Anaerobe xxx (2014) 1e7

Contents lists available at ScienceDirect

Anaerobe journal homepage: www.elsevier.com/locate/anaerobe

Pathogenesis and toxins

LuxS signaling in Porphyromonas gingivalis-host interactions Nina Scheres a, *, Richard J. Lamont b, Wim Crielaard a, Bastiaan P. Krom a, * a

Department of Preventive Dentistry, Academic Centre for Dentistry Amsterdam (ACTA), VU Free University and the University of Amsterdam, Gustav Mahlerlaan 3004, 1081 BT Amsterdam, The Netherlands b Department of Oral Immunology and Infectious Diseases, University of Louisville School of Dentistry, Louisville, KY 40202, United States

a r t i c l e i n f o

a b s t r a c t

Article history: Received 5 September 2014 Received in revised form 16 November 2014 Accepted 17 November 2014 Available online xxx

Dental plaque is a multispecies biofilm in the oral cavity that significantly influences oral health. The presence of the oral anaerobic pathogen Porphyromonas gingivalis is an important determinant in the development of periodontitis. Direct and indirect interactions between P. gingivalis and the host play a major role in disease development. Transcriptome analysis recently revealed that P. gingivalis geneexpression is regulated by LuxS in both an AI-2-dependent and an AI-2 independent manner. However, little is known about the role of LuxS-signaling in P. gingivalis-host interactions. Here, we investigated the effect of a luxS mutation on the ability of P. gingivalis to induce an inflammatory response in human oral cells in vitro. Primary periodontal ligament (PDL) fibroblasts were challenged with P. gingivalis DluxS or the wild-type parental strain and gene-expression of pro-inflammatory mediators IL-1b, IL-6 and MCP-1 was determined by real-time PCR. The ability of P. gingivalis DluxS to induce an inflammatory response was severely impaired in PDL-fibroblasts. This phenotype could be restored by providing of LuxS in trans, but not by addition of the AI-2 precursor DPD. A similar phenomenon was observed in a previous transcriptome study showing that expression of PGN_0482 was reduced in the luxS mutant independently of AI-2. We therefore also analyzed the effect of a mutation in PGN_0482, which encodes an immuno-reactive, putative outer-membrane protein. Similar to P. gingivalis DluxS, the P. gingivalis D0482 mutant had an impaired ability to induce an inflammatory response in PDL fibroblasts. LuxS thus appears to influence the pro-inflammatory responses of host cells to P. gingivalis, likely through regulation of PGN_0482. © 2014 Elsevier Ltd. All rights reserved.

Keywords: Porphyromonas gingivalis Quorum sensing Periodontal fibroblast Autoinducer-2 Inflammatory response PGN_0482

1. Introduction 1.1. The oral biofilm and Porphyromonas gingivalis Dental plaque is a multispecies biofilm in the oral cavity in which reside over 700 species of bacteria with differing pathogenic potential. The microbial composition of plaque has a major impact on oral health, and the development of periodontal disease is linked to a shift in microbial composition from a health-associated community to a dysbiotic one [1e3]. The presence of the Gramnegative, anaerobic oral pathogen P. gingivalis may be an important determinant in the shift towards disease. P. gingivalis possesses many sophisticated virulence traits which can undermine the host

defense mechanisms, and benefit not only P. gingivalis, but also other microbes in the oral biofilm. P. gingivalis has therefore been implicated as a keystone species in the development of periodontitis, a chronic, host-mediated inflammation of the toothsupporting tissues [4,5]. In periodontitis, the inflammatory reactions of the host against the oral biofilm can be disturbed and abused by P. gingivalis. This causes an imbalance between host and microflora, which in turn can lead to severe tissue-damage and alveolar bone degradation. Periodontitis is a major cause of adult tooth-loss, and its occurrence may also be correlated to the development of systemic diseases such as cardiovascular diseases and diabetes [6e8]. 1.2. P. gingivalis quorum sensing

* Corresponding authors. Department of Preventive Dentistry, Academic Centre for Dentistry Amsterdam (ACTA), Gustav Mahlerlaan 3004, 1081 LA Amsterdam, The Netherlands. E-mail addresses: [email protected] (N. Scheres), [email protected] (B.P. Krom).

To establish and survive within the oral biofilm, P. gingivalis not only needs to sense environmental conditions such as variations in temperature, oxygen tension, pH, and nutrients, but also microbial density and the presence of other microorganisms. P. gingivalis uses

http://dx.doi.org/10.1016/j.anaerobe.2014.11.011 1075-9964/© 2014 Elsevier Ltd. All rights reserved.

Please cite this article in press as: Scheres N, et al., LuxS signaling in Porphyromonas gingivalis-host interactions, Anaerobe (2014), http:// dx.doi.org/10.1016/j.anaerobe.2014.11.011

