Fungal Genetics and Biology 80 (2015) 31–42

Contents lists available at ScienceDirect

Fungal Genetics and Biology journal homepage: www.elsevier.com/locate/yfgbi

Regular Articles

Loss of RPS41 but not its paralog RPS42 results in altered growth, filamentation and transcriptome changes in Candida albicans Hui Lu a,b,1, Xiang-Wen Yao a,d,1, Malcolm Whiteway c, Juan Xiong a,b, Ze-bin Liao a, Yuan-Ying Jiang a,⇑, Ying-Ying Cao a,⇑ a

Center for New Drug Research, Department of Pharmacology, School of Pharmacy, Second Military Medical University, No. 325 Guohe Road, Shanghai 200433, China Key Laboratory of the Plateau of the Environmental Damage Control, Lanzhou General Hospital of Lanzhou Military Command, No. 333 Binhe South Road, Lanzhou 730050, China Biology Department, Concordia University, No. 7141 Sherbrooke Street West, Montreal, Quebec H4B 1R6, Canada d Pharmacy Department, General Hospital of Jiangsu Armed Police, No. 8 Jiangdu South Road, Yangzhou 225000, China b c

a r t i c l e

i n f o

Article history: Received 7 November 2014 Revised 23 March 2015 Accepted 31 March 2015 Available online 29 April 2015 Keywords: Ribosomal protein S4 Growth rate Morphological transition cDNA microarrays Candida albicans

a b s t r a c t Although ribosomal proteins (RPs) are components of the ribosome, and function centrally in protein synthesis, several lines of evidence suggest that S4 ribosomal proteins (Rps4ps) can function in other cellular roles. In Candida albicans, ribosomal protein S4 (Rps4p) is encoded by two distinct but highly similar genes, RPS41 (C2_10620W_A) and RPS42 (C1_01640W_A). Previous studies indicated that in Saccharomyces cerevisiae loss of one isoform generated distinct phenotypes. To probe this relationship in C. albicans, rps41D and rps42D homozygous null mutants were generated. The transcript levels of the RPS41 and RPS42 genes are asymmetric in C. albicans, RPS41 mRNA levels were similar in wild-type strains and rps42D null mutants, while RPS42 gene transcript levels were induced 20 fold relative to wild type in rps41D null mutants. We found that the rps41D homozygous null mutant showed a reduced growth rate, and had defects in filament formation in liquid media and on solid media, while these phenotypes were not observed in the rps42D mutant strain. Neither the rps41D nor rps42D mutant strains displayed differential sensitivity to azoles, although intriguingly ectopic expression of either RPS41 or RPS42 in a wild-type strain leads to decreased sensitivity to fluconazole (FLC). C. albicans cDNA microarray analysis experiments found that carbohydrate and nitrogen metabolic processes were repressed but transport-process-related genes were up-regulated in the rps41D mutant. Overall, our present study suggests that loss of the RPS41 gene but not its paralog the RPS42 gene can generate distinct phenotypes including effects on growth rate, morphological transitions, and susceptibility to osmotic stress due to the fact that mRNA levels of RPS41 is much higher than RPS42 in C. albicans. Ó 2015 Elsevier Inc. All rights reserved.

1. Introduction The ribosome, which is the site of mRNA translation and protein synthesis, is a complex molecular machine (Sonenberg and Hinnebusch, 2009). For example, in Saccharomyces cerevisiae, the active 80S ribosome consists of a small 40S subunit made up of an 18S rRNA and 32 proteins and a large 60S subunit including 25S, 5.8S, and 5S rRNAs and 46 proteins (Green and Noller, 1997; Spahn et al., 2001). The eukaryotic ribosome is responsible for translating mRNA into protein, and it is generally perceived as a key component of the cell, with a non-selective role in polypeptide ⇑ Corresponding authors. Tel.: +86 021 8187 1357; fax: +86 021 6549 0641. E-mail addresses: [email protected] (Y.-Y. Jiang), caoyingying608@163. com (Y.-Y. Cao). 1 The authors contributed equally to this work. http://dx.doi.org/10.1016/j.fgb.2015.03.012 1087-1845/Ó 2015 Elsevier Inc. All rights reserved.

synthesis (Byrne, 2009). However, in fungi, plants and animals, mutations in genes encoding ribosomal proteins (RPs) and ribosome assembly factors can lead to specific physiological defects (Dignard et al., 2008; Strittmatter et al., 2006; Szakonyi and Byrne, 2011). Although some of the consequences of reduced ribosomal protein (RP) function probably result from a global reduction in protein synthesis, the existence of specific physiological defects suggests that the ribosome may have a regulatory role in physiological functions. The eukaryotic ribosomal protein S4 (Rps4p), which has no homolog in bacteria, is one of the proteins of the small ribosomal subunit. In S. cerevisiae, Rps4p is encoded by the duplicated genes RPS4A and RPS4B. Mutations in these two paralogous ribosomal protein genes generate completely distinct phenotypes. Loss of RPS4A gives phenotypes showing differences in cell size (Jorgensen et al., 2002) and CG4-theopalaumide sensitivity

32

H. Lu et al. / Fungal Genetics and Biology 80 (2015) 31–42

(Parsons et al., 2006), while deletion of RPS4B can lead to abnormal telomere length (Askree et al., 2004), modified neomycin sulfate sensitivity and hydrogen peroxide sensitivity (Parsons et al., 2006). The Rps4p of wheat has been suggested to act as a general cysteine protease, and can hydrolyze a variety of cysteine protease substrates (Sudhamalla et al., 2012). In mammals, Rps4p is encoded by three genes, RPS4X, RPS4Y1 and RPSY2, which are located on the X and the Y chromosomes (Lopes et al., 2010), and might be involved in Turner syndrome (Fisher et al., 1990; Zinn et al., 1994). In human males, RPS4X and RPS4Y1 are expressed ubiquitously, but RPSY2 expression is restricted to the testis and prostate, suggesting a male-specific role for this RP and the possibility of testis-specific ribosomes (Lopes et al., 2010). Although the sequences of the three Rps4ps are very similar, distinct amino acids in the carboxyl terminus of RPS4Y2 possibly facilitate unique interactions with distinct, potentially testis-specific, RPs or extra-ribosomal factors (Lopes et al., 2010). In Candida albicans, Rps4p is encoded by two isogenes, RPS41 (C2_10620W_A) and RPS42 (C1_01640W_A). Recent studies showed that the mRNA level of Rps4p is repressed in Spider-medium-induced biofilms (Nobile et al., 2012). A rps41::Tn5/RPS41 mutant strain, with one copy of RPS41 disrupted by Tn5, showed defects in invasion (Oh et al., 2010). However, are the duplicated genes RPS41 and RPS42 coding Rps4p equally important to C. albicans? Currently, these questions remain to be answered. Meanwhile, the possible complexity of function of Rps4ps in S. cerevisiae, wheat and mammals provided an interesting direction to answer the above questions in C. albicans, and in the present study we have focused on the phenotypes of rps4 mutants. We constructed rps41D and rps42D null mutant strains in C. albicans, and showed that expression of either RPS41 or RPS42 is sufficient for growth of yeast form cells, but expression of RPS42 alone does not support filamentous growth and reduces overall growth rate. Although loss of RPS41 and RPS42 does not affect the sensitivity to azoles of C. albicans, ectopic expression of RPS41 or RPS42 in a wild-type strain increased tolerance to fluconazole (FLC). The RPS41 isogene produces more transcript than RPS42. To investigate the mechanisms of the phenotypic changes in the rps41D mutant at the molecular level, C. albicans cDNA microarray analysis experiments were used to identify gene expression profiles of the wild-type strain and the rps41D mutant. Overall, our observations suggested that loss of the RPS41 gene but not the RPS42 gene can generate distinct phenotypes including changes in growth rate, and morphological transitions, and susceptibility to osmotic stress.

