General and Comparative Endocrinology 198 (2014) 1–12

Contents lists available at ScienceDirect

General and Comparative Endocrinology journal homepage: www.elsevier.com/locate/ygcen

Luteinizing hormone, insulin like growth factor-1, and epidermal growth factor stimulate vascular endothelial growth factor production in cultured bubaline granulosa cells V. Babitha a, V.P. Yadav a, V.S. Chouhan a, I. Hyder a, S.S. Dangi a, Mahesh Gupta a, F.A. Khan b, G. Taru Sharma a, M. Sarkar a,⇑ a b

Physiology & Climatology, Indian Veterinary Research Institute, Izatnagar, Bareilly, Uttar Pradesh 243122, India Department of Animal Sciences and D.H. Barron Reproductive and Perinatal Biology Research Program, University of Florida, Gainesville, FL, USA

a r t i c l e

i n f o

Article history: Received 26 July 2013 Revised 9 November 2013 Accepted 10 December 2013 Available online 17 December 2013 Keywords: Buffalo Granulosa cells EGF IGF-1 LH VEGF

a b s t r a c t The objective of this study was to characterize in vitro expression and secretion of vascular endothelial growth factor (VEGF) in bubaline granulosa cells (GC), grown in serum containing media supplemented with luteinizing hormone (LH), insulin like growth factor-1 (IGF-1), and epidermal growth factor (EGF) at three different doses and time durations. GCs were collected from ovarian follicles of varying diameters [Gp-I (small), 4–6 mm; Gp-II (medium), 7–9 mm; Gp-III (large), 10–13 mm; Gp-IV (pre-ovulatory), >13 mm]. In general, each of the three treatments resulted in a dose as well as time dependent increase in the mRNA expression and secretion of VEGF in the cultured GCs of Gp-IV follicles. These results were well supported by our observations on immunocytochemistry in Gp IV granulosa cell culture (GCC). We also looked into the expression dynamics of an anti-apoptotic factor – proliferating cellular antigen (PCNA) and a pro-apoptotic factor – Bcl-2-associated X protein (BAX) in GCs of Gp IV follicles on treatments with LH, IGF-1, and EGF to evaluate their cytoprotective/anti-apoptotic property. Relative expressions of PCNA and BAX showed a mutually opposite trend with the PCNA expression increasing and BAX expression decreasing with increase in dose and time to reach the zenith (P < 0.05) and nadir (P < 0.05) at the highest dose(s) at the maximum time duration (72 h) for PCNA and BAX respectively on treatment with all the three factors. Thus, it can be concluded that LH, IGF-1, and EGF treatments have a cytoprotective/anti-apoptotic effect and stimulate VEGF production in granulosa cells of bubaline pre-ovulatory follicles. Ó 2013 Elsevier Inc. All rights reserved.

1. Introduction The buffalo cow is an economically important livestock species in many Asian, Mediterranean and Latin countries. Its genetic improvement, especially in reproductive performance stands high amidst agricultural research requirements of these countries. Several aspects of reproduction in the buffalo cows are reported to be similar to dairy cattle (Jainudeen and Hafez, 1993). However, a better understanding of follicular growth and ovulation may be essential for augmenting conception rate and for minimizing early embryonic losses. The failures in conception often may arise due to defects in the process of transformation of follicular structure into luteal structure essential for maintenance of pregnancy in these animals (Jainudeen and Hafez, 1993). Follicle development in buffalo follows the same pattern as in cattle and the dominant follicle is typically the first member of the cohort to reach 9 mm in ⇑ Corresponding author. Fax: +91 0581 2301327. E-mail address: [email protected] (M. Sarkar). 0016-6480/$ - see front matter Ó 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.ygcen.2013.12.004

diameter (Ginther et al., 2003) and the only one to continue growing to ovulatory size (about 14–20 mm). During ovarian follicular development, vascularisation happens in a well-orchestrated manner. Primary and primordial follicles are dependent on stromal blood vessels for nutrients, since they lack their own blood supply (Fraser and Wulff, 2001). Thereafter a separate theca layer is acquired by the developing follicle, recruiting endothelial cells from neighboring vasculature (Barboni et al., 2000). It is observed that the extent of angiogenesis gets enhanced with development reaching its zenith in the dominant follicle. This justifies the preferential delivery of nutrients, gonadotropins, steroids, and lipids to the dominant follicle when compared to its counterparts in the wave. It has been well established that though the follicle growth in monovular species is chiefly regulated by the pituitary gonadotropins, mediation by certain local growth factors such as VEGF, fibroblast growth factor (FGF), angiopoietin (ANGPT), IGF-1, and EGF are inevitable, without which the follicle fails to grow further. Of these factors, the initiation and further progression of follicular angiogenesis is primarily regulated by VEGF

2

V. Babitha et al. / General and Comparative Endocrinology 198 (2014) 1–12

(Berisha et al., 2000). Gonadotropins stimulate ovarian follicular angiogenesis by regulating the expression of many growth factors and cytokines, which include IGF, EGF, transforming growth factor (TGF), FGF, and VEGF (Shimizu et al., 2002). VEGF is the key angiogenic factor and the VEGF family (VEGF isoforms and VEGF receptors) has been found to play an important role in recruitment, growth, and in the establishment of dominance of antral follicles in cattle (Berisha et al., 2000), buffalo (Babitha et al., 2013), humans (Kamat et al., 1995), and pigs (Barboni et al., 2000). Ovary is a major site of hormone regulated IGF production in mammals (Giudice, 1992). The IGFs act as modulators of gonadotropin function at cellular level and stimulate granulosa and thecal cell proliferation and differentiation, and in bovines, a high concentration of IGF-1 was detected in dominant follicle (Schams et al., 2002). It is observed of late that IGF-1 and IGF-2 not only stimulated VEGF as well as progesterone production by GCs, but also synergized with gonadotropins to maintain secretory activity throughout the culture interval in luteinized GCs in monkeys (Martinez-Chequer et al., 2003). The IGF-1, a potent stimulator of cellular proliferation, differentiation and development, regulates GC steroidogenesis and apoptosis during follicular development. Epidermal growth factor is one of the members of a large family of closely related proteins including HB-EGF, amphiregulin, (AREG), epiregulin (EREG), betacellulin (BTC), epigen, and neuregulins (Yarden and Sliwkowski, 2001). The EGF is shown to stimulate GC proliferation, differentiation, and steroidogenesis (Mondschein and Schomberg, 1981), modulate follicular development through a paracrine mechanism in gonadotropin primed immature rats (Katabuchi et al., 1996) and induce angiogenesis in vivo in the hamster cheek pouch (Schreiber et al., 1986). Like IGF-1, EGF also plays a very important role in mediating some of the responses of the pre-ovulatory follicle to the pre-ovulatory LH surge (Conti, 2006), one of them being the angiogenic action of EGF in the ovary (Jiang et al., 2001; Miyamoto et al., 1996). The expression of the prime angiogenic factor, VEGF in GC has been explored widely in bovine (Garrido et al., 1993) and buffalo (Babitha et al., 2013) and the in vitro expression of VEGF in GCs is found to be regulated and enhanced by LH (Christenson and Stouffer, 1997), IGF-1 (Schams et al., 2001), and EGF (Frank et al., 1995). Apoptosis occurs throughout follicle development, with an extensive reduction in the number of follicles present at birth. Interestingly, this drastic reduction is not present among preovulatory follicles responding to the ovulatory surge of luteinizing hormone (LH), and various other local factors since the number of corpora lutea roughly equals the number of pre-ovulatory follicles (Svensson et al., 2000). Granulosa cells exposed to LH surge, along with other local growth factors in in vivo conditions are observed to have lesser extent of apoptosis. A delicate balance between survival and apoptotic factors may determine whether a follicle will continue developing or undergo atresia (Amsterdam et al., 2003; Hsu and Hsueh, 2000). Luteinizing hormone, IGF-1, and EGF are observed to promote proliferation and prevent the spontaneous onset of apoptosis in cultured early antral and pre-ovulatory follicles (Chun et al., 1996; Mao et al., 2004; Tilly et al., 1992). Hence it is pertinent to study the effect of these factors in regulation of GC apoptosis in bubaline pre-ovulatory follicles. The aim of our study was to test under in vitro conditions whether separate treatments of LH, IGF-1 and EGF could bring about changes in VEGF expression and secretion by cultured GCs from different sized bubaline follicles. In addition, temporal and dose dependent in vitro expression patterns of a classic anti-apoptotic factor (PCNA) as well as a pro-apoptotic factor (BAX) in the GCC of Gp IV follicles on treatment with LH, IGF1, and EGF were evaluated.

