Experimental Hematology 2015;-:-–-
Loss of autophagy leads to failure in megakaryopoiesis, megakaryocyte differentiation, and thrombopoiesis in mice Yan Cao, Jinyang Cai, Suping Zhang, Na Yuan, Xin Li, Yixuan Fang, Lin Song, Menglin Shang, Shengbing Liu, Wenli Zhao, Shaoyan Hu, and Jianrong Wang Hematology Center of Cyrus Tang Medical Institute, Jiangsu Institute of Hematology, Collaborative Innovation Center of Hematology, Jiangsu Key Laboratory for Stem Cell Research, Affiliated Children’s Hospital, Soochow University School of Medicine, Suzhou, China (Received 3 July 2014; revised 15 December 2014; accepted 5 January 2015)
During hematopoiesis, megakaryopoiesis, megakaryocyte differentiation, and thrombopoiesis are regulated at multiple stages, which involve successive lineage commitment steps and proceed with polyploidization, maturation, and organized fragmentation of the cytoplasm, leading to the release of platelets in circulation. However, the cellular mechanisms by which megakaryocytes derive from their progenitors and differentiate into platelets have not fully been understood. Using an Atg7 hematopoietic conditional knockout mouse model, we found that loss of autophagy, a metabolic process essential in homeostasis and cellular remodeling, caused mitochondrial and cell cycle dysfunction, impeding megakaryopoiesis and megakaryocyte differentiation, as well as thrombopoiesis and subsequently produced abnormal platelets, larger in size and fewer in number, ultimately leading to severely impaired platelet production and failed hemostasis. Copyright Ó 2015 ISEH - International Society for Experimental Hematology. Published by Elsevier Inc.
During hematopoiesis, hematopoietic stem cells (HSCs) give rise to two lineages, a common lymphoid progenitor, capable of producing lymphocytes, and a common myeloid progenitor with developmental potential restricted to granulocytes/monocytes, basophils, eosinophils, erythroid, and megakaryocytes [1]. Megakaryocytes have a unique maturation process that includes polyploidization, development of an extensive internal demarcation membrane system, formation of proplatelet processes, and finally release into sinusoidal blood vessels, which undergo repeated abscissions to yield circulating platelets [2,3]. Megakaryocyte differentiation is regulated both positively and negatively by cytokines and transcription factors. For instance, granulocyte-macrophage colony–stimulating factor, interleukin (IL) 3, IL-6, IL-11, IL-12, and erythropoietin can stimulate megakaryocytic progenitor proliferation, whereas IL-1a and leukemia inhibitory factor can modulate megakaryocyte maturation and platelet release [4]. The number of megakaryocytes and platelets in mice lacking thrombopoietin (TPO) decreases by approximately 85%. Although suffering severe thrombocytopenia, mice retain w15% of their peripheral platelet count, indicating that TPO is cenOffprint requests to: Prof. Jianrong Wang, Soochow University School of Medicine, Hematology Center of Cyrus Tang Medical Institute, 199 Ren’ai Road, Suzhou 215123, China; E-mail: [email protected]
tral to but dispensable for megakaryocytopoiesis [5,6]. Multiple transcription factors, including Runt-related transcription factor 1 (RUNX1), GATA binding protein 1 (GATA1), Friend leukemia virus integration 1 (Fli1), and transcriptional activator Myb (c-Myb), regulate megakaryocyte differentiation. GATA-1, the master regulator of hematopoiesis, plays a critical role in megakaryocyte differentiation by functioning either as an activator or repressor, depending on the protein complex [7]. A recent study demonstrates that GATA-1 directly activates transcription of genes encoding the essential autophagy component microtubule-associated protein 1 light chain 3B (LC3B) and its homologues [8]. Autophagy is an evolutionary conserved metabolic and remodeling process that is executed by a series of autophagy related genes (ATGs) [9,10]. Deletion of Atg7 in hematopoietic stem cells results in failure to maintain an HSC pool and in the development of myeloid malignancies [11]. Mice lacking Atg7 in the hematopoietic system develop severe anemia. Atg7/ erythrocytes accumulate damaged mitochondria with altered membrane potential, leading to cell death. Deficiency of Atg7 also led to severe lymphopenia as a result of mitochondrial damage, followed by apoptosis in mature T lymphocytes [10]. A recent study showed that human platelets express Atg5, Atg7, and LC3. Similar to nucleated mammalian cells, autophagy
0301-472X/Copyright Ó 2015 ISEH - International Society for Experimental Hematology. Published by Elsevier Inc. http://dx.doi.org/10.1016/j.exphem.2015.01.001 EXPHEM3223_proof ■ 21-4-2015 9-10-28
2
Y. Cao et al./ Experimental Hematology 2015;-:-–-
in human platelets was stimulated by cell starvation or rapamycin in a phosphatidylinositol 3-kinase–dependent manner. Disruption of autophagic flux led to impairment of platelet aggregation and adhesion. Furthermore, monoallelic deletion of Becn1 in mice displayed a prolonged bleeding time and reduced platelet aggregation. These results suggest that platelets may require a Becn1dependent autophagy [12]. Hemostasis depends on functional platelets, which are produced by megakaryocytes requiring normal megakaryopoiesis, megakaryocyte differentiation, and thrombopoiesis. In this study, we examine the role of autophagy during in vivo megakaryopoiesis, megakaryocyte differentiation, and thrombopoiesis using hematopoietic system conditional knockout mice. The Atg7-deficient mice displayed aberrant megakaryogenesis, megakaryocyte differentiation, and thrombopoiesis from hematopoietic progenitors and ultimately failed platelet production and hemostasis.
Materials and methods Materials Suppliers were: phycoerythrin (PE)-labeled JON/A antibody supplied by Emfret (Eibelstadt, Germany); PE-conjugated antiP-selectin antibody, anti-CD41-FITC, and anti-CD61-PE supplied by eBioscience (San Diego, CA); MitoTracker Green and MitoSox Red supplied by Invitrogen (Carlsbad, CA). Generation of Atg7f/f;Vav-Cre mice Atg7Flox/Flox mice (from RIKEN BioResource Center, Ibaraki, Japan) were crossed to Vav-Cre mice (Jackson Laboratory, Sacramento, CA) to obtain Atg7f/f;Vav-Cre. Genotyping was performed on tail genomic DNA as described previously [13,14]. Male and female mice were used equally in all experiments. Each group contained at least six mice. All experiments with animals complied with the institutional protocols on animal welfare and were approved by the Ethics Committee of Soochow University, China. Polymerase chain reaction genotyping The final polymerase chain reaction (PCR) volume was 20 mL, and PCR was performed as follows: 1 cycle of 94 C for 5 min, 35 cycles of 94 C for 30 sec, 60 C or 64 C for 30 sec, 72 C for 40 sec or 2 min, and 1 cycle of 72 C for 5 min. After gel electrophoresis, the wild-type (WT) band of Atg7f/f was detected at 653 bp, and the mutant band was detected at 426 bp; the WT band of Atg7 knockout band was detected at 1,641 bp, and the knockout (KO) band was detected at 600 bp. The positive band of Vav-Cre was detected at 236 bp. The following primers were used: Atg7-F: CATCTTGTAGCACCTGCTGACCTGG; Atg7-R: CCACTGGC CCATCAGTGAGCATG; LoxP-R: GCGGATCCTCGTATAAT GTATGCTATACGAAGTTAT; Atg7-F2: TGGCTGCTACTTCTG CAATGATGT; Atg7-R2: AAGCCAAAGGAAACCAAGGGAG TG; Vav-F: AGATGCCAGGACATCAGGAACCTG; and Vav-R: ATCAGCCACACCAGACACAGAGATC. Western blotting analyses Isolated bone marrow lineage-negative (Lin) cells were solubilized in 1 lysis buffer (Cell Signaling, Beverly, MA) containing