2. Materials and methods 2.1. Strains, media and growth conditions The strains of C. albicans used in this study are listed in Table 1. For C. albicans, cells were routinely grown in either YPD medium (1% yeast extract, 2% bacto peptone, 2% glucose, and 2% agar for solid medium) (Guthrie and Fink, 1991) or synthetic complete (SC) medium (0.67% yeast nitrogen base without amino acids, 2% glucose, 0.15% amino acid mix with uridine at 50 lg/ml, and 2% agar for solid medium) at 30 °C at 200 rpm in an orbital shaker overnight, diluted to an OD600 of 0.1–0.2, grown to logarithmic phase (6–8 h) and used for subsequent experiments. For morphogenesis analysis, mid-log phase C. albicans cells were adjusted to 1  103 cells/ml. Cellular filamentation was induced in either liquid and solid Spider medium (1% nutrient broth, 1% mannitol, 0.2% K2HPO4, and 2% agar for solid medium, PH 7.2) or in YPD + 10%FBS (with fetal bovine serum at 10% concentrations) at 37 °C. These filament-inducing media were pre-warmed to 37 °C. YPD medium was supplemented with 50 lg ml1 uridine for

Table 1 Strains used in this study. Strain

Parent

Description

Source or reference

CAI4

CAF2-1

ura3D::immm434/ura3D::immm434

CaLH031

CAI4

CaLH033 CaLH035

CaLH031 CaLH033

CaLH037 CaLH039

CaLH035 CaLH037

CaLH041

CaLH039

CaLH032

CAI4

CaLH034 CaLH036

CaLH032 CaLH034

CaLH038 CaLH040

CaLH036 CaLH038

CaLH042

CaLH040

CaLH051

CAI4

CaLH052

CaLH041

CaLH053

CaLH042

CaLH054

CAI4

CaLH055

CAI4

CaLH056

CaLH041

CaLH057

CaLH042

RPS41/RPS41/rps41D::hisG-URA3hisG RPS41/RPS41/rps41D::hisG RPS41/rps41D::hisG/rps41D::hisGURA3-hisG RPS41/rps41D::hisG/rps41D::hisG rps41D::hisG/rps41D::hisG/ rps41D::hisG-URA3-hisG rps41D::hisG/rps41D::hisG/ rps41D::hisG RPS42/RPS42/rps42D::hisG-URA3hisG RPS42/RPS42/rps42D::hisG RPS42/rps42D::hisG/rps42D::hisGURA3-hisG RPS42/rps42D::hisG/rps42D::hisG rps42D::hisG/rps42D::hisG/ rps42D::hisG-URA3-hisG rps42D::hisG/rps42D::hisG/ rps42D::hisG ura3D::immm434/ura3D::immm434/ RPS1::URA3 rps41D::hisG/rps41D::hisG/ rps41D::hisG/RPS1::URA3 rps42D::hisG/rps42D::hisG/ rps42D::hisG/RPS1::URA3 ura3D::immm434/ura3D::immm434/ RPS1:: RPS41-URA3 ura3D::immm434/ura3D::immm434/ RPS1:: RPS42-URA rps41D::hisG/rps41D::hisG/ rps41D::hisG/RPS1::RPS41-URA3 rps42D::hisG/rps42D::hisG/ rps42D::hisG/RPS1::RPS42-URA3

Fonzi and Irwin (1993) This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study

growth of URA3 strains. YPD/-Uri medium (YPD medium lacking uridine) and SC/-Uri medium (SC medium lacking uridine) were used for growth of URA3+ strains. For selection of Ura clones, SC/-Uri medium was supplemented with 50 lg ml1 uridine and 1 mg ml1 5-fluoroorotic acid (5-FOA) (Staab and Sundstrom, 2003). 2.2. Disruption of the RPS41 gene and RPS42 gene To investigate the function of Rps4ps in C. albicans, we constructed C. albicans rps41D and rps42D null mutants in wild-type strain CAI4 by the ura-blaster method as described previously (Fonzi and Irwin, 1993). The RPS41 gene is on chromosome II, while the RPS42 gene is on the chromosome I of C. albicans (http:// www.candidagenome.org/). Both the chromosome I and II of C. albicans in the CAI4 background are trisomic(Selmecki et al., 2005, 2010); there are three copies of the RPS41 gene and three copies of the RPS42 gene in the CAI4 strain. For the disruption of the RPS41 gene, a 300 bp 30 flanking region of the RPS41 gene was amplified by PCR with oligonucleotides RPS41dn-F plus RPS41dn-R and cloned into the BamHI and HindIII sites at one side of the hisG–URA3–hisG cassette in p5921, yielding new plasmid pLH001. Similarly, a 400 bp DNA fragment which is promoter region of RPS41 was amplified by PCR with oligonucleotides RPS41up-F plus RPS41up-R and cloned into the KpnI and BglII sites at another side of the hisG–URA3–hisG cassette in pLH001, yielding new plasmid pLH003, which was used to disrupt the three alleles of RPS41 (see Table 3). The pLH003 was linearized with KpnI for transformation C. albicans strain CAI4 by the lithium acetate– polyethylene glycol (LiAc–PEG) method as described previously