2. Materials and methods 2.1. Collection of follicles and preparation Buffalo ovaries were obtained from a local abattoir and transported to the laboratory at 38 °C in 0.9% sterile saline supplemented with 50 lg/ml Gentamycin sulphate solution within 2–3 h of slaughter. Only follicles that were deemed healthy, i.e. with a well vascularized wall and transparent, amber-colored follicular fluid without debris, were used. 2.2. Follicle classification The follicles were classified according to their diameter measured from the ovarian surface as (i) 4–6 mm (Gp-I); (ii) 7–9 mm (Gp-II); (iii) 10–13 mm (Gp-III); (iv) >13 mm (Gp-IV). About fifty ovaries with follicles were used to extract 10 follicles each per group, from which GCs were obtained from FF for cell culture. 2.3. Granulosa cell culture and treatments Ovaries were washed properly with physiological saline solution and GCs were collected from all the 4 stages of follicles separately by aspiration of FF using a needle (18 gauge) and syringe (plastic, 10 ml). Aspirants were transferred to a 60-mm dish, under sterile conditions, containing 0.1% solution of PBS, and all cumulusoocyte complexes were recovered. The remaining cells and fluids were centrifuged in 15-ml conical tubes at 300g for 5 min, and the GC pellet was resuspended in 10 ml of 1 PBS prior to a second centrifugation. Finally, GCs were resuspended and washed in culture medium – Medium 199 (supplemented with 10% FBS, antibiotic, antimycotic, L-glutamine). The number of viable cells was determined using trypan blue exclusion. Then the cells were centrifuged, resuspended and seeded at a density of 2  105 viable cells/well (in three 24-well culture plate-NEST, China) in 1 ml Medium 199 containing Earle’s salts and NaHCO3, with L-glutamine, 25 mmol Hepes/l (M 2154), 10% fetal bovine serum (lot #1028022); 10,000 U penicillin/l, 10 mg streptomycin/l, 25 lg amphotericin/ml, and 65 mg ascorbic acid/l. The seeded cells were cultured at 37 °C for 48 h in a 5% CO2 atmosphere until they attain around 70% confluency and then cells were washed with Medium 199 to remove unattached cells and any remaining tissue debris. Cells were further incubated with treatments – LH (bovine LH; AFP 117438-NHPP-NIDDK), IGF-1 (human IGF-1; lot #01, NHPP-NIDDK) and EGF (murine EGF lot #3147K; MP Biomedicals) added to serum containing Medium 199 (at three different concentrations) for three time durations viz. 24, 48 and 72 h before RNA was harvested. The concentrations adopted were as follows: LH (0.1, 1 and 10 ng/ml media), IGF-1 (5, 10 and 50 ng/ml media) and EGF (5, 10 and 50 ng/ml media). At the end of the specific time duration, the spent culture media from each well was collected and stored at 20 °C till VEGF assay, and the harvested cells were used for mRNA isolation. All experiments were repeated three times in triplicate maintaining controls. 2.4. Primers For primer design the Fast PCR. (Version: 6.2.73) software was used. The details of the primers used are shown in Table 1. 2.5. Quantitative RT-PCR analysis Total RNA was isolated by Trizol reagent (Invitrogen, USA) according to manufacturer instructions from harvested GC (n = 3) of all four follicular groups (VEGF) as well as of GP-IV follicles

3

V. Babitha et al. / General and Comparative Endocrinology 198 (2014) 1–12

Table 1 Target gene, primer sequences and amplicon length for qRT-PCR used in the study of granulosa cell culture(GCC) from ovarian follicles of different size recovered from water buffalo (Bubalus bubalis). Gene

Sequences 50 –30

Efficiency (%)

Amplicon length (bp)

EMBL accession No. or reference

VEGF T

Forward: CCATGAACTTTCTGCTCTCTTGG Reverse: TCCATGAACTTCACCACTTCG Forward: ACCTGCAGAGCATGGACTCGTC Reverse: CATGCTGGTGAGGTTCACGCCCA Forward: TCTGACGGCAACTTCAACTG Reverse: AAGTAGGAGAGGAGGCCGTC Forward: GCGATACTCACTCTTCTACTTTCGA Reverse: TCGTACCAGGAAATGAGCTTGAC

98.2

133

NM-174216.1

98.6

160

NM_001034494.1

99.1

250

NM_173894.1

94.7

82

PCNA BAX GAPDH

(PCNA and BAX) seperately. RNA quality, quantity and integrity were verified by agarose gel electrophoresis and spectrophotometric readings. Constant amounts of 1 lg of total RNA from GCC (n = 3/group) were reverse transcribed using iScript™ Select cDNA Synthesis Kit (Bio-Rad laboratories, CA) and oligo-dT18 primer at 42 °C for 90 min. The resulting complimentary DNAs (cDNAs) were used in qRT-PCR reactions.

U85042.1

melting temperature, which is product specific and a high resolution gel electrophoresis was used to verify that transcripts were of exact molecular size and further confirmed by sequence analysis. Negative control PCR containing all components except template were included for each sample to check out the formation of primer dimer. For qPCR analysis of each gene including the house keeping gene, three replicates of GCC from each treatment group/dose/time period of treatment were used.

2.6. RNA integrity and purity 2.8. VEGF assay The integrity of total RNA was checked on 1.0% agarose gel using 1 TBE as electrophoresis buffer. Total RNA was in good yield in all the samples. The bands of 28sRNA and 18sRNA reflected the high quality of extracted total RNA. The purity and concentration of total RNA was checked using nanodrop. Isolated RNA samples were free from the protein contamination as the OD 260: OD 280 values were more than 1.8. The concentrations of the RNA samples were in the range of 200–2000 ng/ll.

VEGF concentration in harvested spent media was determined in duplicate by ELISA (Mouse VEGF immune assay Quantikine, lot #295951; catalog MMV00, R&D systems Inc; Minnaepolis, MN, USA) following the manufacturer’s instructions. Intra- and interassay coefficients of variation were 4.3% and 5.7% for VEGF. The minimum detectable dose (MDD) of mouse VEGF is typically less than 3.0 pg/mL.