protease inhibitor (Roche, Basel, Swiss). Cell debris was removed by centrifugation. Thirty micrograms of protein was separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred to a polyvinylidene fluoride (PVDF) membrane (Millipore, Billerica, MA). The membrane was incubated with anti-Atg7, anti–glyceraldehyde 3-phosphate dehydrogenase and anti-LC3 monoclonal antibodies, detected with the enhanced chemiluminescent (ECL) system (Pierce, Waltham, MA). Blood routine examination We added 20 mL mouse peripheral blood into 500 mL CPK-303A solution (37 C), and then routine blood examination was performed using Sysmex KX-21N (Kobe, Japan). Tail bleeding time Mice were anesthetized by intraperitoneal injection of 2, 2, 2-trichloroethan-1, 1-diol (0.1 mL/10 g of body weight), and the distal 3-mm segment of the tail was removed with a scalpel. Time until complete cessation of bleeding was measured. Bleeding was stopped after 20 min if the tail was still bleeding. Flow cytometry and aggregation studies Flow cytometry studies on mouse platelets were performed using platelet-rich plasma prepared from blood obtained into acid-citrate dextrose solution through the inferior vena cava and diluted into Tyrode’s buffer as previously described [15]. Bone marrow or Lin cells were stained with indicated antibodies or dyes and analyzed by BD Calibur cytometer (BD Bioscience, San Diego, CA). Aggregation studies were performed using washed platelets prepared as described previously [16]. Quantitative measurement of acetylcholinesterase activity Acetylcholinesterase (AChE) activity was measured by the microplate method [17]. Briefly, cells (1 103 cells) and platelets (1 105) were suspended with 200 mL of phosphate-buffered saline containing 0.5% of Bovine Serum Albumin (BSA) and seeded in a 96-well plate. We added 50 mL of 0.265 mmol/L 5,50 -dithiobis-2-nitrobenzoic acid (Sigma-Aldrich, St. Louis, MO) containing 1 mol/L Tris (pH 8.0) and 1% Triton X-100 (Sigma-Aldrich); then, the optical density (OD) was measured at 405 nm using automatic colorimeter (OD405[A]). We then added 15 mL of 10 mmol/L acetylthiocholine iodide (Sigma-Aldrich). Optical density was again measured at 405 nm after 30 min (OD405[B]). Specific AChE activity (DOD405) was calculated by OD405[B]-OD405[A]. Cell cycle analysis Bone marrow Lin- cells were cultured with TPO and stem cell factor (SCF) for 4 days and then harvested. After centrifugation, cells were fixed in 70% ice-cold ethanol at 4 C overnight and then incubated with propidium iodide staining solution containing 50 mg/mL propidium iodide and 20 mg/mL RNase at room temperature for 30 min before analysis by flow cytometry. Isolation of lineage negative cells Bone marrow cells were stained with biotin antibodies specific for the following lineage markers: CD5, CD45R (B220), CD11b, Anti-Gr-1(Ly-6G/C), and Ter119. To obtain Lin cells, Linþ cells were depleted using anti-biotin microbeads (Miltenyi Biotec, Bergisch Gladbach, Germany).
EXPHEM3223_proof ■ 21-4-2015 9-10-29
Y. Cao et al./ Experimental Hematology 2015;-:-–-
Megakaryocyte purification and culture Mature megakaryocytes from BM cells were defined using the standard method [18] with some modifications. Briefly, BM cells were obtained from femora and tibiae of C57BL6 mice by flushing, and lineage positive cells were depleted using immunomagnetic beads (Miltenyi Biotec). The remaining population was cultured in 2.6% serum-supplemented Roswell Park Memorial Institute 1640 medium with 2 mmol/L L-glutamine, penicillin/streptomycin, and 20 ng/mL murine SCF at 37 C under 5% CO2 for 2 days. Cells were then cultured for an additional 4 days in the presence of 20 ng/mL murine SCF and 100 ng/mL murine TPO [19,20]. Wright-Giemsa staining Morphology of megakaryocytes was evaluated by Wright-Giemsa staining. Briefly, cytospin preparations were incubated sequentially in solution A for 1 min and solution B for 7 min and washed with water, air-dried, and then examined under an Olympus Microscope (Tokyo, Japan). Statistical analysis Statistical analyses were performed with a two-tailed unpaired t test. We considered p ! 0.05 to indicate statistical significance.
Results Generation of Atg7-deficient mouse strains To investigate the physiologic roles of autophagy in mammalian hematopoietic system, we generated a hematopoietic conditional Atg7 knockout mouse model (Atg7f/f; Vav-Cre, hereafter referred to as Atg7/) by breeding the Atg7f/f mice with Vav-Cre transgenic mice that the expression of Cre recombinase restricted to hematopoietic cells [21,22]. Homozygous Atg7/ mice were viable but infertile and were born at Mendelian frequency from intercrosses of heterozygous parents (Atg7f/þ;Vav-Cre, hereafter referred to as Atg7þ/). The results of PCR genotyping are shown in Figure 1A. The lack of Atg7 protein in the Atg7/ cells was also confirmed by Western blot analysis (Fig. 1B). We also tested autophagy activity by examining the two forms of LC3 in the BM Lin cells. Unlike in WT and Atg7þ/ Lin cells, LC3-II is no longer formed in Atg7/ Lin cells due to Atg7 deletion–caused disruption of LC3 lipidation, demonstrating a successful loss of autophagy in hematopoietic cells. Abnormal platelet production in Atg7/ mice The blood count revealed that the number of platelets in the peripheral blood of Atg7/ mice was significantly decreased compared with WT mice (Fig. 1C). The platelet size (mean platelet volume) was increased, and the large platelet (platelet-large cell ratio, P-LCR) was only observed in Atg7/ peripheral blood (Fig. 1D). These data suggest a critical role of autophagy in normal platelet production. Atg7/ mice display a defect in platelet activation To assess whether the observed platelet changes in peripheral blood of Atg7/ mice result in functional aberrations
3
of platelet biology, we assessed the bleeding time and platelet aggregation in Atg7/ mice. The bleeding time was significantly longer, and thrombin-induced platelet aggregation was severely decreased in Atg7/ compared with WT mice and Atg7þ/ heterozygous mice, although the Atg7þ/ heterozygous mice displayed a longer bleeding time than the WT mice (Fig. 1E and 1F). The P-selectin (CD62P) level and activation of integrin aIIbb3 (JON/A), two markers for platelet activation and aggregation, were also decreased in both Atg7/ and Atg7þ/ mice as compared with WT mice (CD62P: WT 14.5 6 0.09, Atg7þ/ 11.17 6 0.06, Atg7/ 3.2 6 0.03, p ! 0.01; aIIbb3: WT 48.1 6 0.1, Atg7þ/ 13.5 6 0.1, Atg7/ 5.9 6 0.2, p ! 0.01; Fig. 1G and 1H). These results indicate the important role of Atg7 in platelet activation and hemostasis. Autophagy deficiency leads to impeded megakaryocyte differentiation To determine whether the dysfunction of platelets was a consequence of the impairment in their upstream event, i.e., abnormal differentiation of megakaryocytes, we defined the bone marrow megakaryocytes in WT, Atg7þ/, and Atg7/ mice by CD41þCD61þ cell population and AChE activity, a marker of murine megakaryocytic cells. The percentage of CD41þCD61þ cells was decreased in Atg7/ bone marrow cells (Fig. 2A), which was associated with increased apoptosis and necrosis, shown by flow cytometric data measured with Annexin-V (Fig. 2B). Histopathologic examination of the bone marrow and spleen from WT, Atg7þ/, and Atg7/ mice by hematoxylin-eosin (H&E) staining showed that the number of autophagydefective megakaryocytes from bone marrow, but not spleen, was greatly decreased (Fig. 2C), supporting the above cytometric data. In megakaryopoiesis, HSCs differentiate into megakaryocytes through their committed progenitors. To obtain megakaryocytic progenitor cells, Linþ bone marrow cells from mice were depleted by immunomagnetic beads, and the Lin bone marrow cells were cultured in the medium supplied with murine SCF for 2 days, then cultured for an additional 4 days in the presence of murine SCF and murine TPO. In mice lacking hematopoietic autophagy, both the Lin cells stimulated by TPO and the platelets collected through the inferior vena cava had significantly lower AChE activity compared with WT mice (Fig. 2D). In the presence of murine TPO, many enlarged megakaryocytic cells were observed on day 3 in WT compared with few in Atg7/ group. Microscopic examination of cytospin samples revealed that megakaryocytes in Atg7/ mice had aberrant nongrained cytoplasm characterized by numerous vacuoles (Fig. 2E). To evaluate megakaryocyte differentiation from common myeloid progenitors, we used CD41/forward-scatter (FSC) dot plot to identify megakaryocyte population. CD41 is the lineage marker to identify megakaryocytes, and FSC properties distinguish cells on the basis of size. After differentiation,
EXPHEM3223_proof ■ 21-4-2015 9-10-29
Y. Cao et al./ Experimental Hematology 2015;-:-–-
web 4C=FPO
4
Figure 1. Autophagy deficiency results in impaired thrombopoiesis and platelet function. (A) Genomic DNA PCR using the Atg7, KO, and Vav primers confirmed the structure of Atg7 allele for WT and knockout, respectively. (B) Western blotting analysis of Atg7 and LC3-I/II protein expression. No Atg7 and LC3-II protein were detected in the Atg7-deficient mouse BM Lin cells with either antibody. Glyceraldehyde 3-phosphate dehydrogenase was used as a loading control. (C, D) Aberrant platelet production in Atg7-defective mice. The number and size of platelets in the peripheral blood were detected by blood count and flow cytometry in WT (n 5 12), Atg7þ/ (n 5 12), and Atg7/ (n 5 8) animals. (E) Bleeding time was determined as the interval until bleeding stopped in WT (n 5 12), Atg7þ/ (n 5 5), and Atg7/ (n 5 9) mice. (F) Representative aggregation tracing and combined results from WT, Atg7þ/, and Atg7/ mice show the aggregation defect in Atg7-deficient platelets using thrombin (0.2 U/mL; n $ 4). (G, H) Atg7-deficient platelets have a defect in activation of CD62P and aIIbb3 by thrombin detected by the JON/A activation dependent antibody in WT, Atg7þ/, and Atg7/ mice (n $ 4). All data are from three independent experiments. *p ! 0.05; **p ! 0.01. GAPDH 5 glyceraldehyde 3-phosphate dehydrogenase; MPV 5 mean platelet volume; PLT 5 platelet; P-LCR 5 platelet-large cell ratio.