H. Lu et al. / Fungal Genetics and Biology 80 (2015) 31–42

(Schiestl and Gietz, 1989). Three RPS41 gene alleles in the strain CAI4 were disrupted using three rounds of ura-blasting (Fonzi and Irwin, 1993). A similar strategy and protocol was used for disruption RPS42 gene. A 400 bp 30 flanking region of ORF of RPS42 gene was amplified by PCR with oligonucleotides RPS42dn-F plus RPS42dn-R and cloned into the BamHI and HindIII sites at one side of the hisG– URA3–hisG cassette in p5921, yielding new plasmid pLH002. Similarly, a 400 bp DNA fragment which is promoter region of RPS42 was amplified by PCR with oligonucleotides RPS42up-F plus RPS42up-R and cloned into the KpnI and BglII sites at another side of the hisG–URA3–hisG cassette in pLH002, yielding new plasmid pLH004, which was used to disrupt the three alleles of RPS42 (see Table 3). The pLH004 was linearized with KpnI for transformation C. albicans strain CAI4. Three RPS42 gene alleles in the strain CAI4 were disrupted using three rounds of ura-blasting (Fonzi and Irwin, 1993). All disruptions were confirmed by PCR (see Table 2). 2.3. Reintegration A copy of the wild-type gene for complementation experiments was reintegrated at the RPS1 locus in the rps41D and rps42D strains as described previously (Dignard et al., 2008). To reintroduce RPS41 into the rps41D mutants, a 1789 bp DNA fragment amplified by PCR using oligonucleotides RPS41-SalI and RPS41-HindIII was cloned into the CIp10 vector (Murad et al., 2000) to generate pLH005 (see Table 3). This plasmid was linearized with StuI, transformed into the rps41D mutant strain, and single copy integration at the RPS1 locus was confirmed by PCR. A similar strategy and protocol was used for the reintegration of the RPS42 gene. A 2358 bp DNA fragment amplified by PCR using oligonucleotides RPS42-SalI and RPS42-HindIII, was cloned into CIp10 to generate pLH006 (see Table 3). This plasmid was linearized with StuI, transformed into the rps42Dmutant strain, and single copy integration at the RPS1 locus confirmed by PCR. 2.4. Ectopic expression of either the RPS41 gene or the RPS42 gene in wild-type strains To introduced an extra copy of the RPS41 gene or the RPS42 gene in CAI4 strains, we used plasmids pLH005 (Promoter and ORF of RPS41 gene in CIp10) or pLH006 (Promoter and ORF of RPS42 gene in CIp10) for transformation. Plasmids pLH005 and pLH006 were digested with StuI and then transformed into CAI4 strains. The CAI4 strain transformed with plasmid pLH005 was named CaLH0054, while that with plasmid pLH006 was named CaLH055. The correct integration of the plasmids was confirmed by PCR. 2.5. Growth rate determination Growth rate determination was performed as described previously (Rieg et al., 1999). C. albicans strains CAI4 + CIp10 (CaLH051), rps41D + CIp10 (CaLH052), rps41D + RPS41 (CaLH054), rps42D + CIp10 (CaLH053) and rps42D + RPS42 (CaLH055) were grown in YPD/-Uri medium overnight on a rotary shaker (200 rpm) at 30 °C. The cells were then washed with PBS and counted with a hemacytometer. They were adjusted to a cell count of 104 cells/ml and used to inoculate 100 ml of fresh YPD/-Uri medium to a final optical density of 0.015–0.020 at 600 nm. The optical density was measured every hour until the stationary phase of the growth curve was reached. The doubling time during the log phase was determined by the following formula: T = ln2  t/(ln b–ln a) (T is the doubling time during the log phase; t is the time period in hours; a is the optical density at the beginning of time period; b is the optical density at the end of time period). The growth rate during the log was determined by the following formula: l = T1

33

(l is the growth rate during the log phase; T is the doubling time during the log phase). 2.6. Drug susceptibility assays Drop tests were performed, as described previously (Alonso-Monge et al., 2010), by spotting serial dilutions of cells onto YPD/-Uri plates supplemented with sodium chloride, sorbitol, fluconazole, miconazole, or ketoconazole at the indicated concentrations. Plates were incubated 24 h at 30 °C and scanned. 2.7. Real-time quantitative PCR (RT-PCR) RNA isolation and RT-PCR were performed as described previously (Lu et al., 2011). Briefly, the isolated RNA was treated with DNase I (TaKaRa, Biotechnology, China) to remove genomic DNA contamination. First-strand cDNAs were obtained through 500 ng of total RNA in a 10 ll reverse transcription reaction volume containing random hexamers plus oligo dT primer using the cDNA synthesis kit for RT-PCR (TaKaRa). Triplicate independent quantitative real-time PCR was performed with SYBR Green I (TaKaRa), using ABI PRISM 7500 real-time PCR system (Applied Biosystems). Gene-specific primers are shown in Table 2. The PCR protocol consisted of an initial step at 95 °C for 1 min, followed by 40 cycles at 95 °C for 10 s, 60 °C for 20 s, and 72 °C for 30 s, then melting curve program at 60–95 °C with a heating rate of 0.1 °C per second and continuous fluorescence measurement and finally a cooling step to 40 °C. Change in fluorescence of SYBR Green I in every cycle was monitored by the ABI PRISM 7500 system software, and the threshold cycle (CT) above background for each reaction was measured. ACT1 was used as an internal control. The CT value of ACT1 was subtracted from that of the tested genes to obtain a DCT value. The DCT value of an arbitrary calibrator was subtracted from the DCT value of each sample to obtain a DDCT value. The gene expression level relative to the calibrator was expressed as 2DDCT. 2.8. Microarray analysis Transcription profiling was carried out with cDNA microarrays that were obtained from the CapitalBio Corporation. (http:// www.capitalbio.com). Indicated cells cultured to their log phase were pelleted by centrifugation, and immediately frozen in liquid nitrogen. Total RNA isolation, reverse-transcription and synthesis of cDNA, and microarray analysis were carried out by CapitalBio Corporation (Beijing, China) as a feebased service. The 8 K C. albicans Genome Array (CapitalBio Corp., Beijing, China) was used. Fluorescent-dye-labled amplified cDNA was stained with Cy5 and Cy3 (GE Healthcare Cat. No. PA 55021/PA53021). Microarray chips were scanned with a LuxScan™ 10KAscanner (CapitalBio Corp, China) at two wavelengths to detect emissions from both Cy3 and Cy5 and analyzed with LuxScan™ 3.0 software (CapitalBio Corp, China). Microarray analysis was performed on three independent biological replicates. A t-test was applied to detect differences in gene expression between each experimental group and control group. Two criteria were used to determine whether a gene was differentially expressed: fold change of 2.0 and P value < 0.05 using a two-tailed distribution, according to current reports. The value of 2.0 is an accepted cut-off with statistical significance (Maegawa et al., 2010). 2.9. Alignment of Rps4p sequences in ascomycete yeasts Multiple protein sequence alignments were performed with the MAFFT web application (http://mafft.cbrc.jp/alignment) and visualized with Jalviewer (Version 2.8). The protein sequences of the

34

H. Lu et al. / Fungal Genetics and Biology 80 (2015) 31–42

Table 2 Oligonucleotides used in this study. Name

Sequence (50 to 30 )

Description

RPS41up-F

RPS41 upstream forward primer

CGGGGTACCCCGCTAGAAAAAGATGTCGAAGAATTG (Containing KpnI restriction site)

RPS41up-R

RPS41 upstream reverse primer

GAAGATCTTCTGTGGTTTATTGTTGATGATGATG (Containing Bgl II restriction site)