2

N. Scheres et al. / Anaerobe xxx (2014) 1e7

quorum sensing (QS), a microbial signaling method in which genes are regulated based on microbial cell density [9e11]. In QS, bacteria produce low amounts of signal molecules, the concentration of which increases as bacterial numbers rise. Once the concentration of signaling molecules reaches a certain threshold, bacteria respond by altering their behavior through transcription of various QSregulated genes, that often include virulence traits and play a role in pathogenicity [11]. P. gingivalis possesses a LuxS/Autoinducer-2 (AI-2) quorum sensing system. This type of QS was first discovered in the marine bacterium Vibrio harveyi [11]. It is dependent on the Autoinducer-2 family of signal molecules, and the luxS gene. luxS encodes AI-2 synthase, an enzyme that cleaves S-ribosylhomocysteine into 4,5dihydroxy-2,3-pentanedione (DPD) [12]. In turn, DPD spontaneously dissociates into various molecular ring-structure forms of AI-2 [9,12e14]. The LuxS/AI-2 system serves multiple functions. On the one hand, it serves as an inter-species communication method. Many bacteria can detect and respond to AI-2 produced by competing, or symbiotic, other bacterial species [11]. Within the oral biofilm, several other species besides P. gingivalis possess a LuxS/AI-2 quorum sensing system, such as Aggregatibacter actinomycetemcomitans and oral streptococci [10]. On the other hand, it provides an intra-species system for gene-regulation, in which AI-2producing bacteria detect their own AI-2 and thereby control endogenous gene expression and behavior [10,11]. A non-signaling function of LuxS arises from its contribution to the activated methyl cycle in recycling of the toxic compound S-adenosyl-homocysteine (SAH) [15]. 1.3. LuxS/AI-2 regulated inter-species interactions of P. gingivalis Within the oral biofilm, P. gingivalis has been shown to use LuxS/ AI-2 signaling to communicate with Streptococcus gordonii [9,14]. AI2 signaling is necessary for the formation of a P. gingivalis-S. gordonii mixed-species biofilm, and AI-2 produced by S. gordonii can complement a luxS mutation in P. gingivalis [16]. Similarly, LuxS/AI-2 signaling appears to be involved in the physical interaction between P. gingivalis and the oral bacterium Filifactor alocis [17]. LuxS/AI-2 signaling may also play an important role in the interaction between P. gingivalis and other species associated with periodontitis. The luxS gene from A. actinomycetemcomitans is, for instance, able to complement a luxS mutation in P. gingivalis [18]. Furthermore, AI-2 produced by Fusobacterium nucleatum stimulates co-aggregation and the expression of adhesion molecules in P. gingivalis, Treponema denticola, and Tannerella forsythia [19]. 1.4. Intra-species regulatory functions of LuxS/AI-2 signaling in P. gingivalis

Among these were genes involved in the hmu hemin uptake regulon, genes of diverse functions such as the flavodoxin FldA, tRNAguanine transglycosylase, the probable YjgP/YjgQ family permease, ssrA RNA binding protein, and dpp and lipoyl synthase [23]. Most of the down-regulated genes could be restored by a chemical complementation of the luxS defect, in the form of exogenously added DPD, the enzymatic product of LuxS. Yet, expression of two genes was not restored by addition of DPD. These were the genes PGN_0481, encoding a hypothetical protein, and PGN_0482, encoding an immuno-reactive protein. These findings indicate that in P. gingivalis LuxS is involved in regulation of gene expression in both an AI-2 dependent and an AI-2 independent system [23]. 1.5. LuxS in P. gingivalis-host interactions Little is known about the influence of the LuxS system on P. gingivalis virulence and its direct interactions with the host [10,13,20]. In a mouse model of infection, no difference in virulence, as measured by survival time of mice injected with P. gingivalis, was found between a P. gingivalis luxS mutant and the wild-type parental strain [20]. However, so far this seems to be the only study assessing the effect of a luxS mutation on the direct interaction between P. gingivalis and the host. To elucidate if LuxS influences the interaction between P. gingivalis and the human host we assessed the same P. gingivalis luxS mutant that had been subjected to transcriptome analysis, for its ability to induce an inflammatory response in primary human oral fibroblasts. Upon a challenge with P. gingivalis in vitro, oral fibroblasts increased gene-expression and protein production of proinflammatory mediators such as IL-6, IL-1b, IL-8, and MCP-1 [24]. Here, we challenged periodontal ligament (PDL) fibroblasts from periodontally healthy donors with the P. gingivalis luxS mutant and compared its ability to induce an inflammatory response in these cells to the wild-type strain and to a genetically complemented strain with the luxS gene restored in trans. Also we applied a chemical complementation of the luxS mutant by addition of exogenous DPD. PDL fibroblast responses to the different strains were analyzed by determining the change in gene-expression of the rapidly induced pro-inflammatory markers interleukin (IL)-6 and IL-1b, and the chemokine monocyte-chemotactic-protein-1 (MCP-1). Our results show that the luxS mutant is impaired in its ability to induce an inflammatory response in PDL fibroblasts. This defect cannot be restored by chemical complementation with DPD. Furthermore, using a P. gingivalis knockout mutant of PGN_0482, we demonstrated that this gene is, at least in part, responsible for the impaired ability of the luxS mutant to induce an inflammatory response in fibroblasts. 2. Materials and methods

In P. gingivalis itself, LuxS/AI-2 signaling is involved in regulating the acquisition of hemin and growth under hemin-limited conditions, and the expression of proteases and stress-related genes [20e22]. Analysis of a luxS mutant of P. gingivalis showed that genes encoding the TonB-linked hemin binding protein Tlr, and the lysine-specific protease Kgp, which can degrade host hemecontaining proteins, were down-regulated in the DluxS strains. In contrast, the genes for the TonB-linked hemin binding protein HmuR, the hemin binding lipoprotein FetB, the Fe2þ ion transport protein FeoB1 and the iron storage protein ferritin were upregulated in the absence of LuxS [21]. In another study, a P. gingivalis luxS mutant produced less heamagglutinin and less of the proteases Rgp and Kgp [20]. Recently, the role of LuxS/AI-2 in P. gingivalis was more deeply evaluated through transcriptome analysis of a luxS mutant P. gingivalis strain [23]. RNASeq revealed that expression of 57 genes and systems was influenced by LuxS.