2.7. Gene expression analysis

2.9. Immunocytochemistry

The control maintained for each treatment group/dose/time period was used as calibrator for obtaining relative mRNA expression. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as housekeeping gene. Efficiency corrected relative quantification of mRNA was obtained as described earlier (Pfaffl, 2001). For this, efficiency of primers was determined by serial dilution of template cDNA sample and running in triplicate. The qRT-PCR for each cDNA and the housekeeping gene GAPDH was performed in duplicate using SsoFast™ Eva GreenÒ Supermix kit (Bio-Rad, USA) in an Agilent Stratagene MX3005P Real-Time qPCR System instrument as per manufacturer’s instructions. Briefly, PCR templates containing 25 ng reverse transcribed total RNA was added to 0.25 ll forward primer (0.2 mM), 0.25 ll reverse primer (0.2 mM) and 5 ll of SsoFast™ Eva GreenÒ Supermix to a final volume of 10 ll and were subjected to general real-time PCR protocol for all investigated factors. The following general real-time PCR protocol was employed for all investigated factors: denaturation for 30 s at 95 °C, 40 cycles of a three segmented amplification and quantification program denaturation for 10 s at 95 °C, annealing for 10 s at the primer specific temperature (58 °C for VEGF T; 55 °C for PCNA; 63 °C for BAX and 60 °C for GAPDH), elongation for 15 s at 72 °C, a melting step by slow heating from 61 to 95 °C with a rate of 0.58 °C/s and continuous fluorescence measurement, and a final cooling down to 4 °C. After the run ended, cycle threshold (Ct) values and amplification plot for all determined factors were acquired by using the ‘‘EVA green (with dissociation curve)’’ method of the real time machine (MxPro3005P Stratagene, Agilent Technologies, USA). Real-time PCR efficiencies were determined by amplification of a standardized dilution series, and slopes were obtained. The specificity of desired products was documented using analysis of

Cells were grown over glass coverslips of 12 mm diameter in the wells of 24 well plates and treated with the three factors, as described before, maintaining positive and negative control wells in parallel. At the end of treatments, the cells grown over the coverslips were fixed within wells with ice-cold acetone–methanol (1:1) for 5 min at 4 °C after removal of the spent media. Non-specific binding was blocked with 5% BSA for 40 min at 37 °C. Thereafter the cells were incubated with primary polyclonal anti-goat VEGF164 antibody (AF-493-NA, Lot #YU1210101; 1:100 dilution) overnight at 4 °C and then washed three times with 1 PBS. In order to detect the primary antibody, cells were incubated with CFL 488-conjugated secondary antibody (SC-362254; Lot #B0812 1:800 dilution), for 40 min at room temperature, and washed three times in 1 PBS. The primary and secondary antibodies were diluted in 1% BSA in PBS. After immunostaining, the coverslips were stained with DAPI (0.4 lg/ml in PBS) to stain the nuclei of the cells in the culture over coverslips. The negative controls were processed under similar conditions except for the omission of the primary antibody. Fluorescently stained cell cultures on coverslips were mounted with antifade mounting media (MP Biomedicals) and images were captured using Axio Observer.Z1 (Carl Zeiss Micro Imaging GmbH, Germany) microscope. Both antibodies for immunocytochemistry were obtained from Santa Cruz Biotechnology, CA. 2.10. Statistical analyses All experimental data are shown as mean ± SEM. The statistical significance of differences in mRNA expressions of VEGF, PCNA and BAX, and VEGF concentrations in spent culture media was assessed

V. Babitha et al. / General and Comparative Endocrinology 198 (2014) 1–12

by one-way ANOVA followed by the Holm–Sidak as a multiple comparison test. Differences were considered significant if P < 0.05.

the control. In the 72 h treatment, VEGF expression at 50 ng/ml concentration was greater (P < 0.05) than at other lower concentrations and control, while both 5 and 10 ng/ml IGF-1 treatment showed a higher (P < 0.05) VEGF expression than the control group (Fig. 2A, C and E). VEGF levels in the spent culture media showed a time and dose dependent rise on IGF-1 treatment only in Gp-IV GCC with a significant (P < 0.05) rise observed at both 48 and 72 h for all three IGF-1 levels compared to control. But at 24 h duration, 10 and 50 ng/ml IGF-1 stimulated an enhanced (P < 0.05) VEGF secretion than both control and 5 ng/ml IGF-1 treatment (Fig. 2B, D and F).

3. Results 3.1. Effects of treatment with gonadotropin and growth factors on VEGF expression in cultured ovarian GCs 3.1.1. Effect of LH on VEGF expression in GCC and VEGF concentration in harvested media Treatment with LH resulted in a dose as well as time dependent rise in VEGF expression only in Gp-IV follicles. Significant (P < 0.05) differences were recorded between all concentrations at 24 and 48 h. However, at 72 h there was no difference between 1 and 10 ng/ml LH treatments and both stimulated a greater (P < 0.05) rise in VEGF expression compared to control as well as 0.1 ng/ml LH treatment, with the control group expressing significantly (P < 0.05) lower VEGF than 0.1 ng/ml LH treatment group (Fig. 1A, C and E). On assay by ELISA, VEGF concentration dynamics in culture media followed almost same pattern as that of the mRNA expression. At 24 h, only 10 ng/ml, at 48 h both 1 and 10 ng/ml and at 72 h all three concentrations, respectively of LH brought about significant (P < 0.05) rise in VEGF level in spent media in comparison to other lower LH level(s) and/or control in Gp-IV GCC. At 72 h, 10 ng/ml LH stimulated a higher (P < 0.05) media VEGF level than the two lower concentrations in Gp-IV GCC (Fig. 1B, D and F). However, Gp-I, II, and III GCs failed to show any significant variation in VEGF mRNA and protein levels on in vitro LH treatment.

3.1.3. Effect of EGF on VEGF expression in GCC and VEGF concentration in harvested media Like LH and IGF-1, EGF treatment too failed to stimulate a change in VEGF expression in GCC of all follicular groups other than Gp-IV GCC. All the three concentrations showed a significant (P < 0.05) increase in VEGF expression compared to the control at 24 and 48 h durations of treatments in Gp-IV GCC. However at 72 h treatment, VEGF expression at 5 and 10 ng/ml concentrations was higher (P < 0.05) than control, but lower (P < 0.05) than the expression observed at 50 ng/ml EGF level (Fig. 3A, C and E). A rise (P < 0.05) in VEGF concentration was detected by ELISA in spent media of Gp IV follicle at the highest dose (50 ng/ml) at 72 h compared to lower EGF levels and control, while all the three levels stimulated an augmented (P < 0.05) VEGF secretion than the control group at both 24 and 48 h durations of treatment (Fig. 3B, D and F). Similar to LH and IGF-1, neither the VEGF expression in GCC nor the VEGF levels in media showed any fluctuations on EGF treatment at any of the three dose-time combinations in the smaller follicular groups (Fig. 3).

3.1.2. Effect of IGF-1 on VEGF expression in GCC and VEGF concentration in harvested media IGF-1 stimulated a dose dependent and time dependent rise in VEGF expression in Gp-IV GCC at 24, 48 and 72 h, but other groups of follicles failed to show any change in expression. A significant (P < 0.05) rise was observed at IGF-1 concentration of 5, 10 and 50 ng/ml media in Gp-IV GCC at 24 and 48 h when compared to

25 20

b

b

b

15

a

(F)

10 5 0 control

0.1

1

45 40 35 30 25 20

5 0 control

a

b c

3 2

a a

a a

a a

a

a a

a d

a

a

0 Gp I

Gp II

Gp III

follicular groups

1

10

Gp I Gp II Gp III Gp IV

Gp IV

a

b

b

0.1

1

c

control

10

LH conc.(ng/ml media)

(E)

(C) 9

relative expression

relative expression

4

0.1

65 60 55 50 45 40 35 30 25 20 15 10 5 0

LH conc.(ng/ml media)

(A) 5

b

b

10

10

control 0.1 ng LH /ml media 1 ng LH /ml media 10 ng LH /ml media

a

15

LH conc.(ng/ml media)

6

a

Gp I Gp II Gp III Gp IV

VEGF conc.(pg/ml media)