RPS41dn-F

RPS41 downstream forward primer

CGCGGATCCGCGGTTTTATTCGCACTAC (Containing BamHI restriction site)

RPS41dn-R

RPS41 downstream reverse primer

CCCAAGCTTGGGTCCGGCTATGGGCAATTCTGG (Containing HindIII restriction site)

RPS42up-F

RPS42 upstream forward primer

CGGGGTACCCCGGGTATTCGGAGTTTTTTGTTGG (Containing KpnI restriction site)

RPS42up-R

RPS42 upstream reverse primer

GAAGATCTTCTTTTTGTGATTTATAATTCATG (Containing Bgl II restriction site)

RPS42dn-F

RPS42 downstream forward primer

CGCGGATCCGCGGTTTAATTCGATTTATATGTTTG (Containing BamHI restriction site)

RPS42dn-R

RPS42 downstream reverse primer

HISG-R URA3-R RPS41CIP-F

HISG reverse primer URA3 reverse primer RPS41 promoter forward primer

CCCAAGCTTGGGTCTATTGCTTCAGTTTATTCG (Containing HindIII restriction site) GGTTGAGTAGCTCTTCTTCCAG GCATGAGTTTCTGCTCTCTCAC

RPS41CIP-R RPS42CIP-F

RPS41 downstream reverse primer RPS42 promoter forward primer

RPS42CIP-R

RPS42 downstream reverse primer

RPS41in-F RPS41in-R RPS42in-F RPS42in-R RPS1-R-in RPS41rt-F RPS42rt-F RPS41/42rt-R RPS4rt-F RPS4rt-R ACT1rt-F ACT1rt-R

RPS41 forward internal primer RPS41 reverse internal primer RPS42 forward internal primer RPS42 reverse internal primer RPS1 reverse internal primer RPS41 forward primer for RT-PCR RPS42 forward primer for RT-PCR RPS41 and RPS42 shared the reverse primer for RT-PCR The general forward primer of RPS41 and RPS42 for RT-PCR The general reverse primer of RPS41 and RPS42 for RT-PCR The forward primer of ACT1 for RT-PCR The reverse primer of ACT1 for RT-PCR

ACGCGTCGACGTCCAGAGACCATGTTGATATTGTTC (Containing SalI restriction site) ATGAAAATAGGGGTTGATTTTAGG (PCR products containing BglII restriction site) ACGCGTCGACGTCAACATTGATTTAGATATGAAAATAACTG (Containing SalI restriction site)

Table 3 Plasmids used in this study. Plasmid

Parent

Description

Source or reference

p5921

pUC18

HisG-URA3-HisG cassette for gene disruption of C. albicans in pUC18

CIp10

Plasmid for gene reintegration

pLH001 pLH003 pLH002 pLH004 pLH005

pBluescript KS+ P5921 pLH001 P5921 pLH002 CIp10

Fonzi and Irwin (1993) Murad et al. (2000) This study This study This study This study This study

pLH006

CIp10

Downstream of RPS41 gene in p5921 Upstream of RPS41 gene in pLH001 Downstream of RPS42 gene in p5921 Upstream of RPS42 gene in pLH002 Promoter and ORF of RPS41 gene in CIp10 Promoter and ORF of RPS42 gene in CIp10

This study

CCCAAGCTTGGGTCTATTGCTTCAGTTTATTCG (Containing HindIII restriction site) CCAAGACCATCTGCTGGTCCACAC CGGTAGCCAAATCGATCTTAACGG GTTTTAACTTGGATGGGAGCC GACCAACATCCAATGAGATGGAGC TTTCTGGTGAATGGGTCAACGAC ATTGTCCGGTACTTATGC ATTGTCCGGTACCTATGC TGATGGCTTTGACTTCTC AAGAAGCTGCCTACAAAT ACACCAACTCTACCCAAA ACGGTGAAGTTGCTGCTTTAGTT CGTCGTCACCGGCAAAA

The CaRPS41 gene locus is on chromosome II, while CaRPS42 is on chromosome I in C. albicans (Fig. 1a). Sequence analysis of the CaRPS41 shows that its ORF only contains an exon, while the CaRPS42 ORF is interrupted by an intron of 569 bp, at position 15 after the ATG (Fig. 1a). Sequence analysis of the coding sequences of CaRPS41 and CaRPS42 shows a high degree of identity (97% identity). Analysis of the deduced primary structure of the proteins showed 99.6% sequence identity and thus the genes code for two almost identical proteins of 262 amino acids. The predicted Gly2 residue of Rps41p is substituted for Ala2 in Rps42p (Fig. 1b). The amino acid sequence of C. albicans Rps41p and Rps42p were also compared to S. cerevisiae Rps4ap and Rps4bp; the sequences of the four proteins were 86.6% similar (Fig. 1c). 3.2. Generation of rps41D and rps42D null mutant strains in C. albicans

3. Results

In S. cerevisiae, the ScRps4ap is required for normal cell size (Jorgensen et al., 2002) and resisting CG4-theopalaumide, while the ScRps4bp is required for normal telomere length, resisting neomycin sulfate, and resisting hydrogen peroxide (Parsons et al., 2006). The function of CaRps4p in C. albicans has not been investigated deeply. In order to ascertain the effects of CaRps4p in C. albicans, rps41D and rps42D null mutations were created in wild-type strain CAI4. The rps41D and rps42D null mutants were generated by a complete deletion of the whole ORFs with hisG–URA3–hisG cassettes by homologous recombination according to the strategy described in Section 2. The correct insertions of the hisG–URA3– hisG cassettes at the RPS41 and RPS42 locus were confirmed by PCR analysis of genomic DNA (Supplementary data 1).

3.1. C2_10620W_A (CaRPS41) and C1_01640W_A (CaRPS42) encode a Rps4p in C. albicans

3.3. In C. albicans the RPS41 gene generates significantly more RPS4 transcripts than does the RPS42 gene

The C. albicans genome contains two copies of the gene encoding Rps4p (C2_10620W_A/CaRPS41 and C1_01640W_A/CaRPS42).

RPS4 mRNAs of the wild type and rps41D or rps42D mutant strains were compared to test whether the RPS41 and RPS42 genes

different ascomycete yeast species were downloaded from the Fungal Orthogroups Repository (http://www.broadinstitute.org/ cgi-bin/regev/orthogroups) hosted by the Broad Institute, MIT. 2.10. Statistics Experiments were performed at least three times. Data are presented as ‘mean ± standard deviations’ and analyzed using the ‘Student’s t test’ where indicated.