2.1. Bacterial strains, plasmids, and culture conditions P. gingivalis strains used in this study and their relevant genotypes are listed in Table 1. All P. gingivalis strains were grown Table 1 P. gingivalis strains and their relevant genotypes used in this study. Strain designation

Description of mutation

Reference

Pg wild-type Pg DluxS

Wild-type parent strain Mutation in luxS; DluxS:: ermF

Pg DluxS þ luxS

luxS re-inserted in Pg DluxS; DluxS:: ermF (pT-COWmfa-luxS) Mutation in PGN_0482; D0482::ermF PGN_0482 re-inserted in Pg D0482; D0482::ermF (pT-COW-482)

ATCC 33277 James et al., 2006 [21] James et al., 2006 [21] This study This study

Pg D0482 Pg D0482 þ 0482

Please cite this article in press as: Scheres N, et al., LuxS signaling in Porphyromonas gingivalis-host interactions, Anaerobe (2014), http:// dx.doi.org/10.1016/j.anaerobe.2014.11.011

N. Scheres et al. / Anaerobe xxx (2014) 1e7

anaerobically (80% N2, 10% H2, 10% CO2; Anoxomat AN2CTS, Mart Microbiology b.v.) in an anaerobic jar on 5% horse blood agar plates for 5e7 days at 37  C. Alternatively, anaerobic liquid cultures were grown at 37  C until mid-log phase (24 h) in Brain-Heart Infusion (BHI)-broth supplemented with hemin (5 mg/l) and menadione (1 mg/l). To maintain selective pressure, Pg DluxS and Pg D0482 were cultured with 20 mg/mL erythromycin and Pg DluxS þ luxS and Pg D0482 þ 0482 with 20 mg/mL erythromycin and 2 mg/mL tetracycline. Purity was checked routinely with Gram-staining. 2.2. Construction of P. gingivalis mutants To create a knockout in PGN_0482, the PGN_0482 coding region was replaced with the ermF gene by fusion PCR as described earlier [25]. Primers used for the fusion PCR were designed using Primer3. 1st PCR: 50 #515 PGN_0481 þ 326RTFwd TTGCAGAAGCATTCGAACAG; #578 Del-0482ermF5Fd TTTTTGTCATTTTCTTTGTCTTTTTATGTCTTTATTATTTTATCTTGATC ermF; #701 Del-0482ermF5Rv2 GACATAAAAAGACAAAGAAAATGACAAAAAAGAAATTGCC CGTTCGT; #579 Del-0482ermF3Fd TGTTTTCTTACTACGAAGGATGAAATTTTT CAGGGACAA; 30 #702 Del-0482ermF3Rv2 CTGAAAAATTTCATCCTT CG AGTAAGAAAACAAGACCTTGATAAGGGAAAAGCA; #520 PGN_ 0484 þ 502RT RevCGCACTTCACACCCACATAC. 2nd fusion PCR: #580 0481 þ 554Rv TGATGCTTCGTGCATACGAT; #518 PGN_0483 þ 224RTRev TACTGCTCCTCCGAGTCGAT. The plasmid was introduced into the parent strain by electroporation [25] and colonies were selected by culture with gentamicin and erythromycin. The resulting strain, in which the deletion was confirmed by sequencing, was designated Pg D0482. 2.3. Construction of Pg D0482 þ 0482 For complementation of the PGN_0482 deletion, a region containing the complete PGN_0482 sequence was amplified using a PCR fusion technique and the complete fragment was cloned into shuttle vector pT-COW [26]. The promoter sequence (507 bp) of PGN_0482 was amplified using primers F1: ACTTAAGCTTTTGCCGACAGCGCGTTTATG (containing HindIII restriction site) and R1: TTTTCCTTTTGTTTTTGGTTATAATAAATTGTGG. A 630 bp region of PGN_0482 was amplified using primers F2: TTATAACCAAAAACAAAAGGAAAAATGAACAAGAAAGTATTGTTGCTG and R2: AATAGGATCCTTAGAAATGAACATTGAATGTAGCCAAG (containing BamHI restriction site). The fusion PCR product was produced using primers F1 and R2. The shuttle vector plasmid pT-COW was digested with the appropriate restriction enzymes to allow cloning of the fusion PCR product into the tetC region. The resulting plasmid was transformed into Escherichia coli TOP10 and selected on ampicillin (100 mg/ml) plates. Colonies were screened for presence of the correct plasmid by restriction digestion followed by sequencing. The correct plasmid was introduced into corresponding Pg D0482 strain by conjugation. The presence of pT-COW derived plasmid, and of the ermF gene on the chromosome in the transconjugants was confirmed by PCR and sequencing. The resulting strain was designated Pg D0482 þ 0482. 2.4. Oral fibroblasts Periodontal ligament (PDL) fibroblasts from two periodontally healthy donors (one male, age 16y (donor 1), and 1 female, age 41y (donor 2)), and gingival fibroblasts (GF) from one healthy donor (donor 2) were isolated during a previous study [24,27]. Donors had given written informed consent, and use of the cells for the present study was approved by the Medical Ethical committee of the VU University Medical Center, Amsterdam.