Gp I Gp II Gp III Gp IV

30

1

Immunocytochemistry using GCC of Gp IV follicles which received treatments of LH (Fig. 4), IGF-1 (Fig. 5) and EGF (Fig. 6)

(D)

35

VEGF conc.(pg/ml media)

VEGF conc.(pg/ml media)

(B)

3.2. Protein immuno-localization

control 0.1 ng LH /ml media 1 ng LH /ml media 10 ng LH /ml media

8 7 6

b c

5 4 3 2 1

a

a aa

a aa

a a a a

d

a

20

a relative expression

4

a

control 0.1ng LH /ml media 1 ng LH/ml media 10 ng LH /ml media

a

b

10

a aaa

a a aa

Gp I

Gp II

a

aa a

c

0

0 Gp I

Gp II

Gp III

follicular groups

Gp IV

Gp III

Gp IV

follicular groups

Fig. 1. Expression of VEGF mRNA in GCC, and concentration of VEGF in cell culture media on LH treatment for 24, 48 and 72 h at 3 different dose rates (GCC, n = 3/group) of four different follicle sizes in buffalo. (A) VEGF mRNA in GCC and (B) VEGF concentration in culture media on LH treatment for 24 h; (C) VEGF mRNA in GCC and (D) VEGF concentration in culture media on LH treatment for 48 h; (E) VEGF mRNA in GCC and (F) VEGF concentration in culture media on LH treatment for 72 h. Control group included. All the values are shown as mean ± SEM. Different superscripts denote statistically different values (P < 0.05). GCC: granulosa cell culture.

5

V. Babitha et al. / General and Comparative Endocrinology 198 (2014) 1–12

a b

10

b

5

0 control

5

10

20

10 5

3

2

a a aa 1

a

aaa

(C)

a a

6

5

10

b

4 3 2

aa

aa

aa a

1

a

a

Gp II

Gp III

b

10 5 0 5

10

50

IGF-1 conc.(ng/ml media)

a

(E) 12.5

aa

b

0

0 Gp I

15

control

a

aa

a

a

20

50

control 5ng IGF-1/ml media 10ng IGF-1/ml media 50ng IGF-1/ml media

5

aa a a

25

IGF-1 conc.(ng/ml media)

relative expression

relative expression

control 5ng IGF-1/ml media 10ng IGF-1/ml media 50ng IGF-1/ml media

30

0 control

a

4

a

b

50

Gp I Gp II Gp III Gp IV a

35

a

15

IGF-1 conc.(ng/ml media)

(A)

(F)

Gp I Gp II Gp III a Gp IV

25

VEGF conc.(pg/ml media)

VEGF conc.(pg/ml media)

15

(D)

a

VEGF conc.(pg/ml media)

Gp I Gp II Gp III Gp IV

20

relative expression

(B)

a

control 5ng IGF-1/ml media 10ng IGF-1/ml media 50ng IGF-1/ml media

10.0 7.5

b b

5.0 2.5

aa a

a

aa

aa

a

aaa

c

0.0

Gp I

Gp IV

Gp II

Gp III

Gp IV

Gp I

Gp II

Gp III

Gp IV

follicular groups

follicular groups

follicular groups

Fig. 2. Expression of VEGF mRNA in GCC, and concentration of VEGF in cell culture media on IGF-1treatment for 24, 48 and 72 h at 3 different dose rates (GCC, n = 3/group) of four different follicle sizes in buffalo. (A) VEGF mRNA in GCC and (B) VEGF concentration in culture media on IGF-1 treatment for 24 h; (C) VEGF mRNA in GCC and (D) VEGF concentration in culture media on IGF-1 treatment for 48 h; (E) VEGF mRNA in GCC and (F) VEGF concentration in culture media on IGF-1 treatment for 72 h. Control group included. All the values are shown as mean ± SEM. Different superscripts denote statistically different values (P < 0.05). GCC: granulosa cell culture.

7.5

15

a

b

5.0 2.5 0.0 control

5

10

Gp I Gp II Gp III Gp IV a

50

10

control 5ng EGF/ml media 10ng EGF/ml media 50ng EGF/ml media 2 a a a a a aa a aa a a

b

1

0 Gp I

Gp II

Gp III

follicular groups

Gp IV

a

5

0 control

5

10

a

Gp I Gp II Gp III Gp IV

25 20 15

b

control

a

2

1

a

a

a

a

a aa a a aaa

5

10

50

EGF conc.(ng/ml media)

(E) 10.0 3

b

0

control 5ng EGF/ml media 10ng EGF/ml media 50ng EGF/ml media

aa

control 5ng EGF/ml media 10ng EGF/ml media 50ng EGF/ml media

b

5

50

(C) 4

a

10

EGF conc.(ng/ml media)

relative expression

relative expression

aa

a

b

EGF conc.(ng/ml media)

(A) 3

(F) VEGF conc.(pg/ml media)

VEGF conc.(pg/ml media)

10.0

(D) a

b

relative expression

Gp I Gp II Gp III a Gp IV

12.5

VEGF conc.(pg/ml media)

(B)

7.5

a bb

5.0

2.5

a aa a a a a a a a a a c

0.0

0 Gp I

Gp II

Gp III

follicular groups

Gp IV

Gp I

Gp II

Gp III

Gp IV

follicular groups

Fig. 3. Expression of VEGF mRNA in GCC, and concentration of VEGF in cell culture media on EGF treatment for 24, 48 and 72 h at 3 different dose rates (GCC, n = 3/group) of four different follicle sizes in buffalo. (A) VEGF mRNA in GCC and (B) VEGF concentration in culture media on EGF treatment for 24 h; (C) VEGF mRNA in GCC and (D) VEGF concentration in culture media on EGF treatment for 48 h; (E) VEGF mRNA in GCC and (F) VEGF concentration in culture media on EGF treatment for 72 h. Control group included. All the values are shown as mean ± SEM. Different superscripts denote statistically different values (P < 0.05). GCC: granulosa cell culture.

at three different doses and durations revealed that VEGF (VEGF 164) was localized in GCs. In agreement with the mRNA expression and protein secretion profile, the most intense immunostaining by CFL 488 was evident (Fig. 4L, 5L and 6L) in the GCC treated with three factors at their maximum dose(s) maintained for the maximum time duration. The negative controls, without primary antibodies showed only a weak background staining.

3.3. Effects of treatment with gonadotropin and growth factors on PCNA and BAX expression in Gp-IV GCC 3.3.1. Effect of treatments on PCNA expression On LH, IGF-1 and EGF treatment of the GCC of pre-ovulatory follicles, PCNA showed a dose-dependent as well as time dependent rise (P < 0.05) in expression, at 24, 48 as well as 72 h at their

6

V. Babitha et al. / General and Comparative Endocrinology 198 (2014) 1–12

Fig. 4. Immunocytochemical localization of VEGF 164 in buffalo ovarian granulosa cell culture on LH treatment at 24, 48 and 72 h. Immunoreactivity of VEGF 164 in different groups of follicle development was stained with CFL 144 and merged with DAPI counterstain (blue), indicating the nuclei of all cells in the sections. Figs. A–C correspond to A–C: GCC control at 24 h (A), 48 h (B) and 72 h (C); D–F: GCC on LH treatment at 0.1 ng/ml media at 24 h (D), 48 h (E) and 72 h (F); G–I: GCC on LH treatment at 1 ng/ml media at 24 h (G), 48 h (H) and 72 h (I), J–L: GCC on LH treatment at 10 ng/ml media at 24 h (J), 48 h (K) and 72 h (L) and; M–O: GCC negative control at 24 h (M), 48 h (N) and 72 h (O). Negative control sections are presented without primary antibody labeling. Bars = 20 lm. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