H. Lu et al. / Fungal Genetics and Biology 80 (2015) 31–42

35

Fig. 1. Sequence analysis of the RPS41 and RPS42 genes in C. albicans. (A) RPS41 and RPS42 gene loci in C. albicans. The RPS41 gene with only one exon locus is on chromosome II of C. albicans. The RPS42 gene locus is on chromosome I of C. albicans, with two exons and one intron. The white boxes represent the exons. The black box represents the intron. The black lines represent genomic DNA at theRPS41 and RPS42 loci. The positions of the ATG and of the beginning and end of the intron are indicated as shown. (B) Sequence comparisons of CaRps41p and CaRps42p. The CaRps41p and CaRps42p show 99.6% sequence identity and code for two almost identical proteins of 262 amino acids. The deduced Gly2 residue of Rps41p is substituted for Ala2 in Rps42p. (C) Alignment of proteins sequences of ScRps4ap, ScRps4bp, CaRps41p, and CaRps42p. The sequences of two Rps4ps in S. cerevisiae genes are the same.

are differently transcribed. To avoid cross hybridization in the wild type as a result of almost identical ORFs, we used specific oligonucleotides for RPS41 and RPS42 (the specific oligonucleotides for RPS41 were RPS41rt-F and RPS41/42rt-R; the specific oligonucleotides for RPS42 were RPS42rt-F and RPS41/42rt-R; the common oligonucleotides for RPS41 and RPS42 were RPS4rt-F and RPS4-R) (Fig. 2a). These quantitative real time PCR results demonstrated nearly similar amounts of RPS41 mRNA in the wild type and the rps42D mutants. A dramatic induction of the RPS42 gene was seen in the rps41D mutant; 20 fold more expression was observed than in the wild-type strain (Fig. 2b). To quantify the ratio of the two RPS4 transcript species, we tested total mRNAs isolated from the same set of C. albicans strains by quantitative real time PCR, using the non-specific oligonucleotides for the RPS41 gene or the RPS42 gene exons that cannot discriminate between the two mRNA targets (Fig. 2a). We found that the rps41D null mutant strains exhibit 15%–20% of the total RPS4 mRNA when compared to wild-type controls, and that the rps42D mutant C. albicans strains exhibit 85%–80% of the complete RPS4 mRNA level when compared to wild-type controls (Fig. 2c). These transcript analyses suggest that expression of the RPS41 and RPS42 genes is asymmetric and the RPS41 gene transcript level is 27.91 (±3.01) times of the RPS42 gene in wild-type strains relative to ACT1 gene.

3.4. RPS41 is required for normal growth of the yeast form of C. albicans To assess whether there are differences between the two RPS4 isogenes, the rps41D and rps42Dmutant strains of C. albicans were studied using growth rate determination according to the method described in Section 2. A significant difference in the growth rate of wild-type strain and the rps41D null mutant strain, but not the rps42Dnull mutant strain was observed. To quantify more precisely the growth rate of the rps41Dand rps42Dstrains, the null mutant strains were compared in YPD/-Uri liquid medium. The average of the growth rates of rps41D strain tested was l = 0.48 h1 corresponding to a 28% reduction in growth in comparison to l = 0.68 h1 for the rps42D, and l = 0.66 h1 for the wild-type strain CAI4 (Fig. 3). Complementation of the rps41D null mutant strain by a plasmid-borne RPS41 gene restored growth to wild-type levels (Fig. 3). 3.5. RPS41 is required for filamentous growth in C. albicans In order to further characterize the phenotype of the rps41D and rps42D null mutants, we examined their ability to undergo the dimorphic transition. Dimorphism, which has been shown to play a relevant role in the virulence of this fungus (Baillie and Douglas,

36

H. Lu et al. / Fungal Genetics and Biology 80 (2015) 31–42

Fig. 2. (A) Alignment of DNA sequences of RPS41 gene and RPS42 gene with only exons shown. The arrows represent orientation and position of oligonucleotides (Table 2) used for RT-PCR analysis expressions of RPS41 and RPS42 genes. (B) Transcriptional analysis of the RPS41 and RPS42 gene within two sets of rps41D, and rps42D null mutant strains. Strains used for real-time PCR experiments were grown for 6–8 h in liquid YPD/Uri medium. Strains tested were wild-type controls, rps41D mutant strains, and rps42D mutant strains, respectively. The values depicted are average values of at least three independent measurements. (C) Total Rps4p mRNAs were tested by real-time PCR with nonspecific oligos to RPS41 and RPS42. The values depicted are average values of at least three independent measurements. The ACT1 transcript levels were controls for all the measurements.

Fig. 3. Growth rates test of rps41D and rps42D C. albicans mutant strains. The growth rates depicted were determined in liquid YPD medium lacking uridine (YPD/Uri). Those strains were adjusted to a cell count of 104 cells/ml and used to inoculate 100 ml of fresh YPD/-Uri medium to a final optical density of 0.015–0.020 at 600 nm. The optical density was measured every hour until the stationary phase of the growth curve was reached. Tested strains were CAI4 + CIp10 (CaLH051) as wildtype control, rps41D + CIp10 (CaLH052), rps41D + RPS41 (CaLH056), rps42D + CIp10 (CaLH053), and rps42D + RPS42 (CaLH057). Mutant strains were transformed with plasmids CIp10 as control, pLH005 (+RPS41) or pLH006 (+RPS42).

1999), can be induced by various environmental stimuli, such as serum, N-acetylglucosamine (GlcNAc), high temperature, neutral pH, and starvation (Biswas et al., 2007). For this purpose, cells were grown in liquid YPD medium supplemented with 10% fetal bovine serum, and Spider medium and incubated at 37 °C. In liquid YPD plus 10% serum medium, which is one of the most effective hypha-inducing conditions, wild type and rps42D cells developed long hyphae after 1 h incubation at 37 °C, whereas rps41D mutant cells were unable to form filaments (Fig. 4a). Although the rps41D mutant cells begin to form hyphae after 2 h incubation, the ratio of hyphae of rps41D mutant (32.78% ± 6.00%) is still far less than wild-type strain (80.67% ± 0.88%). On solid serum-containing YPD medium, the rps41D mutant strain displayed a more severe defective phenotype in filamentous growth and formed small downy colonies without long filaments, although the wild-type strain produced florid filamentous colonies (Fig. 4c). On solid Spider medium, the rps41D mutant strain also showed impaired hyphal development, and formed smooth colonies without filaments (Fig. 4c) although the rps41D mutant strain showed a similar phenotype to the wild-type strain and the rps42D mutant strain in liquid Spider medium (Fig. 4b). The defects in filamentous growth observed in the rps41D mutants were caused by the RPS41 deletion, as the phenotype was reversed by re-introducing RPS41.

H. Lu et al. / Fungal Genetics and Biology 80 (2015) 31–42

37

Fig. 4. (A) YPD + 10%FBS induces filamentous growth in C. albicans following 1 h growth at 37 °C. (B) Spider medium induces filamentous growth in C. albicans following 1 h growth at 37 °C. (C) The morphology of strains was tested under different solid filamentous induced medium. Colonies were photographed at the same magnification.

