This article was downloaded by: [North Carolina State University] On: 01 January 2015, At: 17:04 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK
Veterinary Quarterly Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/tveq20
Loop-mediated isothermal amplification (LAMP) test for specific and rapid detection of Brucella abortus in cattle a
a
a
a
a
a
K. Karthik , Rajesh Rathore , Prasad Thomas , T.R. Arun , K.N. Viswas , R.K. Agarwal , b
H.V. Manjunathachar & Kuldeep Dhama
c
a
Division of Bacteriology and Mycology, Indian Veterinary Research Institute, Bareilly, India b
Division of Parasitology, Indian Veterinary Research Institute, Bareilly, India
c
Division of Pathology, Indian Veterinary Research Institute, Bareilly, India Accepted author version posted online: 15 Sep 2014.Published online: 10 Oct 2014.
Click for updates To cite this article: K. Karthik, Rajesh Rathore, Prasad Thomas, T.R. Arun, K.N. Viswas, R.K. Agarwal, H.V. Manjunathachar & Kuldeep Dhama (2014) Loop-mediated isothermal amplification (LAMP) test for specific and rapid detection of Brucella abortus in cattle, Veterinary Quarterly, 34:4, 174-179, DOI: 10.1080/01652176.2014.966172 To link to this article: http://dx.doi.org/10.1080/01652176.2014.966172
PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http:// www.tandfonline.com/page/terms-and-conditions
Veterinary Quarterly, 2014 Vol. 34, No. 4, 174 179, http://dx.doi.org/10.1080/01652176.2014.966172
ORIGINAL ARTICLE Loop-mediated isothermal amplification (LAMP) test for specific and rapid detection of Brucella abortus in cattle K. Karthika, Rajesh Rathorea, Prasad Thomasa, T.R. Aruna, K.N. Viswasa, R.K. Agarwala, H.V. Manjunathacharb and Kuldeep Dhamac* a
Division of Bacteriology and Mycology, Indian Veterinary Research Institute, Bareilly, India; bDivision of Parasitology, Indian Veterinary Research Institute, Bareilly, India; cDivision of Pathology, Indian Veterinary Research Institute, Bareilly, India
Downloaded by [North Carolina State University] at 17:04 01 January 2015
(Received 14 March 2014; accepted 11 September 2014) Background: Brucella abortus, the major causative agent of abortion in cattle and a zoonotic pathogen, needs to be diagnosed at an early stage. Loop-mediated isothermal amplification (LAMP) test is easy to perform and also promising to be adapted at field level. Objective: To develop a LAMP assay for specific and rapid detection of B. abortus from clinical samples of cattle. Methods: LAMP primers were designed targeting BruAb2_0168 region using specific software tool and LAMP was optimized. The developed LAMP was tested for its specificity with 3 Brucella spp. and 11 other non-Brucella spp. Sensitivity of the developed LAMP was also carried out with known quantity of DNA. Cattle whole blood samples and aborted fetal stomach contents were collected and used for testing with developed LAMP assay and results were compared with polymerase chain reaction (PCR). Results: The developed LAMP assay works at 61 C for 60 min and the detection limit was observed to be 100-fold more than the conventional PCR that is commonly used for diagnosis of B. abortus. Clinical sensitivity and specificity of the developed LAMP assay was 100% when compared with Rose Bengal plate test and standard tube agglutination test. SYBÒ green dye I was used to visualize the result with naked eye. Conclusion: The novelty of the developed LAMP assay for specifically detecting B. abortus infection in cattle along with its inherent rapidness and high sensitivity can be employed for detecting this economically important pathogen of cattle at field level as well be exploited for screening of human infections. Keywords: cattle; cow; Brucella abortus; LAMP; BruAb2_0168; whole blood