CD41þ with a high level of FSC was observed in WT cells, whereas only a low level of CD41þFSChigh cells were seen in the Atg7/ mice (Fig. 2F). Autophagy deficiency leads to mitochondrial and cell cycle dysfunction of hematopoietic progenitors Failure to remove mitochondria and loss of control of reactive oxygen species contribute to differentiation failure
in erythroid maturation [10]. Lin cells were therefore stained with MitoTracker Green or MitoTracker Deep Red or measured for mitochondrial genome abundance by quantitative PCR, all indicators of mitochondrial mass (Fig. 3A–3C), and also stained with MitoSOX, a mitochondrial superoxide indicator (Fig. 3D). Indeed, Atg7/ bone marrow Lin cells showed accumulated mitochondria mass and displayed increased mitochondrial superoxide
EXPHEM3223_proof ■ 21-4-2015 9-10-29
5
web 4C=FPO
Y. Cao et al./ Experimental Hematology 2015;-:-–-
Figure 2. Autophagy deficiency leads to impeded megakaryocyte differentiation. (A) Flow-cytometric analysis of mouse bone marrow cells stained with anti-CD41-FITC and anti-CD61-PE conjugate. The percentage of CD41þ/CD61þ cells was quantified (right panel). (B) Cell death analysis on bone marrow CD41þ/CD61þ cell population. Representative flow plots measured with Annexin-V (left panel) and statistic result (right panel). (C) Histopathologic examination by hematoxylin and eosin staining in WT, Atg7þ/, and Atg7/ mice. * Megakaryocyte in the bone marrow of the Atg7/ mice. (D) Specific AChE activity of TPO-induced BM Lin cells and peripheral platelets were estimated by a quantitative method of AChE activity. (E) Megakaryocyte differentiation was induced for 4 days in mouse Lin progenitors. Photographs show cytospin examples of WT as well as of aberrant Atg7/ megakaryocytes (upper panel). These cells were stained by Wright-Giemsa. (F) Megakaryocyte differentiation was induced for 4 days in Lin BM cells and analyzed using gates suited to FSC (size) and CD41 expression level (fluorescence) of megakaryocytes. All data are from three independent experiments (n $ 4). *p ! 0.05; **p ! 0.01. FITC 5 fluorescein isothiocyanate; PI 5 Propidium Iodide.
production as compared with WT Lin cells (Fig. 3A–3D). Cell cycle analysis showed that Atg7 deficiency caused apoptosis and fewer progenitor cells in diploidy and polyploidy (Fig. 3E).
Discussion Megakaryocytes residing in the bone marrow are the source of platelets. Platelet production depends on successful megakaryopoiesis and megakaryocyte differentiation, which are identified by development of common myeloid progenitors with potential to commit to megakaryocytes as well as megakaryocyte polyploidization and maturation. In the final stage of megakaryocyte differentiation, megakaryo-
cytes in bone marrow extend and release long, branched proplatelets into sinusoidal blood vessels, which undergo repeated abscissions to yield circulating platelets [23]. Fragmentation of proplatelets occurs exclusively in the blood circulation; otherwise, platelets would remain trapped in the marrow [23]. Ex vivo pharmacologic inhibition of autophagy in human platelets impairs platelet function, and monoallelic nontissue specific deletion of Becn1 of mice demonstrates a role of Becn1-dependent autophagy in platelet function [12]. However, platelet impairment may also be attributable to other causes, since absence of nonconditional Becn1 may lead to other adverse effects on cell function. Using a conditional mouse model in which autophagy-essential gene Atg7 is exclusively deleted in the
EXPHEM3223_proof ■ 21-4-2015 9-10-30
Y. Cao et al./ Experimental Hematology 2015;-:-–-
web 4C=FPO
6
Figure 3. Autophagy deficiency leads to mitochondrial and cell-cycle dysfunction of hematopoietic progenitors. (A, B) BM Lin cells from WT and Atg7/ mice were stained with (A) MitoTracker Green or (B) MitoTracker Deep Red. (C) Relative mDNA/nDNA ratios in WT, and Atg7/ Lin cells. The mDNA/ nDNA ratios were quantified (right panel). (D) BM Lin cells from WT or Atg7/ mice were stained with MitoSOX. (E) Cell cycle distribution in BM Lin Cells treated with TPO and SCF for 4 days. All data are from three independent experiments (n $ 4). *p ! 0.05; **p ! 0.01. AP 5 apoptosis; mDNA 5 mitochondrial DNA; nDNA 5 nuclear DNA; PI 5 Propidium Iodide.