V. Babitha et al. / General and Comparative Endocrinology 198 (2014) 1–12

7

Fig. 5. Immunocytochemical localization of VEGF 164 in buffalo ovarian granulosa cell culture on IGF-1 treatment at 24, 48 and 72 h. Immunoreactivity of VEGF 164 in different groups of follicle development was stained with CFL 144 and merged with DAPI counterstain (blue), indicating the nuclei of all cells in the sections. Figs. A–C correspond to A–C: GCC control at 24 h (A), 48 h (B) and 72 h (C); D–F: GCC on IGF-1 treatment at 5 ng/ml media at 24 h (D), 48 h (E) and 72 h (F); G–I: GCC on IGF-1 treatment at 10 ng/ml media at 24 h (G), 48 h (H) and 72 h (I), J–L: GCC on IGF-1 treatment at 50 ng/ml media at 24 h (J), 48 h (K) and 72 h (L) and; M–O: GCC negative control at 24 h (M), 48 h (N) and 72 h (O). Negative control sections are presented without primary antibody labeling. Bars = 20 lm. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

8

V. Babitha et al. / General and Comparative Endocrinology 198 (2014) 1–12

Fig. 6. Immunocytochemical localization of VEGF 164 in buffalo ovarian granulosa cell culture on EGF treatment at 24, 48 and 72 h. Immunoreactivity of VEGF 164 in different groups of follicle development was stained with CFL 144 and merged with DAPI counterstain (blue), indicating the nuclei of all cells in the sections. Figs. A–C correspond to A–C: GCC control at 24 h (A), 48 h (B) and 72 h (C); D–F: GCC on EGF treatment at 5 ng/ml media at 24 h (D), 48 h (E) and 72 h (F); G–I: GCC on EGF treatment at 10 ng/ml media at 24 h (G), 48 h (H) and 72 h (I), J–L: GCC on EGF treatment at 50 ng/ml media at 24 h (J), 48 h (K) and 72 h (L) and; M–O: GCC negative control at 24 h (M), 48 h (N) and 72 h (O). Negative control sections are presented without primary antibody labeling. Bars = 20 lm. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

9

V. Babitha et al. / General and Comparative Endocrinology 198 (2014) 1–12

(A) relative expression

control 0.1 ngLH/ml 1 ng LH/ml 10 ngLH/ml

15.0 12.5 10.0

a

a

7.5

a

5.0 2.5

b b

b b

b

b b

b 48h

(B)

72h

relative expression

a

48h

72h

a

a

a

aa

b b

control 5 ng IGF-1 /ml 10 ng IGF-1ng/ml 50 ng IGF-1/ml

b b

b 0.75

0.50

0.25

c 0.00

a

24h

48h

72h

Duration of IGF-1 treatment

b

b b b

b b

b

48h

b b

(A) 72h

Duration of IGF-1 treatment

a

control 5 ng EGF/ml 10 ng EGF/ml 50 ng EGF/ml a

relative expression

relative expression

relative expression

control 5 ng EGF /ml 10 ng EGF /ml 50 ng EGF /ml

b

a

1.00

a

control 5ng IGF-1 /ml 10 ng IGF-1/ml 50 ng IGF-1/ml

24h

12 11 10 9 8 7 6 5 4 3 2 1 0

a a a

Duration of EGF treatment

(B)

(C)

a a a a

24h

Duration of LH treatment 13 12 11 10 9 8 7 6 5 4 3 2 1 0

a a a a

1.0 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0.0

b

0.0 24h

relative expression

(C) 1.1

17.5

1.1 1.0 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0.0

24h

a

control 0.1ng LH/ml 1 ng LH/ml 10 ngLH /ml

a b c d b 24h

48h

b b

72h

Duration of LH treatment

a b b b

a

a a a

b b b 48h

b b b 72h

Duration of EGF treatment Fig. 7. Expression of PCNA mRNA in GCC on LH, IGF-1, EGF treatment for 24, 48 and 72 h at 3 different dose rates (GCC, n = 3/group) of Gp IV follicle in buffalo. (A) PCNA mRNA in GCC on LH treatment; (B) PCNA mRNA in GCC on IGF-1 treatment; and (C) PCNA mRNA in GCC on EGF treatment. Control group included. All the values are shown as mean ± SEM. Different superscripts denote statistically different values (P < 0.05). GCC: granulosa cell culture.

respective highest concentrations compared to lower doses and control (Fig. 7A–C).

3.3.2. Effect of treatments on BAX expression While EGF stimulated a dip (P < 0.05) in BAX expression only at 72 h treatment at the highest dose, both LH and IGF-1 treatments led to a dose dependent decline (P < 0.05) in BAX expression at 48 as well as 72 h. LH stimulated a steady reduction (P < 0.05) in BAX expression from control to highest LH level at 48 h, with increase in dose, while a reduced expression (P < 0.05) in vitro was recorded at all the three LH concentrations compared to the control, at 72 h. In case of IGF-1, however, when all the 3 doses brought about decrement (P < 0.05) in BAX expression than control at 48 h, 72 h treatment reduced (P < 0.05) BAX expression at 50 ng/ ml, compared to lower doses and control (Fig. 8A–C).

Fig. 8. Expression of BAX mRNA in GCC on LH, IGF-1, EGF treatment for 24, 48 and 72 h at 3 different dose rates (GCC, n = 3/group) of Gp IV follicle in buffalo. (A) BAX mRNA in GCC on LH treatment; (B) BAX mRNA in GCC on IGF-1 treatment; and (C) BAX mRNA in GCC on EGF treatment. Control group included. All the values are shown as mean ± SEM. Different superscripts denote statistically different values (P < 0.05). GCC: granulosa cell culture.

4. Discussion Earlier works on VEGF expression in ovarian granulosa cells of domestic species have revealed certain crucial findings: (1) the avascular GC layer is a major site of VEGF production within the bovine and buffalo follicle, (2) the VEGF expression in GC markedly increases corresponding to growth of follicles reaching a zenith in large (dominant) follicles in bovine and buffaloes (Babitha et al., 2013; Greenaway et al., 2004; Shimizu et al., 2002), and (3) the treatment of GCC with LH and IGF-1 at different dose-time combinations led to variable VEGF secretion in bovine pre-ovulatory follicles (Schams et al., 2001). These discoveries, in fact, encouraged us to investigate the direct effects of physiological and supraphysiological levels of the above factors as well as EGF, on in vitro VEGF expression and secretion in buffalo ovarian GCs collected from all developmental phases of follicles. The present study succeeded in detecting the dose and time dependent mRNA expression and protein secretion of VEGF in buffalo ovarian GCC (of all four groups), as well as in localizing VEGF protein in Gp-IV GCC treated with LH, IGF-1, and EGF during different follicular stages during estrus cycle in buffaloes. To our knowledge, it is the first in vitro study to