1. Introduction Brucellosis is a notable disease of animals prevalent throughout the world and it is zoonotic as well. Brucella abortus is one of the major abortion-causing agents in case of cattle population (Priyantha 2011). Each country employs different strategies to control this important disease from their cattle herd. To control a disease, accurate early detection of the pathogen is very important. With the advancements in science, various diagnostic techniques are available now for B. abortus, but still the basic bacteriological techniques remain as the standard testing options since serological and molecular assays have some limitations. Though there are lots of techniques available nowadays to diagnose brucellosis, definitive diagnosis still requires isolation and identification of the causative organism (Alton et al. 1988; Parida et al. 2008; Dhama et al. 2014). Basic bacteriological technique being used as gold standard requires lot of skill to purely isolate the organism and is also time consuming as the organism takes 2 3 days to grow. Other major disadvantages with these conventional techniques are that these are less sensitive when the pathogen load is low in the sample and that the organism is zoonotic in nature so need to be handled in biosafety cabinet 3 (Pike et al. 1965; Perez-Sancho et al. 2013). Serological techniques for detecting brucellosis are quite easy compared to the bacterial isolation as *Corresponding author. Email: [email protected] Ó 2014 Taylor & Francis
these take lesser time and can be employed for mass screening of animals (Chand & Sharma 2004). The major drawback with serological techniques like Rose Bengal plate test (RBPT) and standard tube agglutination test (STAT) are, they are not always specific as the antibodies can cross-react with other gram-negative bacteria like Yersinia enterocolitica serotype O:9 and Francisella spp. (Garin-Bastuji et al. 1999; Yu & Nielsen 2010). Further, these tests are not of high value in detecting infection at early stages since generation of antibodies requires some time. DNA detection methods like polymerase chain reaction (PCR) and its various versions are commonly used these days for detecting Brucella species as these are easy to perform, sensitive and specific but requirement of sophisticated instruments and post-amplification procedures make these impractical to be adapted at field level (Ilhan et al. 2008; Marianelli et al. 2008; Song et al. 2012). Accurate diagnosis of brucellosis at field level is of prime importance but due to the disadvantages of the existing assays, there is requirement of a specific, sensitive and reliable assay that can replace commonly employed serological assays. Loop-mediated isothermal amplification (LAMP) is one such technique having all the qualities for a field-level assay. LAMP assay has the advantage of working at constant temperature which eliminates the need for costly
Downloaded by [North Carolina State University] at 17:04 01 January 2015
Veterinary Quarterly instruments and its results can be viewed directly with no post-amplification protocols. It has higher sensitivity and specificity compared to PCR and hence can be used as a valuable diagnostic tool at field level (Notomi et al. 2000; Nagamine et al. 2002; Dhama et al. 2014). To our knowledge, there are only seven reports regarding detection of Brucella spp. using LAMP (Ohtsuki et al. 2008; Lin et al. 2011; Pan et al. 2011; Song et al. 2012; Perez-Sancho et al. 2013; Soleimani et al. 2013; Karthik et al. 2014a), but there is no report to date regarding development of a LAMP assay detecting specifically the B. abortus species. Keeping this in view, the present study was constructed to develop a LAMP assay to specifically detect B. abortus targeting BruAb2_0168 region and evaluate its diagnostic potential by comparing the results with commonly used PCR and serological tests. The sensitivity and specificity of the developed LAMP assay were also assessed by screening of whole blood samples (n D 200) of cattle for the presence of B. abortus. Results obtained were promising that the developed LAMP can be used under field conditions for specific detection of B. abortus from cattle and also this specific LAMP can serve as the first step towards development of a multiplex LAMP for Brucella spp. 2. Materials and methods 2.1. Bacterial strains used Three major Brucella species, namely B. abortus, B. meltensis and B. suis, were used in this study along with 11 other non-Brucella strains. The bacterial species used in the study were obtained from various laboratories of Indian Veterinary Research Institute and are enlisted in Table 1. DNA template from these isolates was extracted by Rodriguez et al.’s (1997) protocol. 2.2.