hematopoietic system, we found a severe loss of platelets in peripheral blood (Fig. 1C); meanwhile, the platelet size in the Atg7-deficient mice was significantly increased compared with that of littermate controls, indicating that Atg7 deficiency in the hematopoietic system alters platelets both in number and size (Fig. 1D). In term of irregular platelet size, loss of Atg7 may cause a failure in abscission, leading to the accumulation of premature or large platelets. As platelet number and size are inversely proportional, our data suggest that platelet reduction in number in Atg7/ mice may be caused at least in part by formation of macrothrombocytopenias, which represent a failure in the intermediate stages of platelet production [24]. A low count and larger size for platelets are associated with platelet dysfunction. In this study, we found that deficiency of Atg7 in the hematopoietic system prolongs the tail bleeding times and platelet aggregation induced by reduced thrombin (Fig. 1E and 1F). Moreover, the expression of platelet activation marker CD62P and activated aIIbb3 induced by thrombin was lower in autophagy-defective platelets than in WT and Atg7þ/ ones (Fig. 1G and 1H). Taken together, our data indicate that autophagy is important for platelet production and hemostasis. Our data further demonstrate that autophagy-defective hematopoietic progenitors accumulate aberrant mitochondria and generate increased levels of reactive oxygen species. These cellular disorders of autophagy defect could impair erythropoiesis [10]. Thus, the reduction in the platelet count and the enlargement in platelet size may be caused by aberrant megakaryocyte lineage differentiation. Our notion was confirmed by a decreased number of mega-
karyocytes in Atg7/ bone marrow using CD41 and CD61 markers or H&E staining (Fig. 2A–2C). Additionally, a previous study demonstrated that AChE activity, which exists among the membrane systems such as the Golgi complex, increases gradually during megakaryocyte maturation in the red bone marrow of mouse, rat, and cat [25]. We found that the AChE activity clearly dropped in the platelets and megakaryocyte progenitors lacking autophagy, indicating differentiation blockage in Atg7/ megakaryocyte progenitors (Fig. 2D). Because of the limit imposed by the infrequency of mature megakaryocytes in the bone marrow, we enriched megakaryocytes using hematopoietic progenitor cells (HPCs) obtained from the bone marrow of Atg7/ and WT mice. Significantly fewer numbers of mature megakaryocytes were observed in Atg7/ cultures (Fig. 2E). Autophagy is a solely cellular mechanism capable of cleaning damaged mitochondria, which is often caused by overproduction of reactive oxygen species [26]. Megakaryocytes undergo progressive differentiation while becoming polyploid through endomitosis, and megakaryocyte polyploidy is positively associated with platelet production [27]. How the polyploid cell avoids apoptotic triggers and continues to cycle remains unknown. Our data indicate that autophagy deficiency caused accumulation of mitochondria and mitochondrial superoxide (Fig. 3A–3D) and significant apoptosis (Fig. 3E) in bone marrow Lin cells, suggesting that autophagy prevents apoptosis, secures cell cycle, and confers progenitors to differentiate to megakaryocytes. It should be noted that Atg7 deletion in the present mouse model occurs in hematopoietic stem cells, leading
EXPHEM3223_proof ■ 21-4-2015 9-10-30
Y. Cao et al./ Experimental Hematology 2015;-:-–-
to autophagy defect in the entire hematopoietic system. Thus, a lineage-specific deletion of the Atg gene in megakaryocytes and platelets is needed to better assess intrinsic effects on thrombopoiesis and platelet function. In summary, in the present study, we show that autophagy is essential for megakaryopoiesis, megakaryocyte differentiation, thrombopoiesis, and platelet production. Therefore, autophagy may serve as a suitable target for megakaryocyte/platelet disorders in clinical conditions.
Acknowledgments This work was supported by grants from the National Natural Science Foundation of China (nos. 31071258, 81272336, and 31201073), the National Basic Research Program from The Ministry of Science and Technology of China (no. 2011CB512101), the Department of Science and Technology of Jiangsu Province of China (no BK20130333), and a project funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions. Conflict of interest disclosure: No financial interest/ relationships with financial interest relating to the topic of this article have been declared.
References 1. Kondo M, Wagers AJ, Manz MG, et al. Biology of hematopoietic stem cells and progenitors: Implications for clinical application. Annu Rev Immunol. 2003;21:759–806. 2. Bluteau D, Lordier L, Di Stefano A, et al. Regulation of megakaryocyte maturation and platelet formation. J Thromb Haemost. 2009;7: 227–234. 3. Machlus KR, Italiano JE Jr. The incredible journey: From megakaryocyte development to platelet formation. J Cell Biol. 2013;201: 785–796. 4. Machlus KR, Thon JN, Italiano JE Jr. Interpreting the developmental dance of the megakaryocyte: A review of the cellular and molecular processes mediating platelet formation. Br J Haematol. 2014;165: 227–236. 5. Murone M, Carpenter DA, de Sauvage FJ. Hematopoietic deficiencies in c-mpl and TPO knockout mice. Stem Cells. 1998;16:1–6. 6. Ng AP, Hauppi M, Metcalf D, et al. Mpl expression on megakaryocytes and platelets is dispensable for thrombosis but essential to prevent myeloproliferation. Proc Natl Acad Sci U S A. 2014;111: 5884–5889. 7. Martin F, Prandini MH, Thevenon D, Marguerie G, Uzan G. The transcription factor GATA-1 regulates the promoter activity of the platelet glycoprotein IIb gene. J Biol Chem. 1993;268:21606–21612. 8. Kang YA, Sanalkumar R, O’Geen H, et al. Autophagy driven by a master regulator of hematopoiesis. Mol Cell Biol. 2012;32:226–239.
7
9. Levine B, Klionsky DJ. Development by self-digestion: molecular mechanisms and biological functions of autophagy. Dev Cell. 2004; 6:463–477. 10. Mortensen M, Ferguson DJP, Edelmann M, et al. Loss of autophagy in erythroid cells leads to defective removal of mitochondria and severe anemia in vivo. Proc Natl Acad Sci U S A. 2009;107:832–837. 11. Mortensen M, Soilleux EJ. The autophagy protein Atg7 is essential for hematopoietic stem cell maintenance. J Exp Med. 2011;208:455–467. 12. Feng W, Chang C, Luo D, et al. Dissection of autophagy in human platelets. Autophagy. 2014;10:642–651. 13. Komatsu M, Waguri S, Ueno T, et al. Impairment of starvationinduced and constitutive autophagy in Atg7-deficient mice. J Cell Biol. 2005;169:425–434. 14. De Boer J, Williams A, Skavdis G, et al. Transgenic mice with hematopoietic and lymphoid specific expression of Cre. Eur J Immunol. 2003;33:314–325. 15. Wu Y, Ahmad SS, Zhou J, Wang L, Cully MP, Essex DW. The disulfide isomerase ERp57 mediates platelet aggregation, hemostasis, and thrombosis. Blood. 2012;119:1737–1746. 16. Wu Y, Suzuki-Inoue K, Satoh K, et al. Role of Fc receptor gammachain in platelet glycoprotein Ib-mediated signaling. Blood. 2001; 97:3836–3845. 17. Matsumura-Takeda K, Sogo S, Isakari Y, et al. CD41/CD45 cells without acetylcholinesterase activity are immature and a major megakaryocytic population in murine bone marrow. Stem Cells. 2007;25: 862–870. 18. Mazharian A, Watson SP, Severin S. Critical role for ERK1/2 in bone marrow and fetal liver-derived primary megakaryocyte differentiation, motility, and proplatelet formation. Exp Hematol. 2009;37:1238–1249. 19. Dumon S, Heath VL, Tomlinson MG, Gottgens B, Frampton J. Differentiation of murine committed megakaryocytic progenitors isolated by a novel strategy reveals the complexity of GATA and Ets factor involvement in megakaryocytopoiesis and an unexpected potential role for GATA-6. Exp Hematol. 2006;34:654–663. 20. Dhanjal TS, Pendaries C, Ross EA, et al. A novel role for PECAM-1 in megakaryocytokinesis and recovery of platelet counts in thrombocytopenic mice. Blood. 2007;109:4237–4244. 21. Ogilvy S, Metcalf D, Gibson L, Bath ML, Harris AW, Adams JM. Promoter elements of vav drive transgene expression in vivo throughout the hematopoietic compartment. Blood. 1999;94:1855–1863. 22. Cao Y, Zhang A, Cai J, et al. Autophagy regulates the cell cycle of mouse HSPCs in a nutrient-dependent manner. Exp Hematol. 2015; 43:229–242. 23. Junt T, Schulze H, Chen Z, et al. Dynamic visualization of thrombopoiesis within bone marrow. Science. 2007;317:1767–1770. 24. Thon JN, Italiano JE Jr. Does size matter in platelet production? Blood. 2012;120:1552–1561. 25. Rata S, Wesemann W, McDonald TP. Isolation of mouse megakaryocytes. I. Separation of two fractions enriched in different maturational stages. Eur J Cell Biol. 1985;37:111–116. 26. Moore MN. Autophagy as a second level protective process in conferring resistance to environmentally-induced oxidative stress. Autophagy. 2008;4:254–256. 27. Geddis AE. Megakaryopoiesis. Semin Hematol. 2010;47:212–219.
