatic dissemination of primary tumors is directly associated with patient survival, and distant metastases, such as of the liver or lungs, are the major cause of mortality in CRC patients. Furthermore, metastatic disease is the most frequent reason for treatment failure (2). Therefore, the identification of genes that are responsible for the development and progression of CRC, and comprehension of the clinical significance of these genes is critical for the diagnosis and adequate treatment of CRC. The characterization of these key molecules is promising for the development of novel treatment strategies for CRC. T he hepato cy t e g row t h fa ctor (H GF )/mesenchymal‑epithelial transition factor (MET) signaling pathway was reported to have a key role in cellular growth, invasiveness and metastasis (3‑5). The metastasis‑associated in colon cancer‑1 (MACC1) induces MET expression and promotes HGF‑induced scattering, which the mitogen‑activated protein kinase (MAPK) signaling pathway prevents (6). This indicates that MACC1 expression in primary tumors is associated with metastasis and results in a poor prognosis. The aim of the present study was to analyze the correlation between MACC1 expression levels, in tissue obtained from CRC patients, with their clinicopathological factors, and to investigate the possible functions of MACC1 in the metastasis of CRC. Materials and methods Clinical tissue samples. One hundred and seventy‑four patients (99 males and 75 females) with CRC underwent curative surgery of CRC and distant metastases (if present) at the Department of Gastroenterological Surgery, Osaka University Graduate School of Medicine and Medical Institute of Bioregulation at Kyusyu
2306
YAMAMOTO et al: MACC1 IN CRC
University (Osaka, Japan) between 1994 and 2003. No patients had received chemotherapy or radiotherapy prior to surgery. Primary CRC specimens and adjacent normal colorectal mucosa were obtained from patients following receipt of written informed consent, which was in accordance with the institutional ethical guidelines. The surgical specimens were fixed in formalin, processed through graded ethanol, and embedded in paraffin. The sections were stained with hematoxylin and eosin and Elastica van Gieson stain (Merck Millipore, Billerica, MA, USA), and the degree of histological differentiation, lymphatic invasion, and venous invasion was examined. Additionally, samples of each specimen were frozen in liquid nitrogen immediately after resection and stored at ‑80˚C until RNA extraction. Following surgery, the patients underwent follow‑up blood examinations to assess the tumor markers, serum carcinoembryonic antigen and cancer antigen 19‑9 and imaging, such as abdominal ultrasonography, computed tomography and chest X‑rays were conducted every 3‑6 months. Postoperatively, stage III and IV patients received 5‑fluorouracil‑based chemotherapy [mFOLFOX6; 85 mg/m 2 oxaliplatin and 2800 mg/m2 5‑fluorouracil, for two weeks for a total of 12 courses of treatment; 300 mg/m2/day UFT, for 28 days for five weeks for five courses of treatment; 2500 mg/m 2/day capecitabine for 14 days for three weeks for 8 courses of treatment, and/or 80 mg/m2/day TS-1 (tegafur, gimestat and otastat potassium) for 28 days for six weeks and four courses of treatment]. Adjuvant therapeutic strategies were performed, except for stage I and II patients who received no chemotherapy, according to the guidelines laid out by the Japanese Society for Cancer of the Colon and Rectum (7). Clinicopathological factors were assessed according to the tumor node metastasis (TNM) classification system of the International Union Against Cancer (8). This study was approved by the ethics committee of Osaka University Graduate School of Medicine (Osaka, Japan). RNA preparation and expression analysis. Total RNA was prepared using TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) or using DNase and a modified acid guanidinium‑phenol‑chloroform procedure (9). Reverse transcription (RT) was performed with SuperScript™ II (Invitrogen Life Technologies) or by the methods reported previously (10) and an MACC1 fragment was amplified by polymerase chain reaction (PCR). Two human MACC1 oligonucleotide primers were designed as follows: Forward, 5'‑T TCT T T TGAT TCCTCCG GTGA‑3' a nd reverse, 5'‑ACTCTGATGGGCATGTGCTG‑3'. A PCR kit (Takara Ex Taq; Takara Bio Inc., Shiga, Japan) on a GeneAMP® PCR System 9600 (PE Applied Biosystems, Foster City, CA, USA) was used to perform 35 cycles of PCR with the following parameters: 95˚C for 40 sec, 45˚C for 40 sec and 72˚C for 60 sec. An 8‑µl aliquot of each reaction mixture was size‑fractionated in a 1.5% agarose gel and visualized with ethidium bromide staining. To ensure the RNA was not degraded, a PCR assay with primers specific for the glyceraldehydes‑3‑phosphate dehydrogenase (GAPDH) gene was performed for 1 min at 95˚C, 1 min at 56˚C, and 1 min at 72˚C for 30 cycles. The GAPDH primers were as follows: Forward, 5'‑TTGGTATCGTGGAAGGACTCA‑3' and reverse, 5'‑TGTCATCATATTGGCAGGTT‑3' and produced a 270‑bp amplicon. Complementary DNA (cDNA) from Human Reference Total RNA (Clontech Laboratories, Mountain View,
Figure 1. MACC1 mRNA expression levels in clinical tissue specimens. Quantitative reverse transcription‑polymerase chain reaction on 174 paired clinical samples showed that 143 cases (82.2%) exhibited higher levels of MACC1 mRNA in tumors than in the paired normal tissues. The mean MACC1 mRNA expression level in the tumor tissues (normalized to glyceraldehydes‑3‑phosphate dehydrogenase gene expression) was significantly different when compared with the corresponding normal tissues (P