Design and optimization of LAMP
LAMP primers, namely F3, B3, FIP and BIP, were designed using primer explorer online software version 4 by targeting
175
conserved BruAb2_0168 region of B. abortus (sequence accession number AE017224.1). The primers used in the study are presented in Table 2. LAMP assay was optimized for different concentrations of MgSO4 (2 8 mM), dNTPs (0.8 1.4 mM), and betaine (0.6 1.4 M) and also the effect of different amplification temperatures (60 66 C) and time (30 90 min) were assessed. In brief, the final reaction mixture for the LAMP contained 5 pM of each outer primer (F3 and B3) and 50 pM of each inner primer (FIP and BIP). Other components comprised 2.5 ml of 10£ Thermopol buffer (1£ buffer comprised 25 mM Tris-HCl pH 8.8, 12.5 mM KCl, 12 mM (NH4)2SO4 and 0.125% Tween 20 (New England Biolabs, USA)), 8 mM MgSO4, 1.4 mM dNTPs and 1 M betaine, and the reaction mixture was adjusted to 22 ml with sterile nuclease free water (NFW). Then, 2 ml of standard B. abortus S99 DNA template and 1 ml Bst DNA polymerase (8 units) were added to the reaction mixture which was followed by incubation at 61 C for 60 min. The reaction was terminated by heating at 95 C for 5 min. NFW was used as a negative control while DNA from known standard strain (B. abortus S99) was used as a positive control in each run. Gel electrophoresis with 2% agarose was conducted to visualize the typical ladder like pattern using 5 ml of LAMP product. To confirm the LAMP product as of B. abortus, sequencing was carried out using F3 and B3 primers. LAMP products were also visualized by using 1 ml of SYBR green dye I (1000£ concentration, Sigma, USA).
2.3.
Analytical specificity and sensitivity of LAMP
Analytical specificity of LAMP assay was evaluated by using the three major Brucella species and also 11 other non-Brucella species (Table 1). Analytical sensitivity of LAMP test was carried out by performing optimized LAMP reaction with serially diluted (10-fold) B. abortus S99 DNA. The initial concentration of purified DNA was estimated using Nanodrop to be having 700 ng/ml
Table 1. Bacterial isolates used in the study. S. No 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
Bacterial isolates (collection code) Brucella abortus S19 (vaccine strain) Brucella abortus S99 (diagnostic reference strain) Brucella melitensis 16M (ATCC 23546) Brucella melitensis field isolate Brucella suis (1330) Escherichia coli (ATCC 25922) Salmonella Typhimurium (MTCC 3219) Yersinia enterocolitica (MTCC 4858) Pasteurella multocida B:2 Clostridium chauvoei (ATCC 10092) Clostridium perfringens Staphylococcus aureus field isolate Campylobacter jejuni field isolate 1 Campylobacter jejuni field isolate 2 Listeria monocytogenes (MTCC 1143) Shigella flexneri (MTCC 1457)
Source
LAMP result
Division of Biological Standardization, IVRI Division of Biological Standardization Division of Veterinary Public Health, IVRI General Bacteriology Lab, IVRI Division of Veterinary Public Health ATCC MTCC MTCC Division of Bacteriology and Mycology, IVRI Division of Bacteriology and Mycology Division of Bacteriology and Mycology General Bacteriology Lab Division of Veterinary Public Health Division of Veterinary Public Health MTCC MTCC
ATCC: American type culture collection; IVRI: Indian Veterinary Research Institute; MTCC: microbial type culture collection.
C C ¡ ¡ ¡ ¡ ¡ ¡ ¡ ¡ ¡ ¡ ¡ ¡ ¡ ¡
176
K. Karthik et al. Table 2. LAMP primers used in the study. S. No
Name
1 2 3 4
F3 B3 FIP BIP
Sequence (50 30 )
Base pair length
GGGTGGAACGACCTTTGC ATTGCCACCAATCTCTCCG CAAAACCTTGGCTGTCACCGCTTGGC AGTCTGGTGCAGAA CGGTACGACCACGGTGTCGACACCGC TATTCACCGTCAC
18 19 40 39
(Thermo Scientific, USA). Optimized conditions for the LAMP assay as mentioned above were followed during these reactions.
Downloaded by [North Carolina State University] at 17:04 01 January 2015
2.4.