EXPHEM3223_proof ■ 21-4-2015 9-10-31
Loss of autophagy leads to failure in megakaryopoiesis, megakaryocyte differentiation, and thrombopoiesis in mice Yan Cao, Jinyang Cai, Suping Zhang, Na Yuan, Xin Li, Yixuan Fang, Lin Song, Menglin Shang, Shengbing Liu, Wenli Zhao, Shaoyan Hu, and Jianrong Wang Hematology Center of Cyrus Tang Medical Institute, Jiangsu Institute of Hematology, Collaborative Innovation Center of Hematology, Jiangsu Key Laboratory for Stem Cell Research, Affiliated Children’s Hospital, Soochow University School of Medicine, Suzhou, China (Received 3 July 2014; revised 15 December 2014; accepted 5 January 2015)
During hematopoiesis, megakaryopoiesis, megakaryocyte differentiation, and thrombopoiesis are regulated at multiple stages, which involve successive lineage commitment steps and proceed with polyploidization, maturation, and organized fragmentation of the cytoplasm, leading to the release of platelets in circulation. However, the cellular mechanisms by which megakaryocytes derive from their progenitors and differentiate into platelets have not fully been understood. Using an Atg7 hematopoietic conditional knockout mouse model, we found that loss of autophagy, a metabolic process essential in homeostasis and cellular remodeling, caused mitochondrial and cell cycle dysfunction, impeding megakaryopoiesis and megakaryocyte differentiation, as well as thrombopoiesis and subsequently produced abnormal platelets, larger in size and fewer in number, ultimately leading to severely impaired platelet production and failed hemostasis. Copyright Ó 2015 ISEH - International Society for Experimental Hematology. Published by Elsevier Inc.
During hematopoiesis, hematopoietic stem cells (HSCs) give rise to two lineages, a common lymphoid progenitor, capable of producing lymphocytes, and a common myeloid progenitor with developmental potential restricted to granulocytes/monocytes, basophils, eosinophils, erythroid, and megakaryocytes [1]. Megakaryocytes have a unique maturation process that includes polyploidization, development of an extensive internal demarcation membrane system, formation of proplatelet processes, and finally release into sinusoidal blood vessels, which undergo repeated abscissions to yield circulating platelets [2,3]. Megakaryocyte differentiation is regulated both positively and negatively by cytokines and transcription factors. For instance, granulocyte-macrophage colony–stimulating factor, interleukin (IL) 3, IL-6, IL-11, IL-12, and erythropoietin can stimulate megakaryocytic progenitor proliferation, whereas IL-1a and leukemia inhibitory factor can modulate megakaryocyte maturation and platelet release [4]. The number of megakaryocytes and platelets in mice lacking thrombopoietin (TPO) decreases by approximately 85%. Although suffering severe thrombocytopenia, mice retain w15% of their peripheral platelet count, indicating that TPO is cenOffprint requests to: Prof. Jianrong Wang, Soochow University School of Medicine, Hematology Center of Cyrus Tang Medical Institute, 199 Ren’ai Road, Suzhou 215123, China; E-mail: [email protected]
tral to but dispensable for megakaryocytopoiesis [5,6]. Multiple transcription factors, including Runt-related transcription factor 1 (RUNX1), GATA binding protein 1 (GATA1), Friend leukemia virus integration 1 (Fli1), and transcriptional activator Myb (c-Myb), regulate megakaryocyte differentiation. GATA-1, the master regulator of hematopoiesis, plays a critical role in megakaryocyte differentiation by functioning either as an activator or repressor, depending on the protein complex [7]. A recent study demonstrates that GATA-1 directly activates transcription of genes encoding the essential autophagy component microtubule-associated protein 1 light chain 3B (LC3B) and its homologues [8]. Autophagy is an evolutionary conserved metabolic and remodeling process that is executed by a series of autophagy related genes (ATGs) [9,10]. Deletion of Atg7 in hematopoietic stem cells results in failure to maintain an HSC pool and in the development of myeloid malignancies [11]. Mice lacking Atg7 in the hematopoietic system develop severe anemia. Atg7/ erythrocytes accumulate damaged mitochondria with altered membrane potential, leading to cell death. Deficiency of Atg7 also led to severe lymphopenia as a result of mitochondrial damage, followed by apoptosis in mature T lymphocytes [10]. A recent study showed that human platelets express Atg5, Atg7, and LC3. Similar to nucleated mammalian cells, autophagy
0301-472X/Copyright Ó 2015 ISEH - International Society for Experimental Hematology. Published by Elsevier Inc. http://dx.doi.org/10.1016/j.exphem.2015.01.001 EXPHEM3223_proof ■ 21-4-2015 9-10-28
2
Y. Cao et al./ Experimental Hematology 2015;-:-–-
in human platelets was stimulated by cell starvation or rapamycin in a phosphatidylinositol 3-kinase–dependent manner. Disruption of autophagic flux led to impairment of platelet aggregation and adhesion. Furthermore, monoallelic deletion of Becn1 in mice displayed a prolonged bleeding time and reduced platelet aggregation. These results suggest that platelets may require a Becn1dependent autophagy [12]. Hemostasis depends on functional platelets, which are produced by megakaryocytes requiring normal megakaryopoiesis, megakaryocyte differentiation, and thrombopoiesis. In this study, we examine the role of autophagy during in vivo megakaryopoiesis, megakaryocyte differentiation, and thrombopoiesis using hematopoietic system conditional knockout mice. The Atg7-deficient mice displayed aberrant megakaryogenesis, megakaryocyte differentiation, and thrombopoiesis from hematopoietic progenitors and ultimately failed platelet production and hemostasis.
Materials and methods Materials Suppliers were: phycoerythrin (PE)-labeled JON/A antibody supplied by Emfret (Eibelstadt, Germany); PE-conjugated antiP-selectin antibody, anti-CD41-FITC, and anti-CD61-PE supplied by eBioscience (San Diego, CA); MitoTracker Green and MitoSox Red supplied by Invitrogen (Carlsbad, CA). Generation of Atg7f/f;Vav-Cre mice Atg7Flox/Flox mice (from RIKEN BioResource Center, Ibaraki, Japan) were crossed to Vav-Cre mice (Jackson Laboratory, Sacramento, CA) to obtain Atg7f/f;Vav-Cre. Genotyping was performed on tail genomic DNA as described previously [13,14]. Male and female mice were used equally in all experiments. Each group contained at least six mice. All experiments with animals complied with the institutional protocols on animal welfare and were approved by the Ethics Committee of Soochow University, China. Polymerase chain reaction genotyping The final polymerase chain reaction (PCR) volume was 20 mL, and PCR was performed as follows: 1 cycle of 94 C for 5 min, 35 cycles of 94 C for 30 sec, 60 C or 64 C for 30 sec, 72 C for 40 sec or 2 min, and 1 cycle of 72 C for 5 min. After gel electrophoresis, the wild-type (WT) band of Atg7f/f was detected at 653 bp, and the mutant band was detected at 426 bp; the WT band of Atg7 knockout band was detected at 1,641 bp, and the knockout (KO) band was detected at 600 bp. The positive band of Vav-Cre was detected at 236 bp. The following primers were used: Atg7-F: CATCTTGTAGCACCTGCTGACCTGG; Atg7-R: CCACTGGC CCATCAGTGAGCATG; LoxP-R: GCGGATCCTCGTATAAT GTATGCTATACGAAGTTAT; Atg7-F2: TGGCTGCTACTTCTG CAATGATGT; Atg7-R2: AAGCCAAAGGAAACCAAGGGAG TG; Vav-F: AGATGCCAGGACATCAGGAACCTG; and Vav-R: ATCAGCCACACCAGACACAGAGATC. Western blotting analyses Isolated bone marrow lineage-negative (Lin) cells were solubilized in 1 lysis buffer (Cell Signaling, Beverly, MA) containing