3.6. rps41D mutant strains displayed increased sensitivity to osmotic stress The role of RPS41 and RPS42 in resistance to osmotic stress was first investigated by plating exponentially growing cells on solid media supplemented with different types of osmolytes (see Section 2). The rps41D mutant strain, but not rps42D mutant strain, was found to show enhanced sensitivity to osmotic stress when using 1 M sodium chloride in this spot assay on solid medium

(Fig. 5). However, the rps41D and rps42D mutant strain displayed no significant differences in sensitivity to 1 M sorbitol compared to wild-type strain. 3.7. Ectopic expression of either the RPS41 gene or the RPS42 gene in CAI4 increased tolerance to FLC Drug susceptibility assays demonstrated that the rps41D and rps42D mutant strains were not more susceptible to

38

H. Lu et al. / Fungal Genetics and Biology 80 (2015) 31–42

interesting that ectopic expression of either the RPS41 gene or the RPS42 gene in CAI4 leads to reduced sensitivity to FLC (Fig. 6a). We assessed the role of ectopic expression of the RPS41 and RPS42 genes in CAI4 strains, by expressing either the RPS41 gene or the RPS42 gene using the native promoters of the RPS41 and RPS42 genes in CAI4, leading to four copies of either the RPS41 gene or the RPS42 gene in CAI4, in turn, resulting in the increase in the mRNA levels of the RPS41 gene or the RPS42 gene in CAI4 (Fig. 6 b). 3.8. Loss of RPS41 leads to gene expression changes To investigate the mechanism of the phenotypic changes in the rps41D strain at the molecular level, C. albicans cDNA microarray analysis was used to identify gene expression profiles of the wild type strain and the rps41D mutant. A total of 390 differentially expressed genes were found due to loss of RPS41; 198 genes showed an increase in expression and 192 genes showed a decrease in expression (Supplementary data 3). Carbohydrate and nitrogen metabolic processes were repressed (Fig. 7a), while transport process related genes were up-regulated in the rps41D mutant (Fig. 7b). It is worth noting that the genes involved in the methionine 387 (Met) and arginine (Arg) synthesis pathways were repressed in rps41D strains (Fig. 8a, b). However, the rps41 mutant was not auxotrophic for Met and/or Arg 389 (Supplementary data 4). 4. Discussion

Fig. 4 (continued)

azoles, including fluconazole, miconazole, and ketoconazole (Supplementary data 2). Although the rps41D and rps42D mutant strains displayed no differential sensitivity to azoles, it is

To probe the relationship between duplicated genes encoding Rps4p and phenotypes in C. albicans, we used the ‘‘Ura-blaster’’ technology to disrupt both the RPS41 and RPS42 genes in strain CAI4. Applications of ‘‘Ura-blaster’’ technology result in different genomic positions for the URA3 gene in the mutant strains, wild type strains and the strains complemented for the genes of interest. Studies using animal models of systemic candidiasis pointed to possible differences in URA3 gene expression, depending on its genomic location, which confounded interpretation of the role of the gene of interest in lethality (Sundstrom et al., 2002). Fortunately, position effects on URA3 expression can be avoided by placement at a common locus in all strains for comparison (Brand et al., 2004; Davis et al., 2000; Murad et al., 2000; Sundstrom et al., 2002). For this reason, we constructed mutant strain in which URA3 was at the same RPS1 locus in our present study. RPs, abundant RNA-binding proteins, are major components of ribosomes, and are responsible for stabilizing the rRNA structure in the ribosome to guarantee the efficiency of protein synthesis (Nissen et al., 2000). However, there are a few reports showing that

Fig. 5. The rps41D and rps42D mutant strains from the wild-type strain (CAI4) were spotted on YPD agar plates supplemented with different agents at indicated concentrations without uridine. Plates were incubated for 24 h at 30 °C.

H. Lu et al. / Fungal Genetics and Biology 80 (2015) 31–42

39

Fig. 6. (A) The ectopic expression of RPS41 gene and RPS42 gene in the wild-type strain (CAI4) were spotted on YPD agar plates supplemented with FLC at indicated concentrations without uridine. Plates were incubated for 24 h at 30 °C. Three independent three biological replicates were performed. (B) Transcriptional analysis of the RPS41 and RPS42 gene within two sets of CaLH054 (CAI4 + RPS41) and CaLH055 (CAI4 + RPS42) strains. Strains used for real-time PCR experiments were grown for 6–8 h in liquid YPD medium without uridine. Strains tested were wild-type controls (CaLH051), CaLH054, and CaLH055, respectively. The values depicted are average values of at least three independent measurements. The ACT1 transcript levels were controls for all the measurements. The asterisk represents P < 0.05 versus wild-type strain.

a deficiency in some RPs has been linked to developmental disorders in organisms as diverse as yeast (Strittmatter et al., 2006), plants, and human beings (Lai and Xu, 2007). In the present study, we probed the relationship between two paralogous genes encoding Rps4p and cellular phenotypes and characterized in detail the role of the RPS41 and RPS42 in C. albicans. It is interesting that almost identical paralogous Rps41p and Rps42p showed different functions in control of growth rate, filament formation, and osmotic stress sensitivity. Previous studies showed that a number of RPs had functions apart from the formation of the ribosome and protein synthesis (Wool, 1996), and the eukaryotic Rps4p is thought to carry out potential extra-ribosomal functions. To reveal the mechanisms of growth rate, filaments formation and other phenotypes changed in the rps41D at the molecular level, C. albicans cDNA microarrays were used to identify gene expression profiles of the wild type strain and the rps41D mutant. We used microarray analysis to find 390 genes differently expressed between the wild-type strain and the rps41D mutant strain (Supplement data 2); overall, loss of RPS41 gene selectively altered gene expression. This present study showed that the RPS41 gene, not the RPS42 gene, plays a significant role in control of the growth rate. In contrast to loss of RPS42 that slightly affected the growth rate, loss of the RPS41 gene leads to a dramatic growth rate decrease from 0.66 h1 to 0.48 h1, a 28% reduction in growth in comparison to the wild-type strain. This defect in growth rate in the rps41D null mutant was restored by reintegration of the RPS41 gene. To

investigate the mechanisms of the growth rate modulation in rps41D at the molecular level, C. albicans cDNA microarrays were used to identify gene expression profiles of the wild type and the rps41D strains. Our transcriptome analyses have revealed that loss of RPS41 gene leads to a significant change in expression of carbohydrate and nitrogen metabolism related genes (Fig. 7a). The role of RPS41 in hyphal growth was evidenced by the decreased ability of rps41D mutants to form filaments in liquid media and by the altered colonial morphology detected on different solid media. The rps41D mutant, but not the rps42D mutant, shows a deficiency in the morphological transition in different filament inducing media. The RPS41 gene is required for hyphae formation in liquid or on solid YPD + 10% FBS medium and on solid Spider medium, but not in liquid Spider medium. Our transcriptome analyses demonstrated that the filamentous growth related genes ALS1, POB3, ECI1, TPS1 and USO6 were repressed, but the filamentous growth related genes FLO8, CLN3, CHT2, CCC1, orf19.5406, and FGR24 were induced (Biswas et al., 2007; Chaffin, 2008). Als1p, a member of ALS protein family, is a downstream effector of the EFG1 filamentation pathway and required for normal filamentation of C. albicans in vitro (Fu et al., 2002). It is worth noting that the TPS1, which plays an important role in filamentous growth, was repressed (Zaragoza et al., 1998). We found that the susceptibility of rps41D to osmotic stress increased in our present study. We speculated the phenomenon might be related to the glucose level in rps41D. In the rps41D strain