3

Fibroblasts were maintained in culture in Dulbecco's Modified Eagle's Medium (DMEM, Gibco BRL, Paisley, Scotland) with 10% fetal bovine serum (FBS, SigmaeAldrich, St Louis, MO, USA) and antibiotic/antimycotic solution (PSA; 100 U/ml of penicillin, 100 mg/ ml streptomycin and 250 ng/ml amphotericin B; SigmaeAldrich) in a humidified atmosphere with 5% CO2 at 37  C [24]. Experiments were performed with cells from passages 4 to 7. 2.5. Bacterial challenge Viable P. gingivalis were harvested by centrifugation at 5000  g. Bacterial pellets were washed in sterile phosphate buffered saline solution (D-PBS, Gibco BRL) and in DMEM with 10% FBS. Bacteria were resuspended in DMEM with 10% FBS and without PSA, and the optical density was measured at 690 nm to establish the number of colony forming units (CFU). Fibroblasts were challenged with viable P. gingivalis as published previously [24]. In short, fibroblasts were seeded in 24-well plates and challenged for 4 h with 0.5 ml of a P. gingivalis suspension of 2  108 CFU/ml (MOI 10,000:1) in antibiotic-free DMEM with 10% FBS, containing either wild-type P. gingivalis 33277, mutant Pg DluxS, Pg DluxS þ luxS, Pg D0482, or Pg D0482 þ 0482. DMEM with 10% FBS only was added to control fibroblasts (non-challenged). After challenge, fibroblasts were washed with sterile D-PBS and lysed in RNA lysis-buffer from the Fermentas GeneJet RNA isolation kit (Fermentas, Vilnius, Lithuania), supplemented with b-mercapto-ethanol. Bacterial challenges were repeated at least four times. To chemically complement strain Pg DluxS, a set of assays was performed in which Pg DluxS was cultured in the presence of synthetic 4,5-dihydroxy-2,3-pentanedione (DPD) [28]. Five different concentrations of synthetic DPD (200, 100, 50, 25, and 12.5 nM) were present either from the start of liquid culture, or during 4 h fibroblast challenge. Synthetic DPD in DMEM with 10% FBS was added to control fibroblasts. Each synthetic DPD concentration was tested four times. 2.6. RNA isolation Fibroblast mRNA was isolated using the GeneJet RNA isolation kit (Fermentas) according to manufacturer's protocol. The RNA concentration was estimated using a Nanodrop spectrophotometer (NanoDrop Technologies; Thermo-Fischer Scientific, Wilmington, Delaware, USA). mRNA was reverse-transcribed to cDNA using the MBI Fermentas RevertAid™ First Strand cDNA Synthesis Kit (Fermentas) according to manufacturer's protocol, using both the Oligo(dT)18 and the D(N)6 primers in an equal volume. 2.7. Real time PCR Primers for IL-6, MCP-1 and IL-1b were used as published previously [29]. Real-time PCR was performed on Roche LightCycler 480 (F. Hoffmann-La Roche AG, Basel, Switzerland). Reactions were performed with 2 ng of cDNA in a total volume of 11 mL containing LightCycler 480 SYBR Green I Master Mix (F. Hoffmann-La Roche) and 0.91 pM/ml primer. Human reference total RNA (Stratagene, La Jolla, CA, USA) was used as an external standard. The PCR reaction consisted of an activation step of 5 min at 95  C and 40 (IL-6, MCP1) or 50 (IL-1b) cycles of denaturation at 95  C for 10 s, and annealing and extension at 60  C for 5 s, 72  C for 10 s and 78  C for 5 s. PCR products were subjected to melting curve analysis to check for generation of nonspecific products. Samples were normalized to the expression of housekeeping genes b2-microglobulin and YWHAZ (Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein), which were not affected by the experimental

Please cite this article in press as: Scheres N, et al., LuxS signaling in Porphyromonas gingivalis-host interactions, Anaerobe (2014), http:// dx.doi.org/10.1016/j.anaerobe.2014.11.011

4

N. Scheres et al. / Anaerobe xxx (2014) 1e7

conditions. Gene-expression was calculated by 2(DCt), in which DCt ¼ (Ct gene of interest  Cthousekeeping gene). Fold change in gene expression of challenged fibroblasts compared to non-challenged fibroblasts (induction) was expressed as 2(DDCt), wherein DDCt ¼ DCt challenged  average Ct-value non-challenged. 2.8. Protein expression IL-1b protein expression was analyzed by ELISA, using the PeliKine IL-1b ELISA kit (Sanquin Blood Supply Foundation, Amsterdam, the Netherlands), according to the manufacturer's protocol. All experiments were performed in duplicate with undiluted supernatants and using cell culture supernatants from 3 independent samples per challenge condition. 2.9. Statistical analysis Differences between non-challenged cells and P. gingivalis strains were analyzed one-way ANOVA and Dunnetts multiple comparison posttest. Differences between different P. gingivalis strains and conditions were analyzed with one-way ANOVA and Tukeys posttest. Tests were performed with GraphPad Prism software (version 5, by MacKiev Software™) and differences were considered statistically significant at p < 0.05. 3. Results 3.1. P. gingivalis DluxS has an impaired ability to induce a response in fibroblasts PDL fibroblasts were challenged for 4 h with either Pg wild-type, Pg DluxS, or Pg DluxS þ luxS. The pro-inflammatory response of the fibroblasts was analyzed by measuring gene-expression of IL-1b, IL6, and MCP-1 by real-time PCR. Pg wild-type caused an increase in the expression of IL-6, MCP-1 and IL-1b compared to nonchallenged cells (p < 0.01, p < 0.05, and p < 0.05, respectively; Fig. 1a). Pg DluxS, in contrast, did not induce expression of IL-6,