protease inhibitor (Roche, Basel, Swiss). Cell debris was removed by centrifugation. Thirty micrograms of protein was separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred to a polyvinylidene fluoride (PVDF) membrane (Millipore, Billerica, MA). The membrane was incubated with anti-Atg7, anti–glyceraldehyde 3-phosphate dehydrogenase and anti-LC3 monoclonal antibodies, detected with the enhanced chemiluminescent (ECL) system (Pierce, Waltham, MA). Blood routine examination We added 20 mL mouse peripheral blood into 500 mL CPK-303A solution (37 C), and then routine blood examination was performed using Sysmex KX-21N (Kobe, Japan). Tail bleeding time Mice were anesthetized by intraperitoneal injection of 2, 2, 2-trichloroethan-1, 1-diol (0.1 mL/10 g of body weight), and the distal 3-mm segment of the tail was removed with a scalpel. Time until complete cessation of bleeding was measured. Bleeding was stopped after 20 min if the tail was still bleeding. Flow cytometry and aggregation studies Flow cytometry studies on mouse platelets were performed using platelet-rich plasma prepared from blood obtained into acid-citrate dextrose solution through the inferior vena cava and diluted into Tyrode’s buffer as previously described [15]. Bone marrow or Lin cells were stained with indicated antibodies or dyes and analyzed by BD Calibur cytometer (BD Bioscience, San Diego, CA). Aggregation studies were performed using washed platelets prepared as described previously [16]. Quantitative measurement of acetylcholinesterase activity Acetylcholinesterase (AChE) activity was measured by the microplate method [17]. Briefly, cells (1 103 cells) and platelets (1 105) were suspended with 200 mL of phosphate-buffered saline containing 0.5% of Bovine Serum Albumin (BSA) and seeded in a 96-well plate. We added 50 mL of 0.265 mmol/L 5,50 -dithiobis-2-nitrobenzoic acid (Sigma-Aldrich, St. Louis, MO) containing 1 mol/L Tris (pH 8.0) and 1% Triton X-100 (Sigma-Aldrich); then, the optical density (OD) was measured at 405 nm using automatic colorimeter (OD405[A]). We then added 15 mL of 10 mmol/L acetylthiocholine iodide (Sigma-Aldrich). Optical density was again measured at 405 nm after 30 min (OD405[B]). Specific AChE activity (DOD405) was calculated by OD405[B]-OD405[A]. Cell cycle analysis Bone marrow Lin- cells were cultured with TPO and stem cell factor (SCF) for 4 days and then harvested. After centrifugation, cells were fixed in 70% ice-cold ethanol at 4 C overnight and then incubated with propidium iodide staining solution containing 50 mg/mL propidium iodide and 20 mg/mL RNase at room temperature for 30 min before analysis by flow cytometry. Isolation of lineage negative cells Bone marrow cells were stained with biotin antibodies specific for the following lineage markers: CD5, CD45R (B220), CD11b, Anti-Gr-1(Ly-6G/C), and Ter119. To obtain Lin cells, Linþ cells were depleted using anti-biotin microbeads (Miltenyi Biotec, Bergisch Gladbach, Germany).
EXPHEM3223_proof ■ 21-4-2015 9-10-29
Y. Cao et al./ Experimental Hematology 2015;-:-–-
Megakaryocyte purification and culture Mature megakaryocytes from BM cells were defined using the standard method [18] with some modifications. Briefly, BM cells were obtained from femora and tibiae of C57BL6 mice by flushing, and lineage positive cells were depleted using immunomagnetic beads (Miltenyi Biotec). The remaining population was cultured in 2.6% serum-supplemented Roswell Park Memorial Institute 1640 medium with 2 mmol/L L-glutamine, penicillin/streptomycin, and 20 ng/mL murine SCF at 37 C under 5% CO2 for 2 days. Cells were then cultured for an additional 4 days in the presence of 20 ng/mL murine SCF and 100 ng/mL murine TPO [19,20]. Wright-Giemsa staining Morphology of megakaryocytes was evaluated by Wright-Giemsa staining. Briefly, cytospin preparations were incubated sequentially in solution A for 1 min and solution B for 7 min and washed with water, air-dried, and then examined under an Olympus Microscope (Tokyo, Japan). Statistical analysis Statistical analyses were performed with a two-tailed unpaired t test. We considered p ! 0.05 to indicate statistical significance.
Results Generation of Atg7-deficient mouse strains To investigate the physiologic roles of autophagy in mammalian hematopoietic system, we generated a hematopoietic conditional Atg7 knockout mouse model (Atg7f/f; Vav-Cre, hereafter referred to as Atg7/) by breeding the Atg7f/f mice with Vav-Cre transgenic mice that the expression of Cre recombinase restricted to hematopoietic cells [21,22]. Homozygous Atg7/ mice were viable but infertile and were born at Mendelian frequency from intercrosses of heterozygous parents (Atg7f/þ;Vav-Cre, hereafter referred to as Atg7þ/). The results of PCR genotyping are shown in Figure 1A. The lack of Atg7 protein in the Atg7/ cells was also confirmed by Western blot analysis (Fig. 1B). We also tested autophagy activity by examining the two forms of LC3 in the BM Lin cells. Unlike in WT and Atg7þ/ Lin cells, LC3-II is no longer formed in Atg7/ Lin cells due to Atg7 deletion–caused disruption of LC3 lipidation, demonstrating a successful loss of autophagy in hematopoietic cells. Abnormal platelet production in Atg7/ mice The blood count revealed that the number of platelets in the peripheral blood of Atg7/ mice was significantly decreased compared with WT mice (Fig. 1C). The platelet size (mean platelet volume) was increased, and the large platelet (platelet-large cell ratio, P-LCR) was only observed in Atg7/ peripheral blood (Fig. 1D). These data suggest a critical role of autophagy in normal platelet production. Atg7/ mice display a defect in platelet activation To assess whether the observed platelet changes in peripheral blood of Atg7/ mice result in functional aberrations
3
of platelet biology, we assessed the bleeding time and platelet aggregation in Atg7/ mice. The bleeding time was significantly longer, and thrombin-induced platelet aggregation was severely decreased in Atg7/ compared with WT mice and Atg7þ/ heterozygous mice, although the Atg7þ/ heterozygous mice displayed a longer bleeding time than the WT mice (Fig. 1E and 1F). The P-selectin (CD62P) level and activation of integrin aIIbb3 (JON/A), two markers for platelet activation and aggregation, were also decreased in both Atg7/ and Atg7þ/ mice as compared with WT mice (CD62P: WT 14.5 6 0.09, Atg7þ/ 11.17 6 0.06, Atg7/ 3.2 6 0.03, p ! 0.01; aIIbb3: WT 48.1 6 0.1, Atg7þ/ 13.5 6 0.1, Atg7/ 5.9 6 0.2, p ! 0.01; Fig. 1G and 1H). These results indicate the important role of Atg7 in platelet activation and hemostasis. Autophagy deficiency leads to impeded megakaryocyte differentiation To determine whether the dysfunction of platelets was a consequence of the impairment in their upstream event, i.e., abnormal differentiation of megakaryocytes, we defined the bone marrow megakaryocytes in WT, Atg7þ/, and Atg7/ mice by CD41þCD61þ cell population and AChE activity, a marker of murine megakaryocytic cells. The percentage of CD41þCD61þ cells was decreased in Atg7/ bone marrow cells (Fig. 2A), which was associated with increased apoptosis and necrosis, shown by flow cytometric data measured with Annexin-V (Fig. 2B). Histopathologic examination of the bone marrow and spleen from WT, Atg7þ/, and Atg7/ mice by hematoxylin-eosin (H&E) staining showed that the number of autophagydefective megakaryocytes from bone marrow, but not spleen, was greatly decreased (Fig. 2C), supporting the above cytometric data. In megakaryopoiesis, HSCs differentiate into megakaryocytes through their committed progenitors. To obtain megakaryocytic progenitor cells, Linþ bone marrow cells from mice were depleted by immunomagnetic beads, and the Lin bone marrow cells were cultured in the medium supplied with murine SCF for 2 days, then cultured for an additional 4 days in the presence of murine SCF and murine TPO. In mice lacking hematopoietic autophagy, both the Lin cells stimulated by TPO and the platelets collected through the inferior vena cava had significantly lower AChE activity compared with WT mice (Fig. 2D). In the presence of murine TPO, many enlarged megakaryocytic cells were observed on day 3 in WT compared with few in Atg7/ group. Microscopic examination of cytospin samples revealed that megakaryocytes in Atg7/ mice had aberrant nongrained cytoplasm characterized by numerous vacuoles (Fig. 2E). To evaluate megakaryocyte differentiation from common myeloid progenitors, we used CD41/forward-scatter (FSC) dot plot to identify megakaryocyte population. CD41 is the lineage marker to identify megakaryocytes, and FSC properties distinguish cells on the basis of size. After differentiation,
EXPHEM3223_proof ■ 21-4-2015 9-10-29
Y. Cao et al./ Experimental Hematology 2015;-:-–-
web 4C=FPO
4
Figure 1. Autophagy deficiency results in impaired thrombopoiesis and platelet function. (A) Genomic DNA PCR using the Atg7, KO, and Vav primers confirmed the structure of Atg7 allele for WT and knockout, respectively. (B) Western blotting analysis of Atg7 and LC3-I/II protein expression. No Atg7 and LC3-II protein were detected in the Atg7-deficient mouse BM Lin cells with either antibody. Glyceraldehyde 3-phosphate dehydrogenase was used as a loading control. (C, D) Aberrant platelet production in Atg7-defective mice. The number and size of platelets in the peripheral blood were detected by blood count and flow cytometry in WT (n 5 12), Atg7þ/ (n 5 12), and Atg7/ (n 5 8) animals. (E) Bleeding time was determined as the interval until bleeding stopped in WT (n 5 12), Atg7þ/ (n 5 5), and Atg7/ (n 5 9) mice. (F) Representative aggregation tracing and combined results from WT, Atg7þ/, and Atg7/ mice show the aggregation defect in Atg7-deficient platelets using thrombin (0.2 U/mL; n $ 4). (G, H) Atg7-deficient platelets have a defect in activation of CD62P and aIIbb3 by thrombin detected by the JON/A activation dependent antibody in WT, Atg7þ/, and Atg7/ mice (n $ 4). All data are from three independent experiments. *p ! 0.05; **p ! 0.01. GAPDH 5 glyceraldehyde 3-phosphate dehydrogenase; MPV 5 mean platelet volume; PLT 5 platelet; P-LCR 5 platelet-large cell ratio.