10

V. Babitha et al. / General and Comparative Endocrinology 198 (2014) 1–12

overview the expression dynamics of VEGF in buffalo GCC derived from all different follicular growth stages on independent stimulation with the above factors. The results obtained were correlated with VEGF concentrations of the spent culture media of above GCC to confirm whether the pattern of GCC VEGF expression and VEGF secretion by cultured GCs agree with each other. Since the GC VEGF expression and concentration in spent culture media were distinguishingly higher almost entirely only in the Gp-IV GCs compared to lower groups and control, immunolocalisation of VEGF was performed solely in Gp IV GCC (treated similarly with above factors) which could consolidate our findings. A previous work (Schams et al., 2001) in bovines which measured the concentration of VEGF and progesterone in spent culture media of GCC of pre-ovulatory follicles looked into the synergy between LH and IGF-1 over and above their separate effects but did not study the VEGF mRNA expression in the cells. To explore the survival/antiapoptotic roles, the effect of the treatment with same factors (LH, IGF-1 and EGF) on in vitro expression of a classic pro-apoptotic (BAX) and an anti-apoptotic/survival factor (PCNA) in GC of buffalo Gp IV follicles was investigated. Several works have been conducted so far on the in vitro culture of ovarian GC for the expression of VEGF on stimulation with various treatments including LH, IGF-1 and EGF. It is proved that these factors being angiogenic and mitogenic enhance the VEGF and survival factor expression especially in pre-ovulatory follicles of various species such as bovine (Schams et al., 2001), macaque (Christenson and Stouffer, 1997), primate (Taylor et al., 2004), and monkeys (Martinez-Chequer et al., 2003). Of late, apart from the classic angiogenesis, the cytoprotective actions occurring in the GCs of pre-ovulatory/dominant follicle also has captured much attention. In in vivo situations, the developing follicles and the pre-ovulatory follicles approaching ovulation in a follicular wave presumably have a higher concentration of LH (LH surge) as well as local factors like IGF-1 and EGF brought in by enhanced vascularisation consequent to growth, development and acquiring of dominance (Geva and Jaffe, 2004, 2007). In this study, we have attempted to mimic an in vivo situation wherein all growth stages of follicles are treated with normal and/or supraphysiological doses of the three factors added to GCs grown in serum containing medium (which might have supplemented minimum essential growth factors) and continued for various time durations. Thus, the doses of LH (0.1, 1 and 10 ng/ml media) and IGF-1 and EGF (5, 10 and 50 ng/ml media) were selected to encompass the expected range of concentrations of these factors within the growing and developing buffalo follicles. We found that the significant increase in GCC VEGF expression and immunolocalisation in GCC as well as VEGF secretion into the spent GCC media on separate treatments with LH, IGF-1 and EGF was observed mainly at their highest concentration(s) maintained for the longest time duration(s) almost only in Gp IV follicles. Similar positive stimulation of VEGF by LH had been demonstrated earlier in bovine (Garrido et al., 1993) and macaque (Christenson and Stouffer, 1997) pre-ovulatory follicular GCC. Moreover, it has been shown that the inhibition of gonadotropin secretion by a GnRH antagonist results in decreased VEGF expression, further supporting the suggestion that VEGF expression could be hormonally regulated (Taylor et al., 2004). Though the specific mechanisms that regulate VEGF-A expression during folliculogenesis and development are not completely understood a number of studies have shown that gonadotropins can stimulate VEGF-A transcription and translation both in vivo and in vitro (Geva and Jaffe, 2004, 2007). Also LH, a known activator of adenylate cyclase, was observed to induce VEGF mRNA expression in bovine GCC (Garrido et al., 1993) and in primate GCs in vivo (Hazzard et al., 1999). Similar to our findings, the synthesis and secretion of VEGF increased in cultures of GCs in cattle (Schams et al., 2001) and monkeys

(Martinez-Chequer et al., 2003) when exposed to IGF-I. Since we have used serum containing medium throughout the study in treatments and controls, IGF-1 added could have probably synergized with gonadotropins available in serum and amplified the VEGF expression and secretion directly proportional to the dose of IGF-1 supplied and duration of treatment as observed in monkey GC cultures (Martinez-Chequer et al., 2003). IGF-1 induces VEGF mRNA and protein production by both an increase in the transcriptional rate of the VEGF gene and the stability of mRNA (Warren et al., 1996). Furthermore, different concentrations of IGF-1 (10, 50 and 100 ng/ml) increased follicular diameter and steroidogenesis of mouse preantral follicles cultured in vitro for 6, 10 and 12 days (Demeestere et al., 2004). EGF was shown to improve VEGF expression as well as its secretion especially by GCC of Gp-IV follicles suggesting its possible angiogenic action in the ovary (Jiang et al., 2001; Miyamoto et al., 1996). Like IGF-1, EGF also plays a very crucial role in mediating and amplifying some of the responses of the pre-ovulatory follicle to the ovulatory luteinizing hormone (LH) surge (Conti, 2006) and stimulates synthesis of VEGF in GCC. In other tissues, exposure of quiescent human keratinocytes to EGF resulted in a marked induction of VEGF mRNA expression (Frank et al., 1995). EGF also stimulates VEGF release by cultured glioblastoma cells (Goldman et al., 1993). All the above findings agree well with a similar work which showed an increase in VEGF secretion into the media at dose rates of 1.0 and 50 ng/ml of LH and IGF-1 respectively (Schams et al., 2001) in bovine GCC of pre-ovulatory follicles (15–20 mm diameter) maintained for 72 h. It was observed that the simultaneous addition of LH and IGF-1 to serum free bovine GCC stimulated a greater expression of VEGF at 72 h than when they were added alone due to the synergistic action of LH and IGF1. We speculate that our cells having grown in serum containing medium would have exploited this synergistic action though the factors were added alone (LH, IGF-1 or EGF) since the serum in their growing medium would have at least minimally/partly supplemented the complementary factor(s). This might have resulted in an enhanced VEGF expression and secretion which in turn seems to be directly dependent on the dose and duration of factors added. This is not so in cells grown in serum deprived medium/medium deprived growth factors, where only the specific factors are supplied, wherein control group failed to show any reasonable angiogenic activity compared to treatments (Schams et al., 2001). Data of mRNA expression for the VEGF in the four different groups over the estrous cycle in buffalo follicles did agree with immunocytochemistry observations and VEGF concentration in spent culture media. However, VEGF mRNA expression profile in cultured GCs does not reflect completely media protein concentration and immunocytochemistry findings. The reason for slight disparity in VEGF assay to the VEGF relative expression can be attributed to the fact that all isoforms of VEGF synthesised within the GC on treatment with above factors are not soluble and cannot be secreted outside the cell into the surrounding media. Of the various isoforms, VEGF120 is a freely soluble protein; VEGF164 is also secreted although a significant fraction remains bound to the cell surface and the extracellular matrix. In contrast, VEGF188 and VEGF205 are almost completely sequestered in the extracellular matrix and hence not available for assay in culture media. These sequestered isoforms in turn require for their extracellular release, plasmin produced by activation of plasminogen of blood vessel endothelium in in vivo situations (Park et al., 1993). Therefore while the GC mRNA expression quantifies the total VEGF isoforms (VEGF T) produced within the cell, VEGF assay portrays only the fraction of total VEGF that is secreted by the cell outside into the medium. In case of immunocytochemistry, we have localized VEGF