40

H. Lu et al. / Fungal Genetics and Biology 80 (2015) 31–42

Fig. 7. Total gene changes in the rps41D mutants of C. albicans. Genes with less than 2-fold (A) or more than a 2-fold (B) change in expression levels are included in the diagram. Functional classification of each category is based on the C. albicans genome database (http://www.candidagenome.org/).

we observed GUT1 up-regulated and GCY1 down-regulated from our microarray data. GUT1 up-regulation and GCY1 down-regulation could increase glycerol transformation into DHAP leading to a low level of glycerol, and causing high susceptibility to osmotic stress, but this needs to further study. Our results showed an interesting phenomenon with respect to fluconazole (FLC) sensitivity. Although the rps41D and rps42D mutant strains displayed normal sensitivity to azoles, ectopic expression of either RPS41 or RPS42 in CAI4 reduced sensitivity to FLC. As the drug transport process was activated resulting from the lack of Rps4p (Fig. 7b), we speculated that the drug transport process is repressed by the ectopic expression of Rps4p, leading to low sensitivity to FLC (Fig. 6). However, the exact mechanism of Rps4p involved in FLC resistance is unclear. Our results showed that Rps41p plays much more important role than Rps42p in physiological function in C. albicans. The two paralogous genes show extensive sequence identity and code for two almost identical proteins. To reveal the mechanisms through which RPS41 and RPS42 genes showed different functions, we compared RPS4 mRNAs of the wild type and rps41D or rps42D mutant strains to test whether the RPS41 and RPS42 genes are differently transcribed. We found nearly identical amounts of RPS41 mRNA in the wild type and the rps42D null mutants. By contrast, there

was a strong induction of the RPS42 mRNA level in the rps41D null mutants that was 20 times more than in wild type strains. For the total of RPS4 mRNAs, we found that the RPS41 gene is responsible for almost all RPS4 mRNA transcription. We presume that the mutation of the two almost identical RPs generate different phenotypes due to the asymmetric expression of RPS41 gene and RPS42 gene in C. albicans. The rps41D mutant has a broad range of defects, probably due to production of a partially active or inactive protein that interferes with wild-type function for the total of expression of RPS4 genes decreased dramatically (Fig 2c). Paralogous genes exist after the gene or whole genome duplication event, and usually code for proteins with a high degree of identical primary structure and/or similar function (Zhang, 2003; Lynch and Conery, 2000). Gene duplication has long been recognized as an important source of raw genetic material, allowing functional divergence (Conant and Wolfe, 2008) and rapid biological evolution (Kaessmann, 2010). Duplicated genes generally have three fates: duplicated gene can be retained with the same function if increased dosage gives selective advantage (Hakes et al., 2007); duplicates can degenerate and become a pseudogene if a duplicated gene is entirely redundant and may no longer be subject to purifying selection (Ames et al., 2010); sequences of duplicate pairs can diverge functionally with one copy evolving a novel

H. Lu et al. / Fungal Genetics and Biology 80 (2015) 31–42

41

C. albicans and the post whole genome duplication yeast S. cerevisiae have two RPS4 genes. In summary, deletion of the RPS41 gene, but not the RPS42 gene, caused a broad range of defects, probably due to asymmetric expression of the RPS41 and RPS42 genes in C. albicans. It is possible that the nonlethal phenotype of rps41D mutant is due to the closely related gene, RPS42, being sufficient for viability in the absence of RPS41. Our observations raise a number of questions in relation to the role of RPs in growth rate, morphological transition, susceptibility to osmotic stress and FLC sensitivity. The extent to which rps41D phenotypes overlap with mutation or deletion of other ribosomal protein genes, whether the role of Rps41p in phenotypes changed described above is due to a general reduction in ribosome or more specific effects, and whether these defects are due to changes in ribosome function in translation remain to be determined. However, the phenotypes resulting from loss of RPS41 support the notion that RPs have pivotal roles in physiological functions in C. albicans.

Acknowledgments We would like to acknowledge Dr. Cun-Le Wu (Biotechnology Research Institute, Canada) for the helpful discussion about this study. We would also like to thank Professor William A. Fonzi for kindly providing the C. albicans strains CAI4. This work was supported by the National Natural Science Foundation of China (Grant Nos. 81271798 and 81401552), the State Key Program of National Natural Science of China (Grant No. 81330083), and 973 Program 2013CB531602.

Appendix A. Supplementary material Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.fgb.2015.03.012.

References

Fig. 8. (A, B) Transcriptome kinetics in rps41D strains. In contrast to the red rectangle represents expression of genes were up-regulated, the green rectangle represents down-regulated in rps41D strains compared to WT strain.

function or the ancestral function being partitioned between the paralogs (Lynch et al., 2001). Most of RPs, in yeast, plants and flies, are encoded by more than one functional gene (Komili et al., 2007). In S. cerevisiae, which arose from an ancient genome duplication (Kellis et al., 2004), 59 of the 78 RPs are retained in duplication. In contrast to S. cerevisiae, there are more than 2000 sequences encoding RPs in animals, but most of them are predicted to be pseudogenes (Balasubramanian et al., 2009), and most RPs are encoded by single-copy genes (Szakonyi and Byrne, 2011). In C. albicans, a pre-whole genome duplication yeast, only 6 of the 78 RPs (Rps4p, Rps22p, Rps27p, Rpp1p, Rpp2p and Rpl8p) are duplicated. It is worth noting that both of pre-genome duplication yeast