MCP-1, and IL-1b in the PDL fibroblasts, and expression levels were similar to non-challenged cells (Fig. 1a). The genetically complemented strain Pg DluxS þ luxS caused an increase in the gene-expression of IL-6, MCP-1 and IL-1b relative to non-challenged control cells (p < 0.001, p ¼ 0.0016, and p ¼ 0.0042 respectively, Fig. 1a). For IL-6, Pg DluxS þ luxS induced a response intermediate between Pg DluxS and Pg wild-type, whereas for MCP-1 and IL-1b, Pg DluxS þ luxS resembled the wild-type (Fig. 1a). A challenge with Pg wild-type, Pg DluxS, and Pg DluxS þ luxS in gingival fibroblasts from a different donor gave similar results (data not shown). 3.2. Fibroblasts produce less IL-1b protein in response to P. gingivalis DluxS To confirm whether the differences between Pg DluxS and Pg wild-type or Pg DluxS þ luxS could also be detected at the protein level, we analyzed IL-1b protein concentrations in culture supernatants of PDL fibroblasts challenged for 4 h with each P. gingivalis strain. IL-1b was chosen as a candidate here since it is easily detectable with ELISA, and previous research showed that within a challenge period of a few hours, IL-6 protein is rapidly degraded by P. gingivalis, whereas elevated IL-1b levels could still be found [24]. Although the concentrations of IL-1b in these supernatants were generally low, the IL-1b protein concentration was increased after a challenge with Pg wild-type and with Pg DluxS þ luxS (p < 0.01 and p < 0.001 respectively), but not after a challenge with Pg DluxS (Fig. 1b). This indicates that Pg DluxS is impaired in inducing a cytokine response in fibroblasts, and that this defect is restored in the genetically complemented strain Pg DluxS þ luxS. 3.3. Complementation with DPD does not restore P. gingivalis DluxS ability to induce a response in fibroblasts LuxS is the synthase responsible for DPD production. To provide a chemical complementation of the luxS knockout, synthetic DPD was added during fibroblast challenge with Pg DluxS over a range

Fig. 1. Induction of cytokine expression in PDL fibroblasts by challenge with P. gingivalis strains. A. Fold increase of mRNA expression of IL-6, MCP-1, and IL-1b, calculated relatively to non-challenged cells (white bars), in PDL fibroblasts (donor 1) that were challenged for 4 h with Pg wild-type (gray bars), Pg DluxS (striped bars), or Pg DluxS þ luxS (hatched bars). Bars represent the average induction ± SD in experiments performed four times. * indicate differences between Pg-strains, þ indicate differences from non-challenged cells. ***p < 0.001, **p < 0.01, *p < 0.05 B. Protein expression of IL-1b in culture medium of PDL fibroblasts that were non-challenged (white squares), or challenged for 4 h with Pg wildtype (gray squares), Pg DluxS (circles), or Pg DluxS þ luxS (triangles). Data points represent the average protein concentration (pg/ml) ± SD in 3 independent samples, analyzed in duplicate. þ indicate differences compared to non-challenged cells ***p < 0.001, **p < 0.01, Pg: P. gingivalis.

Please cite this article in press as: Scheres N, et al., LuxS signaling in Porphyromonas gingivalis-host interactions, Anaerobe (2014), http:// dx.doi.org/10.1016/j.anaerobe.2014.11.011

N. Scheres et al. / Anaerobe xxx (2014) 1e7

of concentrations. PDL fibroblasts from the same donor as in Fig. 1 were challenged with Pg wild-type, Pg DluxS alone, or Pg DluxS with 200, 100, 50, 25, or 12.5 nM synthetic DPD. Fibroblast geneexpression of IL-6 was measured by real-time PCR. Pg wild-type induced IL-6 expression compared to non-challenged fibroblasts (p ¼ 0.0084), but Pg DluxS did not (Fig. 2a). The addition of synthetic DPD during the challenge assay did not restore the fibroblasts' responses to Pg DluxS. At all concentrations of DPD, fibroblast IL-6-responses remained clearly lower compared to wildtype infection (p < 0.001, Fig. 2a). The addition of synthetic DPD alone to fibroblasts did not affect IL-6 expression (data not shown). Since AI-2 signaling in P. gingivalis is mostly present during the exponential growth-phase [21], Pg DluxS was also cultured in the presence of synthetic DPD directly from the start of liquid growth in BHI medium. PDL-fibroblasts were then challenged with Pg wildtype, Pg DluxS alone, or Pg DluxS grown in the presence of 200, 100, 50, 25, or 12.5 nM synthetic DPD. Again, IL-6 expression was induced by a challenge with Pg wild-type (p ¼ 0.0002 compared to non-challenged), but not by Pg DluxS alone (Fig. 2b). The presence of synthetic DPD during P. gingivalis growth did not restore fibroblast responses to Pg DluxS (p < 0.001, Fig. 2b). Similar results were obtained for MCP-1 expression, whereas IL-1b expression was too low to reliably measure (data not shown). These results indicate that the reduced ability of Pg DluxS to induce a cytokine response in fibroblasts could not be restored by chemical complementation in the form of exogenous synthetic DPD.

3.4. A knockout of PGN_0482 reduces the ability of P. gingivalis to induce a response in fibroblasts Since the impaired capacity of Pg DluxS to induce a response in fibroblasts could not be restored by the addition of DPD, this defect may be caused by down-regulation of an AI-2 independent system in Pg DluxS. Previously, transcriptome analysis of Pg DluxS revealed that PGN_0482 was down-regulated in Pg DluxS, and expression was not restored by the addition of exogenous AI-2 [23]. This gene encodes for a putative outer membrane, immuno-reactive protein. To investigate if this gene is involved in the interaction of P. gingivalis with the fibroblasts, a knockout mutant Pg D0482 was constructed in strain ATCC 33277. PDL-fibroblasts were then challenged with this mutant, Pg wild-type, and Pg DluxS. Again, IL-6 MCP-1, and IL-1b were induced by Pg wild-type compared to non-challenged cells (p < 0.01, p < 0.01, and p < 0.05, respectively,

5

Fig. 3. Induction of cytokine gene-expression in PDL fibroblasts by challenge with P. gingivalis. Fold increase of mRNA expression of IL-6, MCP-1, and IL-1b, calculated relative to non-challenged cells (white bars), in PDL fibroblasts (donor 2) that were challenged for 4 h with Pg wild-type (gray bars), Pg DluxS (striped bars), or Pg D0482 (hatched bars). Bars represent the average induction ±SD in experiments performed four times. * indicate differences between Pg-strains, þ indicate differences compared to non-challenged cells ***p < 0.001, **p < 0.01, *p < 0.05.