Analysis of clinical samples
A total number of 200 whole blood samples as well as respective serum samples of cattle suspected from Brucellosis were collected from different parts of Uttar Pradesh and Tamil Nadu (India). Additionally, 10 aborted fetal stomach contents were also collected from Bareilly region of Uttar Pradesh. All the 210 samples were subjected for B. abortus detection using PCR and the developed LAMP assay. DNA from the 200 whole blood samples was extracted using modified protocol of Sambrook and Russell (2001) and from the 10 aborted stomach contents, DNA was extracted using the protocol of Rodriguez et al. (1997). PCR testing of all the 210 DNA samples was carried out using B. abortus specific primers targeting IS711 gene having an amplicon size of 498 bp (Bricker & Halling 1994; Doust et al. 2007). PCR was standardized with an initial denaturation at 95 C for 10 min followed by 35 cycles of denaturation (94 C for 1 min), annealing (58 C for 1 min) and extension (72 C for 1 min), and a final extension at 72 C for 7 min. Analytical sensitivity of the PCR test was performed using standard B. abortus S99 DNA and the results compared with those of the LAMP. Serum samples (n D 200) were subjected to RBPT and STAT according to the standard protocols described by Alton et al. (1975) for the detection of Brucella antibodies. The clinical sensitivity and specificity of the LAMP test was determined by comparing with serological tests.
3. Results 3.1.
Figure 1. Temperature gradient results. Lanes 1 7: 60, 61, 62, 63, 64, 65 and 66 C. M-100 bp ladder.
UV light in positive reaction. The optimized reaction did not yield positivity to the 11 non-Brucella spp. and also to Brucella species other than B. abortus (B. meltensis and B. suis), proving the self-designed primers to be specific for B. abortus (Table 1 and Figure 2). The detection limit of LAMP targeting BruAb2_0168 region was 7 pg/ml of DNA and that of IS711 PCR was 700 pg/ml (Figure 3). 3.2.
Analysis of clinical samples
Among the 200 whole blood samples, 12 samples were found positive for B. abortus by the developed LAMP assay, whereas IS711 PCR assay detected only 11 samples as positive. Both serological assays (RBPT and STAT) revealed the same 12 samples positive by LAMP to be positive and rest samples to be negative for Brucella antibodies. There was homology of the positive samples detected by different assays. Among the 10 aborted foetal stomach content, 5 samples were positive for B. abortus by both LAMP and PCR assay. Clinical sensitivity and specificity of the developed LAMP assay was 100% when compared with RBPT and STAT.
Optimization of LAMP assay conditions, analytical sensitivity and specificity
LAMP reaction conditions were standardized to find out the optimum temperature, time, dNTPs concentration, MgSO4 and betaine. The electrophoretic analyses of the optimized LAMP reaction at various conditions showed typical ladder like pattern as presented in Figure 1. The optimized LAMP assay completed the reaction in 60 min at 61 C. The sequence results revealed 100% homology only with B. abortus when these were analyzed by BLAST tool (data not shown). The LAMP reaction results were visible under naked eye with the addition of SYBR green showing green color in positive and orange in negative sample. Similarly, there was green fluorescence under
4. Discussion Bovine brucellosis usually caused by B. abortus is a major concern to cattle owners as it causes abortion, is an economically important disease and has high public health concerns (Buyukcangaz & Sen 2007). Early diagnosis of this zoonotic disease is important to check its spread between animals as well as to humans. Presently, several different assays including basic bacteriological, serological and molecular tools are used for the diagnosis of brucellosis but still the gold standard test remains isolation and identification of the organism (Araj 2010). Isolation of organism requires high precautions, consumes time and
Downloaded by [North Carolina State University] at 17:04 01 January 2015
Veterinary Quarterly
177
Figure 2. Analytical specificity of LAMP. (A) Resolution of LAMP products in agarose gel. Lanes 1 9: E. coli, S. Typhimurium, Y. enterocolitica, P. multocida B:2, C. chauvoei, C. perfringens and S. aureus field isolate, Campylobacter jejuni and Listeria monocytogenes. Lanes 10 and 11: B. abortus S19 and B. abortus S99. Lanes 12 14: B. melitensis 16M, B. melitensis field isolate and B. suis. M100 bp ladder. B Blank. (B) and (C) SYBR green-based detection under day light and UV light, respectively. Tubes 1 8: E. coli, S. Typhimurium, Y. enterocolitica, P. multocida B:2, C. chauvoei, C. perfringens and S. aureus field isolate and Campylobacter jejuni. 9 and 10: B. abortus S19 and B. abortus S99. 11 and 12: B. melitensis 16M and B. suis.