V. Babitha et al. / General and Comparative Endocrinology 198 (2014) 1–12

164 isoform, while in case of mRNA expression, total VEGF (VEGF T) was amplified and relative expression detected. Focusing on the cytoprotective effect of same factors in the same dose-time combinations on GCC of Gp IV follicles, we noticed that PCNA – an antiapoptotic factor, showed a dose as well as time dependent rise in expression in the GCC of Gp IV follicles on treatment with LH, IGF-1 and EGF at 3 different dose rates and time durations. However, a significant rise was noted only in the highest dose(s) at 72 h duration in case of LH and IGF-1 and EGF. The control groups also expressed a basal level of PCNA throughout the duration of experiment, probably be due to the use of serum containing medium instead of serum free medium. The essential survival factors (like LH, insulin, IGF etc.) in serum would have imparted minimal cell surviving capability to control wells, and amplified the anti-apoptotic actions of the factors added in treatment wells. The observation of enhanced PCNA expression in GC of pig preantral and antral follicles (Tománek and Chronowska, 2006) compared to smaller follicles and atretic ones qualifies PCNA as cell proliferation marker and its level of expression increases during the gonadotropin-dependent stages of pre-ovulatory follicular development (Salvetti et al., 2010). On the other hand, higher mRNA and protein levels of BAX detected in early atretic follicles than in healthy follicles in pigs (Sai et al., 2011) confirms its apoptotic actions in granulosa cells. Though we have not studied the effect of VEGF treatment on in vitro granulosa cell expression of PCNA and BAX, our results considered together draw the conclusion that LH, IGF-1, and EGF have cytoprotective actions (evident from increased PCNA and reduced BAX expression) either directly or through the enhanced expression of VEGF (evident from mRNA expression, VEGF assay of spent media and immunocytochemistry on cultured granulosa cells). Cytoprotective or antiapoptotic actions of VEGF of granulosa cells have been proved beyond doubt by early research works (Greenaway et al., 2004; Irusta et al., 2010). Irrespective of whether accomplishing angiogenesis or cytoprotective function it was observed that all three factors were effective mostly in Gp IV follicular GCC possibly due to two reasons. Firstly, IGF-1 and EGF had no direct effect but only mediated/enhanced the action of LH (Conti, 2006; Jiang et al., 2001; Miyamoto et al., 1996), in bringing one of them being the angiogenic action of EGF in the ovary bout angiogenesis and/or anti-apoptosis. The IGF system appears to have indirect effects on angiogenesis through mediatory action on gonadotropin for VEGF production in follicular cells, as well as by inducing endothelial cell proliferation and differentiation (Schams et al., 2001). Secondly, LH receptors are present only in the GCs of pre-ovulatory follicles, since the smaller follicles have FSH receptors which get replaced by LHR as follicles increase in size and acquire dominance (Svensson et al., 2000). Therefore both LH and the mediators can succeed in enhancing the transcription, translation of VEGF mRNA and stabilize it only in Gp-IV follicles which have LH receptors (LHR), while the smaller growing follicles are more responsive to FSH (Fortune et al., 2004; Xu et al., 1995). Studies on expression dynamics of IGF-1 and EGF receptors in bovine granulose cells have shown that their expression increases with increase in follicular size (Schams et al., 2002; Wandji et al., 1992). Taken together, these observations justify the lack of response of above treatments on expression of VEGF, PCNA and BAX, in smaller follicular GCC, together with the fact that angiogenesis and apoptosis/cytoprotection of GC gains significance only when the follicle increase in size, vascularity and acquire dominance. In summary, LH (0.1, 1 and 10 ng/ml media), IGF-1 and EGF (5,10 and 50 ng/ml media) mostly at their higher level(s), longest duration(s) combination acted to induce enhanced VEGF and PCNA expression and depressed BAX expressions respectively in bovine granulosa cells from >13 mm Gp IV follicles. The above factors

11

however, failed to show a significant change in the either VEGF mRNA and or protein secretion levels in vitro in lower follicular groups. We speculate that these factors might play a role in augmenting angiogenic and survival capabilities of granulosa cell of large dominant follicles. These conditions are similar to those found in developing dominant follicles approaching or experiencing LH surge, with an exuberant supply of various local growth factors brought in by extensive angiogenesis. Though this study could portray only an overall basic concept regarding the multifaceted roles of gonadotropin and two important local ovarian factors in angiogenesis and cytoprotection in large pre-ovulatory follicles, it could be considered as a foundation over which more similar research works could be planned and carried out especially in the very less explored area of buffalo reproduction.

Acknowledgments Funding support received from Department of Biotechnology, Government of India is gratefully acknowledged.

References Amsterdam, A., Sazón, R., Keren-Tal, I., Aharoni, D., Dantes, A., Rimon, E., Land, A., Cohen, T., Dor, Y., Hirsh, L., 2003. Alternative pathways of ovarian apoptosis: death for life. Biochem. Pharmacol. 66, 1355–1362. Babitha, V., Panda, R.P., Yadav, V.P., Chouhan, V.S., Dangi, S.S., Khan, F.A., Singh, G., Bag, S., Taru Sharma, G., Silvia, W.J., Sarkar, M., 2013. Amount of mRNA and localization of vascular endothelial growth factor and its receptors in the ovarian follicle during estrous cycle of water buffalo (Bubalis bubalis). Anim. Reprod. Sci. 137, 163–176. Barboni, B., Turriani, M., Galeati, G., Spinaci, M., Bacci, M.L., Forni, M., Mattioli, M., 2000. Vascular endothelial growth factor production in growing pig antral follicles. Biol. Reprod. 63, 858–864. Berisha, B., Schams, D., Kosmann, M., Amselgruber, W., Einspanier, R., 2000. Expression and localization of vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (FGF-2) during the final growth of bovine ovarian follicles. J. Endocrinol. 167, 371–382. Christenson, L.K., Stouffer, R.L., 1997. Follicle-stimulating hormone and luteinizing hormone/chorionic gonadotropin stimulation of vascular endothelial growth factor production by macaque granulosa cells from pre- and periovulatory follicles. J. Clin. Endocrinol. Metab. 82, 2135–2142. Chun, S.Y., Eisenhauer, K.M., Minami, S., Billig, H., Perlas, E., Hsueh, A.J., 1996. Hormonal regulation of apoptosis in early antral follicles: follicle-stimulating hormone as a major survival factor. Endocrinology 137, 1447–1456. Conti, M., 2006. Specificity of the cyclic adenosine 30 , 50 -growth factor-like factors in cumulus oocyte complexes and granulosa cells: key roles for prostaglandin synthase 2 and progesterone receptor. Mol. Endocrinol. 20, 1352–1365. Demeestere, I., Gervy, C., Centner, J., Devreker, F., Englert, Y., Delbaere, A., 2004. Effect of insulin-like growth factor-I during preantral follicular culture on steroidogenesis, in vitro oocyte maturation, and embryo development in mice. Biol. Reprod. 70, 1664–1669. Fortune, J.E., Rivera, G.M., Yang, M.Y., 2004. Follicular development: the role of the follicular microenvironment in selection of the dominant follicle. Anim. Reprod. Sci. 82, 109–126. Frank, S., Hubner, G., Breier, G., Longaker, M.T., Greenhalgh, D.G., Werner, S., 1995. Regulation of VEGF expression in cultured keratinocytes. Implications for normal and impaired wound healing. J. Biol. Chem. 270, 12607–12613. Fraser, H.M., Wulff, C., 2001. Angiogenesis in the primate ovary. Reprod. Fertil. Dev. 13, 557–566. Garrido, C., Saule, S., Gospodarowicz, D., 1993. Transcriptional regulation of vascular endothelial growth factor gene expression in ovarian bovine granulosa cells. Growth Factors 8, 109–117. Geva, E., Jaffe, R.B., 2004. Ovarian angiogenesis. In: Leung, P., Adashi, E. (Eds.), The Ovary, second ed. Elsevier Science, San Diego (CA), pp. 105–117. Geva, E., Jaffe, R.B., 2007. Role of vascular endothelial growth factor in ovarian physiology and pathology. Fertil. Steril. 74, 429–438. Ginther, O.J., Beg, M.A., Donadeu, F.X., Bergfelt, D.R., 2003. Mechanism of follicle deviation in monovular farm species. Anim. Reprod. Sci. 78, 239–257. Giudice, L.C., 1992. Insulin like growth factors and ovarian follicular development. Endocr. Rev. 13, 641–669. Goldman, C.K., Kim, J., Wong, W.L., King, V., Brock, T., Gillespie, G.Y., 1993. Epidermal growth factor stimulates vascular endothelial growth factor production by human malignant glioma cells: a model of glioblastoma multiforme pathophysiology. Mol. Biol. Cell 4, 121–133. Greenaway, J., Conner, K., Pedersen, H.G., Coomber, B.L., Lamarre, J., Petrik, J., 2004. Vascular endothelial growth factor and its receptor, Flk-1/KDR, are in the extravascular compartment of the ovarian follicle. Endocrinology 145, 2896– 2905.