CD41þ with a high level of FSC was observed in WT cells, whereas only a low level of CD41þFSChigh cells were seen in the Atg7/ mice (Fig. 2F). Autophagy deficiency leads to mitochondrial and cell cycle dysfunction of hematopoietic progenitors Failure to remove mitochondria and loss of control of reactive oxygen species contribute to differentiation failure
in erythroid maturation [10]. Lin cells were therefore stained with MitoTracker Green or MitoTracker Deep Red or measured for mitochondrial genome abundance by quantitative PCR, all indicators of mitochondrial mass (Fig. 3A–3C), and also stained with MitoSOX, a mitochondrial superoxide indicator (Fig. 3D). Indeed, Atg7/ bone marrow Lin cells showed accumulated mitochondria mass and displayed increased mitochondrial superoxide
EXPHEM3223_proof ■ 21-4-2015 9-10-29
5
web 4C=FPO
Y. Cao et al./ Experimental Hematology 2015;-:-–-
Figure 2. Autophagy deficiency leads to impeded megakaryocyte differentiation. (A) Flow-cytometric analysis of mouse bone marrow cells stained with anti-CD41-FITC and anti-CD61-PE conjugate. The percentage of CD41þ/CD61þ cells was quantified (right panel). (B) Cell death analysis on bone marrow CD41þ/CD61þ cell population. Representative flow plots measured with Annexin-V (left panel) and statistic result (right panel). (C) Histopathologic examination by hematoxylin and eosin staining in WT, Atg7þ/, and Atg7/ mice. * Megakaryocyte in the bone marrow of the Atg7/ mice. (D) Specific AChE activity of TPO-induced BM Lin cells and peripheral platelets were estimated by a quantitative method of AChE activity. (E) Megakaryocyte differentiation was induced for 4 days in mouse Lin progenitors. Photographs show cytospin examples of WT as well as of aberrant Atg7/ megakaryocytes (upper panel). These cells were stained by Wright-Giemsa. (F) Megakaryocyte differentiation was induced for 4 days in Lin BM cells and analyzed using gates suited to FSC (size) and CD41 expression level (fluorescence) of megakaryocytes. All data are from three independent experiments (n $ 4). *p ! 0.05; **p ! 0.01. FITC 5 fluorescein isothiocyanate; PI 5 Propidium Iodide.
production as compared with WT Lin cells (Fig. 3A–3D). Cell cycle analysis showed that Atg7 deficiency caused apoptosis and fewer progenitor cells in diploidy and polyploidy (Fig. 3E).
Discussion Megakaryocytes residing in the bone marrow are the source of platelets. Platelet production depends on successful megakaryopoiesis and megakaryocyte differentiation, which are identified by development of common myeloid progenitors with potential to commit to megakaryocytes as well as megakaryocyte polyploidization and maturation. In the final stage of megakaryocyte differentiation, megakaryo-
cytes in bone marrow extend and release long, branched proplatelets into sinusoidal blood vessels, which undergo repeated abscissions to yield circulating platelets [23]. Fragmentation of proplatelets occurs exclusively in the blood circulation; otherwise, platelets would remain trapped in the marrow [23]. Ex vivo pharmacologic inhibition of autophagy in human platelets impairs platelet function, and monoallelic nontissue specific deletion of Becn1 of mice demonstrates a role of Becn1-dependent autophagy in platelet function [12]. However, platelet impairment may also be attributable to other causes, since absence of nonconditional Becn1 may lead to other adverse effects on cell function. Using a conditional mouse model in which autophagy-essential gene Atg7 is exclusively deleted in the
EXPHEM3223_proof ■ 21-4-2015 9-10-30
Y. Cao et al./ Experimental Hematology 2015;-:-–-
web 4C=FPO
6
Figure 3. Autophagy deficiency leads to mitochondrial and cell-cycle dysfunction of hematopoietic progenitors. (A, B) BM Lin cells from WT and Atg7/ mice were stained with (A) MitoTracker Green or (B) MitoTracker Deep Red. (C) Relative mDNA/nDNA ratios in WT, and Atg7/ Lin cells. The mDNA/ nDNA ratios were quantified (right panel). (D) BM Lin cells from WT or Atg7/ mice were stained with MitoSOX. (E) Cell cycle distribution in BM Lin Cells treated with TPO and SCF for 4 days. All data are from three independent experiments (n $ 4). *p ! 0.05; **p ! 0.01. AP 5 apoptosis; mDNA 5 mitochondrial DNA; nDNA 5 nuclear DNA; PI 5 Propidium Iodide.