hence cannot be used for mass screening of animals for brucellosis. Similarly, serological techniques lack specificity while molecular techniques, like PCR, need sophisticated instruments (Garin-Bastuji et al. 1999; Dhama et al. 2014; Kumar et al. 2014). Serological techniques are commonly employed in field to screen the animals for brucellosis. Rose Bengal plate agglutination test is one of the prescribed tests to detect brucellosis for international trade as per OIE (2009). As this existing serological assay has disadvantages, a specific, sensitive and reliable LAMP assay was developed in the present study so that it can be applied for mass screening of animals for B. abortus. LAMP assay revolutionized the world of diagnostics by its simplicity, rapidity and applicability at field level for detecting the infectious pathogens (Parida et al. 2005; Parida et al. 2008; Dhama et al. 2014) and has been developed for various pathogens including Brucella spp.
Promising results were obtained in the previous reports of LAMP for detecting Brucella at genus level but a specific LAMP assay for particularly detecting a Brucella spp. has not been reported to date (Ohtsuki et al. 2008; Lin et al. 2011; Pan et al. 2011; Song et al. 2012; Soleimani et al. 2013; Perez-Sancho et al. 2013). Hence, the present research work was designed for species-specific detection of B. abortus, a major pathogen causing abortion in cattle. Species-specific detection of brucellosis using PCR was reported by earlier workers (Hinic et al. 2008). The same target used by Hinic et al. (2008) for B. abortus detection was chosen in the present study to specifically detect the same pathogen. The IS711gene-based LAMP assay has been reported to be developed very recently (Perez-Sancho et al. 2013) detecting Brucella at genus level. However, the LAMP assay developed in the present study could detect specifically Brucella organism at the species level of B. abortus, and not detecting the other two
Figure 3. Analytical sensitivity of LAMP and PCR. (A) Resolution of PCR amplicons in agarose gel. Lanes 1 7: 700 ng/ml DNA, 70 ng, 7 ng, 700 pg, 70 pg, 7 pg and 700 fg. (B) Resolution of LAMP products. Lanes 1 7: 700 ng/ml DNA, 70 ng, 7 ng, 700 pg, 70 pg, 7 pg and 700 fg. M-100 bp ladder. (C) and (D) SYBR green-based detection under day light and UV light, respectively. Tubes 1 7: 700 ng/ml DNA, 70 ng, 7 ng, 700 pg, 70 pg, 7 pg and 700 fg.
Downloaded by [North Carolina State University] at 17:04 01 January 2015
178
K. Karthik et al.
Brucella species (B. melitensis and B. suis) or the 11 nonBrucella species tested. The developed LAMP assay targeting only a single species will be the first step towards developing a multiplex LAMP assay which can differentiate multiple Brucella spp. in a single reaction. The LAMP assay for detecting Brucella genus by Perez-Sancho et al. (2013) could detect 100 fg/ml of DNA but the developed LAMP assay in the present study could detect 7 pg/ml of DNA which is 10-fold lesser but compared to conventional PCR it is 100-fold more sensitive (7 pg/ml vs. 700 pg/ml). Use of loop primers increases the sensitivity of a LAMP assay (Nagamine et al. 2002; Perez-Sancho et al. 2013), and thus the additional usage of loop primers in the presently developed LAMP assay is suggested which could help achieve higher sensitivity for detecting B. abortus. During the present study, problems due to carry over contamination was observed rarely, as a precautionary measure three-room rule has been applied with one room for DNA extraction, one for reaction preparation and one for amplification (Lee et al. 2012), and master mix was made without any DNA template and it was stored at ¡20 C so as to prevent contamination of the chemicals and to save time (Angamuthu et al. 2012). Modifications like agar dye capsule method can be adapted to make the LAMP assay a closed tube