Fig. 3). However, neither Pg D0482 nor Pg DluxS induced a response in the fibroblasts. This indicates that Pg D0482, similar to Pg DluxS, has an impaired ability to elicit a fibroblast inflammatory response. To confirm if the reduced ability of Pg D0482 to induce a response in fibroblasts was caused by the loss of PGN_0482 specifically, a complemented mutant was constructed in which PGN_0482 was expressed in trans in Pg D0482 from plasmid pTCOW (Pg D0482 þ 0482). PDL-fibroblasts were then challenged with Pg wild-type, Pg D0482, or Pg D0482 þ 0482. Gene-expression of IL-6 was induced in the fibroblasts by Pg wild-type and Pg D0482 þ 0482 compared to non-challenged cells (p ¼ 0.0306 and p ¼ 0.0056, respectively), but not by Pg D0482 (Fig. 4). Similarly, gene-expression of MCP-1 was induced by Pg wild-type and Pg D0482 þ 0482 compared to non-challenged cells (p ¼ 0.0398 and

Fig. 2. Induction of IL-6 gene-expression in PDL fibroblasts by challenge with P. gingivalis strains. Fold increase of mRNA expression of IL-6, calculated relative to non-challenged cells, in PDL fibroblasts (donor 1) that were challenged for 4 h with Pg wild-type (even bars), Pg DluxS (striped bars), or Pg DluxS and exogenous synthetic DPD, added during the challenge assay (Fig. A), or from the start of liquid culture (Fig. B) in the indicated concentrations (hatched bars). mRNA expression was normalized to housekeeping gene b2microglobulin; bars represent the average induction ± SD in experiments performed four times. * indicate differences between wild-type Pg and DluxS ± AI-2, þ indicate difference compared to non-challenged cells. ***p < 0.001, *p < 0.05.

Please cite this article in press as: Scheres N, et al., LuxS signaling in Porphyromonas gingivalis-host interactions, Anaerobe (2014), http:// dx.doi.org/10.1016/j.anaerobe.2014.11.011

6

N. Scheres et al. / Anaerobe xxx (2014) 1e7

Fig. 4. Induction of IL-6 and MCP-1 gene expression in PDL fibroblasts by challenge with P. gingivalis. Fold increase of mRNA expression of IL-6 and MCP-1, calculated relative to non-challenged cells (white bars), in PDL fibroblasts (donor 2) that were challenged for 4 h with Pg wild-type (gray bars), Pg D0482 (striped bars), or Pg D0482 þ 0482 (hatched bars). Bars represent the average induction ±SD in experiments performed four times. * indicate differences between Pg-strains, þ indicate differences compared to non-challenged cells. ***p < 0.001, **p < 0.01, *p < 0.05.

p ¼ 0.0056, respectively), but not by Pg D0482 (Fig. 4). This suggests that the PGN_0482 gene product is indeed responsible for the failure of Pg D0482 to induce a cytokine response in fibroblasts. Also, PGN_0482 is, at least partially, responsible for the inability of Pg DluxS to induce a cytokine response in fibroblasts. 4. Discussion The present study aimed to investigate the role of LuxSsignaling in the interaction between P. gingivalis and human oral cells. In an in vitro infection model we assessed the ability of mutant P. gingivalis strains, with defects in LuxS-signaling related genes (see Table 1), to induce an inflammatory response in PDL fibroblasts. First, we found that a mutation in luxS drastically reduces the capacity of P. gingivalis to induce an inflammatory response in PDL fibroblasts. A series of challenge assays was performed, in which fibroblast IL-6, MCP-1 and IL-1b responses to the Pg DluxS strain were either completely absent, or clearly lower compared to wildtype P. gingivalis. Although some day-to-day variation existed between experiments regarding the strength of the fibroblast responses e IL-1b gene-expression could for instance not always be detected - the difference between Pg DluxS and Pg wild-type was consistent. Reintroduction of luxS on a plasmid restored the ability to induce a response in fibroblasts. Although Pg DluxS has a mutation in luxS preventing synthesis of the AI-2 precursor DPD, it remains responsive to AI-2. Therefore, addition of exogenous AI-2 is able to complement the luxS knockout as shown previously [23]. However, when the AI-2 precursor DPD was added to Pg DluxS either during fibroblast challenge assays or from the beginning of liquid culture, the ability of Pg DluxS to induce a response in fibroblasts was not restored. Thus, the reduced ability of Pg DluxS to induce a response in host cells seems to result from a defect in an AI-2 independent but LuxS-dependent system. AI-2 independent effects of LuxS have also been reported in other organisms. For example, LuxS-dependent biofilm formation by Streptococcus sanguinis does not require DPD pools but is