Ames, R.M. et al., 2010. Gene duplication and environmental adaptation within yeast populations. Genome Biol. Evol. 2, 591–601. Askree, S.H. et al., 2004. A genome-wide screen for Saccharomyces cerevisiae deletion mutants that affect telomere length. Proc. Natl. Acad. Sci. USA 101, 8658–8663. Baillie, G.S., Douglas, L.J., 1999. Role of dimorphism in the development of Candida albicans biofilms. J. Med. Microbiol. 48, 671–679. Balasubramanian, S. et al., 2009. Comparative analysis of processed ribosomal protein pseudogenes in four mammalian genomes. Genome Biol. 10, R2. Biswas, S. et al., 2007. Environmental sensing and signal transduction pathways regulating morphopathogenic determinants of Candida albicans. Microbiol. Mol. Biol. Rev. 71, 348–376. Brand, A. et al., 2004. Ectopic expression of URA3 can influence the virulence phenotypes and proteome of Candida albicans but can be overcome by targeted reintegration of URA3 at the RPS10 locus. Eukaryot. Cell 3, 900–909. Byrne, M.E., 2009. A role for the ribosome in development. Trends Plant Sci. 14, 512–519. Chaffin, W.L., 2008. Candida albicans cell wall proteins. Microbiol. Mol. Biol. Rev. 72, 495–544. Conant, G.C., Wolfe, K.H., 2008. Turning a hobby into a job: how duplicated genes find new functions. Nat. Rev. Genet. 9, 938–950. Davis, D. et al., 2000. Candida albicans RIM101 pH response pathway is required for host-pathogen interactions. Infect. Immun. 68, 5953–5959. Dignard, D. et al., 2008. Heterotrimeric G-protein subunit function in Candida albicans: both the a and b subunits of the pheromone response G protein are required for mating. Eukaryot. Cell 7, 1591–1599. Fisher, E. et al., 1990. Homologous ribosomal protein genes on the human X and Y chromosomes: escape from X inactivation and possible implications for Turner syndrome. Cell 63, 1205–1218. Fonzi, W.A., Irwin, M.Y., 1993. Isogenic strain construction and gene mapping in Candida albicans. Genetics 134, 717–728. Fu, Y. et al., 2002. Candida albicans Als1p: an adhesin that is a downstream effector of the EFG1 filamentation pathway. Mol. Microbiol. 44, 61–72. Green, R., Noller, H.F., 1997. Ribosomes and translation. Annu. Rev. Biochem. 66, 679–716.

42

H. Lu et al. / Fungal Genetics and Biology 80 (2015) 31–42

Guthrie, C., Fink, G., 1991. Getting started with yeast. Meth. Enzymol. 194, 3–21. Hakes, L. et al., 2007. All duplicates are not equal: the difference between smallscale and genome duplication. Genome Biol. 8, R209. Jorgensen, P. et al., 2002. Systematic identification of pathways that couple cell growth and division in yeast. Science 297, 395–400. Kaessmann, H., 2010. Origins, evolution, and phenotypic impact of new genes. Genome Res. 20, 1313–1326. Kellis, M. et al., 2004. Proof and evolutionary analysis of ancient genome duplication in the yeast Saccharomyces cerevisiae. Nature 428, 617–624. Komili, S. et al., 2007. Functional specificity among ribosomal proteins regulates gene expression. Cell 131, 557–571. Lai, M.-D., Xu, J., 2007. Ribosomal proteins and colorectal cancer. Curr. Genomics 8, 43. Lopes, A.M. et al., 2010. The human RPS4 paralogue on Yq11. 223 encodes a structurally conserved ribosomal protein and is preferentially expressed during spermatogenesis. BMC Mol. Biol. 11, 33. Lu, H. et al., 2011. Lack of trehalose accelerates H2O2-induced Candida albicans apoptosis through regulating Ca2+ signaling pathway and caspase activity. PLoS ONE 6, e15808. Lynch, M., Conery, J.S., 2000. The evolutionary fate and consequences of duplicate genes. Science 290, 1151–1155. Lynch, M. et al., 2001. The probability of preservation of a newly arisen gene duplicate. Genetics 159, 1789–1804. Maegawa, S. et al., 2010. Widespread and tissue specific age-related DNA methylation changes in mice. Genome Res. 20, 332–340. Murad, A.M.A. et al., 2000. CIp10, an efficient and convenient integrating vector for Candida albicans. Yeast 16, 325–327. Nissen, P. et al., 2000. The structural basis of ribosome activity in peptide bond synthesis. Science 289, 920–930. Nobile, C.J. et al., 2012. A recently evolved transcriptional network controls biofilm development in Candida albicans. Cell 148, 126–138. Oh, J. et al., 2010. Gene annotation and drug target discovery in Candida albicans with a tagged transposon mutant collection. PLoS Pathog. 6, e1001140. Alonso-Monge, R. et al., 2010. The Sko1 protein represses the yeast-to-hypha transition and regulates the oxidative stress response in Candida albicans. Fungal Genet. Biol. 47, 587–601.

Parsons, A.B. et al., 2006. Exploring the mode-of-action of bioactive compounds by chemical-genetic profiling in yeast. Cell 126, 611–625. Rieg, G. et al., 1999. Unanticipated heterogeneity in growth rate and virulence among Candida albicans AAF1 null mutants. Infect. Immun. 67, 3193–3198. Schiestl, R.H., Gietz, R.D., 1989. High efficiency transformation of intact yeast cells using single stranded nucleic acids as a carrier. Curr. Genet. 16, 339–346. Selmecki, A. et al., 2005. Comparative genome hybridization reveals widespread aneuploidy in Candida albicans laboratory strains. Mol. Microbiol. 55, 1553– 1565. Selmecki, A. et al., 2010. Genomic plasticity of the human fungal pathogen Candida albicans. Eukaryot. Cell 9, 991–1008. Sonenberg, N., Hinnebusch, A.G., 2009. Regulation of translation initiation in eukaryotes: mechanisms and biological targets. Cell 136, 731–745. Spahn, C.M. et al., 2001. Structure of the 80S ribosome from Saccharomyces cerevisiae-tRNA-ribosome and subunit–subunit interactions. Cell 107, 373–386. Staab, J.F., Sundstrom, P., 2003. URA3 as a selectable marker for disruption and virulence assessment of Candida albicans genes. Trends Microbiol. 11, 69–73. Strittmatter, A.W. et al., 2006. FLO11 mediated filamentous growth of the yeast Saccharomyces cerevisiae depends on the expression of the ribosomal RPS26 genes. Mol. Genet. Genomics 276, 113–125. Sudhamalla, B. et al., 2012. Cysteine protease attribute of eukaryotic ribosomal protein S4. Biochim. Biophys. Acta 1820, 1535–1542. Sundstrom, P. et al., 2002. Reevaluation of the role of HWP1 in systemic candidiasis by use of Candida albicans strains with selectable marker URA3 targeted to the ENO1 locus. Infect. Immun. 70, 3281–3283. Szakonyi, D., Byrne, M.E., 2011. Ribosomal protein L27a is required for growth and patterning in Arabidopsis thaliana. Plant J. 65, 269–281. Wool, I.G., 1996. Extraribosomal functions of ribosomal proteins. Trends Biochem. Sci. 21, 164–165. Zaragoza, O. et al., 1998. Disruption of the Candida albicans TPS1 gene encoding trehalose-6-phosphate synthase impairs formation of hyphae and decreases infectivity. J. Bacteriol. 180, 3809–3815. Zhang, J., 2003. Evolution by gene duplication: an update. Trends Ecol. Evol. 18, 292–298. Zinn, A.R. et al., 1994. Structure and function of ribosomal protein S4 genes on the human and mouse sex chromosomes. Mol. Cell. Biol. 14, 2485–2492.