system so that it can eliminate product cross contamination (Karthik et al. 2014a). Screening results of the field samples for B. abortus indicated that the developed LAMP assay could detect more positive samples than the conventional PCR. In the present study, since conventional DNA extraction protocol was followed, b-actin primers (Joseph et al. 2010) were used as internal amplification control to rule out the chance of PCR inhibitors. Amplification was noticed with b-actin primers during all the reactions indicating that there were no PCR inhibitors, supporting the fact that LAMP is more sensitive than the conventional PCR as reported by earlier workers (Ohtsuki et al. 2008; Lin et al. 2011; Pan et al. 2011). Whole blood samples were used for the detection of B. abortus in the study as it can be obtained from animals of all sex and age and are also convenient to collect under field conditions for the diagnosis of Brucella spp. Earlier studies have reported the use of whole blood for the detection of brucellosis using PCR (Guarino et al. 2000; Karthik et al. 2014b). Blood was also used by Lin et al. (2011) and Song et al. (2012) for the detection of Brucella spp. using LAMP assay and results were compared with PCR and serological tests. The developed LAMP assay could detect B. abortus within 1 hour of reaction time which is in accordance with earlier reports for the detection of Brucella spp. (Lin et al. 2011; Pan et al. 2011; Song et al. 2012; Perez-Sancho et al. 2013). Compared to conventional PCR and other assays commonly employed for the detection of B. abortus under field conditions, the rapidity of LAMP assay makes it a good assay for early diagnosis. To conclude, the developed LAMP assay detecting the Brucella organism at species level specifically could be applied in testing and screening of the samples for B.
abortus, an important animal pathogen having zoonotic concerns. This B. abortus specific LAMP assay can be used for the development of a multiplex LAMP test that can detect and differentiate multiple Brucella species. Besides having high specificity, the inherent rapidity and sensitivity in detecting pathogens, the results of LAMP assay can be interpreted by naked eye visualization by the addition of SYBR green dye and thus the requirement of sophisticated instruments is eliminated. Lyophilization of the master mix could also enable the end users to just add the DNA sample of a particular pathogen, making the assay highly suitable for field level and commercialization. Acknowledgements The authors are thankful to Indian Veterinary Research Institute for supporting this research.
References Alton GG, Jones LM, Angus RD, Verger JM. 1988. Techniques for the brucellosis laboratory. Paris: Inra Publications. Alton GG, Jones LM, Pietz A. 1975. Laboratory techniques in brucellosis. Geneva: World Health Organization. Angamuthu R, Baskaran S, Gopal DR, Devarajan J, Kathaperumal K. 2012. Rapid detection of the Marek’s disease viral genome in chicken feathers by loop-mediated isothermal amplification. J Clin Microbiol. 50:961 965. Araj GF. 2010. Update on laboratory diagnosis of human brucellosis. Int J Antimicrob Agents. 36:S12 S17. Bricker BJ, Halling SM. 1994. Differentiation of Brucella abortus bv. 1, 2, and 4, Brucella melitensis, Brucella ovis, and Brucella suis bv. 1 by PCR. J Clin Microbiol. 32:2660 2666. Buyukcangaz E, Sen A. 2007. The first isolation of Brucella melitensis from Bovine aborted fetus in Turkey. J Biol Environ Sci. 1:139 142. Chand P, Sharma AK. 2004. Situation of brucellosis in bovines at organized cattle farms belonging to three different states. J Immunol Immunopathol. 