associated with an intact activated methionine cycle [30]. Transcriptome analysis of the P. gingivalis luxS mutant indicated that luxS is involved in both AI-2 dependent, and AI-2 independent gene regulation [23]. One of the P. gingivalis genes down-regulated in the luxS mutant, and whose expression could not be restored by chemical complementation with synthetic DPD, is PGN_0482, which encodes a 23 kDa immuno-reactive putative outer membrane protein. We hypothesized that down-regulation of this gene in Pg DluxS was responsible for the reduced ability to induce a response in host cells. And indeed, similar to Pg DluxS, the PGN_0482 knockout P. gingivalis strain Pg D0482 had a reduced capacity to induce an inflammatory response in fibroblasts. Downregulation of PGN_0482 in Pg DluxS may thus be at least partially responsible for the defect in the luxS mutant. Although it is as yet unknown how the mutations in luxS and PGN_0482 lead to reduced fibroblast responses, we hypothesize that it involves a protein or complex of proteins on the P. gingivalis cell envelope. First, physical contact between P. gingivalis and the host cell is important for P. gingivalis to induce an inflammatory response; when P. gingivalis was physically separated from fibroblasts during challenge assays using a transwell insert, fibroblasts did not respond to any P. gingivalis strain (unpublished results). Second, the protein encoded by PGN_0482 was designated immuno-reactive [31]. It seems likely that such a protein is easily recognized by the host and is accessible on the outside of P. gingivalis. Consistent with this, PGN_0482 protein is by NCBI as a putative outer membrane protein. When taking this information into account, it is feasible that the reduced ability of mutants Pg DluxS and Pg D0482 to induce a fibroblast response are caused by an altered, or absent, cell envelope structure, which in turn affects the direct contact between P. gingivalis and fibroblasts. Interestingly, while a mutation in luxS had a clear effect on P. gingivalis-fibroblast interaction in the present study, Burgess and co-workers previously found no effect of a luxS mutation on P. gingivalis virulence in a mouse abscess model [20]. These contrasting results may of course depend on experimental factors such as the type of host and the infection model used. We must take into account that the present study is based on an in vitro model, and, although this model does focus specifically on oral cells rather than a subcutaneous infection, our results cannot simply be translated to an in vivo situation. It remains to be determined, however, whether LuxS has a role in alveolar bone loss. It is also noteworthy that Burgess and co-workers used P. gingivalis strain W50, which possesses a polysaccharide capsule [20]. Here, P. gingivalis strain ATCC 33277 was used, which has no capsule [32]. It is interesting to consider that if indeed a cell envelope structure of P. gingivalis is affected by a luxS or PGN-0482 mutation, this might be masked by the presence of a capsule. Alternatively, mutation in luxS is known to cause reduced transcription of the genes encoding the proteases Kgp and Rgp [20,21]. This too may lead to lower fibroblast responses, since these proteases are important P. gingivalis virulence factors, and protease mutants indeed induced less strong inflammatory responses in gingival fibroblasts in a previous study [29,33]. However, we tested the protease activity of the P. gingivalis mutants with a specific FRET substrate analysis [34], and although Pg DluxS had decreased protease activity compared to the wild-type, Pg D0482 protease activity was not affected (data not shown). The impaired ability of Pg D0482 to induce a response in fibroblasts is thus not caused by reduced protease activity. 5. Conclusion The results of this study indicate that LuxS-signaling in P. gingivalis takes an important part in the direct interaction with

Please cite this article in press as: Scheres N, et al., LuxS signaling in Porphyromonas gingivalis-host interactions, Anaerobe (2014), http:// dx.doi.org/10.1016/j.anaerobe.2014.11.011

N. Scheres et al. / Anaerobe xxx (2014) 1e7

fibroblasts, in an AI-2 independent fashion. This may occur through down-regulation of the gene PGN_0482, encoding a putative outer membrane immune-reactive, although the exact mechanism remains to be elucidated. This newly discovered function of LuxSsignaling might have a distinct role in P. gingivalis virulence. Acknowledgments We thank Ms. Lara van Woensel and Ms. Caroline Wiggers for their laboratory contributions to the many challenge assays, and Drs Sztukowska and Hirano for creation of mutant strains. The authors are grateful to Dr Michael Meijler for the gift of synthetic DPD. BPK is supported by a grant from the University of Amsterdam for research into the focal point ‘‘Oral Infections and Inflammation’’. RJL is supported by NIH/NIDCR DE01111, DE012505, and DE023193. References [1] Hojo K, Nagaoka S, Ohshima T, Maeda N. Bacterial interactions in dental biofilm development. J Dent Res 2009;88:982e90. [2] Wade WG. Has the use of molecular methods for the characterization of the human oral microbiome changed our understanding of the role of bacteria in the pathogenesis of periodontal disease? J Clin Periodontol 2011;38(Suppl. 11):7e16. [3] Hajishengallis G, Lamont RJ. Beyond the red complex and into more complexity: the polymicrobial synergy and dysbiosis (PSD) model of periodontal disease etiology. Mol Oral Microbiol 2012;27:409e19. [4] Hajishengallis G, Darveau RP, Curtis MA. The keystone-pathogen hypothesis. Nat Rev Microbiol 2012;10:717e25. [5] Hajishengallis G, Liang S, Payne MA, Hashim A, Jotwani R, Eskan MA. Lowabundance biofilm species orchestrates inflammatory periodontal disease through the commensal microbiota and complement. Cell Host Microbe 2011;10:497e506. [6] Cullinan MP, Seymour GJ. Periodontal disease and systemic illness: will the evidence ever be enough? Periodontol 2000;2013(62):271e86. [7] Pihlstrom BL, Michalowicz BS, Johnson NW. Periodontal diseases. Lancet 2005;366:1809e20. [8] Shrihari TG. Potential correlation between periodontitis and coronary heart diseaseean overview. Gen Dent 2012;60:20e4. [9] Huang R, Li M, Gregory RL. Bacterial interactions in dental biofilm. Virulence 2011;2:435e44. [10] McNab R, Lamont RJ. Microbial dinner-party conversations: the role of LuxS in interspecies communication. J Med Microbiol 2003;52:541e5. [11] Bassler BL. How bacteria talk to each other: regulation of gene expression by quorum sensing. Curr Opin Microbiol 1999;2:582e7. [12] Schauder S, Shokat K, Surette MG, Bassler BL. The LuxS family of bacterial autoinducers: biosynthesis of a novel quorum-sensing signal molecule. Mol Microbiol 2001;41:463e76. [13] Chung WO, Park Y, Lamont RJ, McNab R, Barbieri B, Demuth DR. Signaling system in Porphyromonas gingivalis based on a LuxS protein. J Bacteriol 2001;183:3903e9. [14] Jakubovics NS. Talk of the town: interspecies communication in oral biofilms. Mol Oral Microbiol 2010;25:4e14. [15] Vendeville A, Winzer K, Heurlier K, Tang CM, Hardie KR. Making 'sense' of metabolism: autoinducer-2, LuxS and pathogenic bacteria. Nat Rev Microbiol 2005;3:383e96.