hematopoietic system, we found a severe loss of platelets in peripheral blood (Fig. 1C); meanwhile, the platelet size in the Atg7-deficient mice was significantly increased compared with that of littermate controls, indicating that Atg7 deficiency in the hematopoietic system alters platelets both in number and size (Fig. 1D). In term of irregular platelet size, loss of Atg7 may cause a failure in abscission, leading to the accumulation of premature or large platelets. As platelet number and size are inversely proportional, our data suggest that platelet reduction in number in Atg7/ mice may be caused at least in part by formation of macrothrombocytopenias, which represent a failure in the intermediate stages of platelet production [24]. A low count and larger size for platelets are associated with platelet dysfunction. In this study, we found that deficiency of Atg7 in the hematopoietic system prolongs the tail bleeding times and platelet aggregation induced by reduced thrombin (Fig. 1E and 1F). Moreover, the expression of platelet activation marker CD62P and activated aIIbb3 induced by thrombin was lower in autophagy-defective platelets than in WT and Atg7þ/ ones (Fig. 1G and 1H). Taken together, our data indicate that autophagy is important for platelet production and hemostasis. Our data further demonstrate that autophagy-defective hematopoietic progenitors accumulate aberrant mitochondria and generate increased levels of reactive oxygen species. These cellular disorders of autophagy defect could impair erythropoiesis [10]. Thus, the reduction in the platelet count and the enlargement in platelet size may be caused by aberrant megakaryocyte lineage differentiation. Our notion was confirmed by a decreased number of mega-
karyocytes in Atg7/ bone marrow using CD41 and CD61 markers or H&E staining (Fig. 2A–2C). Additionally, a previous study demonstrated that AChE activity, which exists among the membrane systems such as the Golgi complex, increases gradually during megakaryocyte maturation in the red bone marrow of mouse, rat, and cat [25]. We found that the AChE activity clearly dropped in the platelets and megakaryocyte progenitors lacking autophagy, indicating differentiation blockage in Atg7/ megakaryocyte progenitors (Fig. 2D). Because of the limit imposed by the infrequency of mature megakaryocytes in the bone marrow, we enriched megakaryocytes using hematopoietic progenitor cells (HPCs) obtained from the bone marrow of Atg7/ and WT mice. Significantly fewer numbers of mature megakaryocytes were observed in Atg7/ cultures (Fig. 2E). Autophagy is a solely cellular mechanism capable of cleaning damaged mitochondria, which is often caused by overproduction of reactive oxygen species [26]. Megakaryocytes undergo progressive differentiation while becoming polyploid through endomitosis, and megakaryocyte polyploidy is positively associated with platelet production [27]. How the polyploid cell avoids apoptotic triggers and continues to cycle remains unknown. Our data indicate that autophagy deficiency caused accumulation of mitochondria and mitochondrial superoxide (Fig. 3A–3D) and significant apoptosis (Fig. 3E) in bone marrow Lin cells, suggesting that autophagy prevents apoptosis, secures cell cycle, and confers progenitors to differentiate to megakaryocytes. It should be noted that Atg7 deletion in the present mouse model occurs in hematopoietic stem cells, leading
EXPHEM3223_proof ■ 21-4-2015 9-10-30
Y. Cao et al./ Experimental Hematology 2015;-:-–-
to autophagy defect in the entire hematopoietic system. Thus, a lineage-specific deletion of the Atg gene in megakaryocytes and platelets is needed to better assess intrinsic effects on thrombopoiesis and platelet function. In summary, in the present study, we show that autophagy is essential for megakaryopoiesis, megakaryocyte differentiation, thrombopoiesis, and platelet production. Therefore, autophagy may serve as a suitable target for megakaryocyte/platelet disorders in clinical conditions.
Acknowledgments This work was supported by grants from the National Natural Science Foundation of China (nos. 31071258, 81272336, and 31201073), the National Basic Research Program from The Ministry of Science and Technology of China (no. 2011CB512101), the Department of Science and Technology of Jiangsu Province of China (no BK20130333), and a project funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions. Conflict of interest disclosure: No financial interest/ relationships with financial interest relating to the topic of this article have been declared.
References 1. Kondo M, Wagers AJ, Manz MG, et al. Biology of hematopoietic stem cells and progenitors: Implications for clinical application. Annu Rev Immunol. 2003;21:759–806. 2. Bluteau D, Lordier L, Di Stefano A, et al. Regulation of megakaryocyte maturation and platelet formation. J Thromb Haemost. 2009;7: 227–234. 3. Machlus KR, Italiano JE Jr. The incredible journey: From megakaryocyte development to platelet formation. J Cell Biol. 2013;201: 785–796. 4. Machlus KR, Thon JN, Italiano JE Jr. Interpreting the developmental dance of the megakaryocyte: A review of the cellular and molecular processes mediating platelet formation. Br J Haematol. 2014;165: 227–236. 5. Murone M, Carpenter DA, de Sauvage FJ. Hematopoietic deficiencies in c-mpl and TPO knockout mice. Stem Cells. 1998;16:1–6. 6. Ng AP, Hauppi M, Metcalf D, et al. Mpl expression on megakaryocytes and platelets is dispensable for thrombosis but essential to prevent myeloproliferation. Proc Natl Acad Sci U S A. 2014;111: 5884–5889. 7. Martin F, Prandini MH, Thevenon D, Marguerie G, Uzan G. The transcription factor GATA-1 regulates the promoter activity of the platelet glycoprotein IIb gene. J Biol Chem. 1993;268:21606–21612. 8. Kang YA, Sanalkumar R, O’Geen H, et al. Autophagy driven by a master regulator of hematopoiesis. Mol Cell Biol. 2012;32:226–239.
7
9. Levine B, Klionsky DJ. Development by self-digestion: molecular mechanisms and biological functions of autophagy. Dev Cell. 2004; 6:463–477. 10. Mortensen M, Ferguson DJP, Edelmann M, et al. Loss of autophagy in erythroid cells leads to defective removal of mitochondria and severe anemia in vivo. Proc Natl Acad Sci U S A. 2009;107:832–837. 11. Mortensen M, Soilleux EJ. The autophagy protein Atg7 is essential for hematopoietic stem cell maintenance. J Exp Med. 2011;208:455–467. 12. Feng W, Chang C, Luo D, et al. Dissection of autophagy in human platelets. Autophagy. 2014;10:642–651. 13. Komatsu M, Waguri S, Ueno T, et al. Impairment of starvationinduced and constitutive autophagy in Atg7-deficient mice. J Cell Biol. 2005;169:425–434. 14. De Boer J, Williams A, Skavdis G, et al. Transgenic mice with hematopoietic and lymphoid specific expression of Cre. Eur J Immunol. 2003;33:314–325. 15. Wu Y, Ahmad SS, Zhou J, Wang L, Cully MP, Essex DW. The disulfide isomerase ERp57 mediates platelet aggregation, hemostasis, and thrombosis. Blood. 2012;119:1737–1746. 16. Wu Y, Suzuki-Inoue K, Satoh K, et al. Role of Fc receptor gammachain in platelet glycoprotein Ib-mediated signaling. Blood. 2001; 97:3836–3845. 17. Matsumura-Takeda K, Sogo S, Isakari Y, et al. CD41/CD45 cells without acetylcholinesterase activity are immature and a major megakaryocytic population in murine bone marrow. Stem Cells. 2007;25: 862–870. 18. Mazharian A, Watson SP, Severin S. Critical role for ERK1/2 in bone marrow and fetal liver-derived primary megakaryocyte differentiation, motility, and proplatelet formation. Exp Hematol. 2009;37:1238–1249. 19. Dumon S, Heath VL, Tomlinson MG, Gottgens B, Frampton J. Differentiation of murine committed megakaryocytic progenitors isolated by a novel strategy reveals the complexity of GATA and Ets factor involvement in megakaryocytopoiesis and an unexpected potential role for GATA-6. Exp Hematol. 2006;34:654–663. 20. Dhanjal TS, Pendaries C, Ross EA, et al. A novel role for PECAM-1 in megakaryocytokinesis and recovery of platelet counts in thrombocytopenic mice. Blood. 2007;109:4237–4244. 21. Ogilvy S, Metcalf D, Gibson L, Bath ML, Harris AW, Adams JM. Promoter elements of vav drive transgene expression in vivo throughout the hematopoietic compartment. Blood. 1999;94:1855–1863. 22. Cao Y, Zhang A, Cai J, et al. Autophagy regulates the cell cycle of mouse HSPCs in a nutrient-dependent manner. Exp Hematol. 2015; 43:229–242. 23. Junt T, Schulze H, Chen Z, et al. Dynamic visualization of thrombopoiesis within bone marrow. Science. 2007;317:1767–1770. 24. Thon JN, Italiano JE Jr. Does size matter in platelet production? Blood. 2012;120:1552–1561. 25. Rata S, Wesemann W, McDonald TP. Isolation of mouse megakaryocytes. I. Separation of two fractions enriched in different maturational stages. Eur J Cell Biol. 1985;37:111–116. 26. Moore MN. Autophagy as a second level protective process in conferring resistance to environmentally-induced oxidative stress. Autophagy. 2008;4:254–256. 27. Geddis AE. Megakaryopoiesis. Semin Hematol. 2010;47:212–219.
EXPHEM3223_proof ■ 21-4-2015 9-10-31