12

V. Babitha et al. / General and Comparative Endocrinology 198 (2014) 1–12

Hazzard, T.M., Molskness, T.A., Chaffin, C.L., Stouffer, R.L., 1999. Vascular endothelial growth factor (VEGF) and angiopoietin regulation by gonadotrophin and steroids in macaque granulosa cells during the peri-ovulatory interval. Mol. Hum. Reprod. 5, 1115–1121. Hsu, S.Y., Hsueh, A.J., 2000. Tissue-specific Bcl-2 protein partners in apoptosis: an ovarian paradigm. Physiol. Rev. 80, 593–614. Irusta, G., Abramovich, D., Parborell, F., Tesone, M., 2010. Direct survival role of vascular endothelial growth factor (VEGF) on rat ovarian follicular cells. Mol. Cell. Endocrinol. 325, 93–100. Jainudeen, M.R., Hafez, E.S.E., 1993. Cattle and buffalo. In: Hafez, E.S.E. (Ed.), Reproduction in Farm Animals, sixth ed. Lea and Febiger, Philadelphia, USA, pp. 315–329. Jiang, J.Y., Umezu, M., Macchiarelli, G., Sato, E., 2001. Ovarian microvasculature and angiogenic regulation in follicular development and atresia. In: Miyamoto, H., Manabe, N. (Eds.), Reproductive Biotechnology. Hokuto Shobo (publisher), Kyoto, pp. 73–80. Kamat, B., Brown, L.F., Manseau, E.J., Senger, D.R., Dvorak, H.F., 1995. Expression of vascular permeability factor/vascular endothelial growth factor by human granulosa and theca lutein cells. Role in corpus luteum development. Am. J. Pathol. 146, 157–165. Katabuchi, H., Fukumatsu, Y., Araki, M., Suenaga, Y., Ohtake, H., Okamura, H., 1996. Role of macrophages in ovarian follicular development. Horm. Res. 46, 45–51. Mao, J., Smith, M.F., Rucker, E.B., Wu, G.M., McCauley, T.C., Cantley, T.C., Prather, R.S., Didion, B.A., Day, B.N., 2004. Effect of epidermal growth factor and insulin-like growth factor I on porcine preantral follicular growth, antrum formation, and stimulation of granulosal cell proliferation and suppression of apoptosis in vitro. J. Anim. Sci. 82, 1967–1975. Martinez-Chequer, J.C., Stouffer, R.L., Hazzard, T.M., Patton, P.E., Molskness, T.A., 2003. Insulin-like growth factors-1 and 2, but not hypoxia, synergize with gonadotropin hormone to promote vascular endothelial growth factor-A secretion by monkey granulosa cells from preovulatory follicles. Biol. Reprod. 68, 1112–1118. Miyamoto, Y., Nakayama, T., Haraguchi, S., Miyamoto, H., Sato, E., 1996. Morphological evaluation of microvascular networks and angiogenic factors in the selective growth of oocytes and follicles in the ovaries of mouse fetuses and newborns. Dev. Growth Differ. 38, 291–298. Mondschein, J.S., Schomberg, D.W., 1981. Growth factors modulate gonadotropin receptor induction in granulosa cell cultures. Science 211, 1179–1180. Park, J.E., Keller, G.-A., Ferrara, N., 1993. The vascular endothelial growth factor (VEGF) isoforms: differential deposition into the subepithelial extracellular matrix and bioactivity of ECM-bound VEGF. Mol. Biol. Cell 4, 1317–1326. Pfaffl, M., 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, 2002–2007. Sai, T., Goto, Y., Yoshioka, R., Maeda, A., Matsuda, F., Sugimoto, M., Wongpanit, K., Jin, H.-Z., Li, J.-U., Manabe, N., 2011. Bid and Bax are involved in granulosa cell apoptosis during follicular atresia in porcine ovaries. J. Reprod. Dev. 57, 421–427.

Salvetti, N.R., Stangaferro, M.L., Palomar, M.M., Alfaro, N.A., Rey, F., Gimeno, E.J., Ortega, H.H., 2010. Cell proliferation and survival mechanisms underlying the abnormal persistence of follicular cysts in bovines with cystic ovarian disease induced by ACTH. Anim. Reprod. Sci. 122, 98–110. Schams, D., Berisha, B., Kosmann, M., Amselgruber, W.M., 2002. Expression and localization of IGF family members in bovine antral follicles during final growth and in luteal tissue during different stages of estrous cycle and pregnancy. Domest. Anim. Endocrinol. 22, 51–72. Schams, D., Kosmann, M., Berisha, B., Amselgruber, W.M., Miyamoto, A., 2001. Stimulatory and synergistic effects of luteinizing hormone and insulin like growth factor-1 on the secretion of vascular endothelial growth factor and progesterone of cultured bovine granulosa cells. Exp. Clin. Endocrinol. Diabetes 109, 155–162. Schreiber, A.B., Winkler, M.E., Derynck, R., 1986. Transforming growth factor-a is a more potent angiogenic mediator than epidermal growth factor. Science 232, 1250–1253. Shimizu, T., Jiang, J.Y., Sasada, H., Sato, E., 2002. Changes of messenger RNA expression of angiogenic factors and related receptors during follicular development in gilts. Biol. Reprod. 67, 1846–1852. Svensson, E., 2000. Regulation of apoptosis and steroidogenesis in ovarian preovulatory granulosa cells. Thesis submitted to Department of Physiology and Pharmacology, Göteborg University. Taylor, P.D., Hillier, S.G., Fraser, H.M., 2004. Effects of GnRH antagonist treatment on follicular development and angiogenesis in the primate ovary. J. Endocrinol. 183, 1–17. Tilly, J.L., Billig, H., Kowalski, K.I., Hseuh, A.J., 1992. Epidermal growth factor and basic fibroblast growth factor suppresses the spontaneous onset of Apoptosis in cultured rat ovarian granulose cells and follicles by a tyrosine-kinase dependent mechanism. Mol. Endocrinol. 6, 1942–1950. Tománek, M., Chronowska, E., 2006. Immunohistochemical localization of proliferating cell nuclear antigen (PCNA) in the pig ovary. Folia Histochem. Cytobiol. 44, 269–274. Wandji, S.-A., Pelletier, G., Sirard, M.-A., 1992. Ontogeny and cellular localization of 51I-labeled basic fibroblast growth factor and 120 I-labeled epidermal growth factor binding sites in ovaries from bovine fetuses and neonatal calves. Biol. Reprod. 47, 807–813. Warren, R.S., Yuan, H., Matli, M.R., Ferrara, N., Donner, D.B., 1996. Induction of vascular endothelial growth factor by insulin-like growth factor 1 in colorectal carcinoma. J. Biol. Chem. 271, 29483–29488. Xu, Z., Garverick, H.A., Smith, G.W., Smith, M.F., Hamilton, S.A., Youngquist, R.S., 1995. Expression of follicle- stimulating hormone and luteinizing hormone receptor messenger ribonucleic acids in bovine follicles during the first follicular wave. Biol. Reprod. 53, 951–957. Yarden, Y., Sliwkowski, M.X., 2001. Untangling the ErbB signalling network. Nat. Rev. Mol. Cell Biol. 2, 127–137.