7

[16] McNab R, Ford SK, El-Sabaeny A, Barbieri B, Cook GS, Lamont RJ. LuxS-based signaling in Streptococcus gordonii: autoinducer 2 controls carbohydrate metabolism and biofilm formation with Porphyromonas gingivalis. J Bacteriol 2003;185:274e84. [17] Pan H, Ma Y, Wang D, Wang J, Jiang H, Pan S. Effect of IFN-alpha on KC and LIX expression: role of STAT1 and its effect on neutrophil recruitment to the spleen after lipopolysaccharide stimulation. Mol Immunol 2013;56:12e22. [18] Fong KP, Chung WO, Lamont RJ, Demuth DR. Intra- and interspecies regulation of gene expression by Actinobacillus actinomycetemcomitans LuxS. Infect Immun 2001;69:7625e34. [19] Jang YJ, Choi YJ, Lee SH, Jun HK, Choi BK. Autoinducer 2 of Fusobacterium nucleatum as a target molecule to inhibit biofilm formation of periodontopathogens. Arch Oral Biol 2013;58:17e27. [20] Burgess NA, Kirke DF, Williams P, Winzer K, Hardie KR, Meyers NL. LuxSdependent quorum sensing in Porphyromonas gingivalis modulates protease and haemagglutinin activities but is not essential for virulence. Microbiology 2002;148:763e72. [21] James CE, Hasegawa Y, Park Y, Yeung V, Tribble GD, Kuboniwa M, et al. LuxS involvement in the regulation of genes coding for hemin and iron acquisition systems in Porphyromonas gingivalis. Infect Immun 2006;74:3834e44. [22] Yuan L, Hillman JD, Progulske-Fox A. Microarray analysis of quorum-sensingregulated genes in Porphyromonas gingivalis. Infect Immun 2005;73:4146e54. [23] Hirano T, Beck DA, Demuth DR, Hackett M, Lamont RJ. Deep sequencing of Porphyromonas gingivalis and comparative transcriptome analysis of a LuxS mutant. Front Cell Infect Microbiol 2012;2:79. [24] Scheres N, Laine ML, de Vries TJ, Everts V, van Winkelhoff AJ. Gingival and periodontal ligament fibroblasts differ in their inflammatory response to viable Porphyromonas gingivalis. J Periodontal Res 2010;45:262e70. [25] Hirano T, Beck DA, Wright CJ, Demuth DR, Hackett M, Lamont RJ. Regulon controlled by the GppX hybrid two component system in Porphyromonas gingivalis. Mol Oral Microbiol 2013;28:70e81. [26] Shoemaker NB, Getty C, Gardner JF, Salyers AA. Tn4351 transposes in Bacteroides spp. and mediates the integration of plasmid R751 into the Bacteroides chromosome. J Bacteriol 1986;165:929e36. [27] Scheres N, Laine ML, Sipos PM, Bosch-Tijhof CJ, Crielaard W, de Vries TJ, et al. Periodontal ligament and gingival fibroblasts from periodontitis patients are more active in interaction with Porphyromonas gingivalis. J Periodontal Res 2011;46:407e16. [28] Bachtiar Endang W, Bachtiar BM, Jarosz Lucja M, Amir Lisa, Sunarto Hari, Ganin Hadas, et al. AI-2 of Aggregatibacter actinomycetemcomitans inhibits Candida albicans biofilm formation. Front Cell Infect Microbiol Jul 21, 2014;4: 94. [29] Scheres N, Crielaard W. Gingival fibroblast responsiveness is differentially affected by Porphyromonas gingivalis: implications for the pathogenesis of periodontitis. Mol Oral Microbiol 2013;28:204e18. [30] Redanz S, Standar K, Podbielski A, Kreikemeyer B. Heterologous expression of sahH reveals that biofilm formation is autoinducer-2-independent in Streptococcus sanguinis but is associated with an intact activated methionine cycle. J Biol Chem 2012;287:36111e22. [31] Naito M, Sato K, Shoji M, Yukitake H, Ogura Y, Hayashi T. Determination of the genome sequence of Porphyromonas gingivalis strain ATCC 33277 and genomic comparison with strain W83 revealed extensive genome rearrangements in P. gingivalis. DNA Res 2008;15:215e25. [32] Laine ML, van Winkelhoff AJ. Virulence of six capsular serotypes of Porphyromonas gingivalis in a mouse model. Oral Microbiol Immunol 1998;13:322e5. [33] Imamura T. The role of gingipains in the pathogenesis of periodontal disease. J Periodontol 2003;74:111e8. [34] Kaman WE, Galassi F, de Soet JJ, Bizzarro S, Loos BG, Veerman EC. Highly specific protease-based approach for detection of Porphyromonas gingivalis in diagnosis of periodontitis. J Clin Microbiol 2012;50:104e12.

Please cite this article in press as: Scheres N, et al., LuxS signaling in Porphyromonas gingivalis-host interactions, Anaerobe (2014), http:// dx.doi.org/10.1016/j.anaerobe.2014.11.011