6:11 15. Dhama K, Karthik K, Chakraborty S, Tiwari R, Kapoor S, Kumar A, Thomas P. 2014. Loop-mediated isothermal amplification of DNA (LAMP) a new diagnostic tool lights the world of diagnosis of animal and human pathogens: a review. Pak J Biol Sci. 17:151 166. Doust SRH, Ahmadi Z, Ahamdi A, Hajia M, Izadi M, Mobarez AM. 2007. Detection of Brucella abortus by alkB and IS711 based primers. JRMS. 12:62 67. Garin-Bastuji B, Hummel N, Gerbier G, Cau C, Pouillot R, Da Costa M, Fontaine JJ. 1999. Non specific serological reactions in the diagnosis of bovine brucellosis: experimental oral infection of cattle with repeated doses of Yersinia enterocolitica O:9. Vet Microbiol. 66: 223 233. Guarino A, Serpe L, Fusco G, Scaramuzzo A, Gallo P. 2000. Detection of Brucella species in buffalo whole blood by gene-specific PCR. Vet Rec. 147:634 636. Hinic V, Brodard I, Thomann A, Cvetnic Z, Makaya PV, Frey J, Abril C. 2008. Novel identification and differentiation of Brucella melitensis, B. abortus, B. suis, B. ovis, B. canis, and B. neotomae suitable for both conventional and realtime PCR systems. J Microbiol Methods. 75:375 378. Ilhan Z, Aksakal A, Ekin IH, Gulhan T, Solmaz H, Erdenlig S. 2008. Comparison of culture and PCR for the detection of Brucella melitensis in blood and lymphoid tissues of serologically positive and negative slaughtered sheep. Lett Appl Microbiol. 46:301 306. Joseph SJ, Pratt SL, Pavan E, Rekaya R, Duckett SK. 2010. Omega-6 fat supplementation alters lipogenic gene
Downloaded by [North Carolina State University] at 17:04 01 January 2015
Veterinary Quarterly expression in bovine subcutaneous adipose tissue. Gene Regul Syst Bio. 4:91 100. Karthik K, Rathore R, Thomas P, Arun TR, Viswas KN, Dhama K, Agarwal RK. 2014a. New closed tube loop mediated isothermal amplification assay for prevention of product cross contamination. MethodsX. 1:e137 e143. Available from: http://dx.doi.org/10.1016/j.mex.2014.08.009 Karthik K, Rathore R, Thomas P, Elamurugan A, Arun TR, Dhama K. 2014b. Serological and molecular detection of Brucella abortus from Cattle by RBPT, STAT and PCR, and sample suitability of whole blood for PCR. Asian J Anim Vet Adv. 9:262 269. Kumar PP, Agarwal RK, Thomas P, Sailo B, Prasannavadhana A, Kumar A, Kataria JL, Singh DK. 2014. Rapid detection of Salmonella enterica subspecies enterica serovar Typhimurium by loop mediated isothermal amplification (LAMP) test from field chicken meat samples. Food Biotechnol. 28:50 62. Lee PW, Ji DD, Liu CT, Rampao HS, Rosario VE, Lin IF, Shaio MF. 2012. Application of loop-mediated isothermal amplification for malaria diagnosis during a follow-up study in S~ao Tome. Malar J. 11:408. Lin GZ, Zheng FY, Zhou JZ, Gong XW, Wang GH, Cao XA, Qiu CQ. 2011. Loop-mediated isothermal amplification assay targeting the omp25 gene for rapid detection of Brucella spp. Mol Cell Probes. 25:126 129. Marianelli C, Martucciello A, Tarantino M, Vecchio R, Iovane G, Galiero G. 2008. Evaluation of molecular methods for the detection of Brucella species in water buffalo milk. J Dairy Sci. 91:3779 3786. Nagamine K, Hase T, Notomi T. 2002. Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol Cell Probes. 16:223 229. Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, Hase T. 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28:E63. Ohtsuki R, Kawamoto K, Kato Y, Shah MM, Ezaki T, Makino SI. 2008. Rapid detection of Brucella spp. by the loop-mediated isothermal amplification method. J Appl Microbiol. 104:1815 1823. [OIE] World Organization for Animal Health. 2009. Bovine brucellosis, Section 2.4.3. In: Edwards S, editor. OIE manual of standards for diagnostic tests and vaccines. 5th ed. Paris: OIE.
179
Pan W, Wang JY, Shen H, Zhao M, Ju C, Dong X, Yi L, Chen JD. 2011. Development and application of the novel visual loop-mediated isothermal amplification of Omp25 sequence for rapid detection of Brucella sp. J Anim Vet Adv. 10:2120 2126. Parida M, Horioke K, Ishida H, Dash PK, Saxena P, Jana AM. 2005. Rapid detection and differentiation of dengue virus serotypes by a real-time reverse transcription-loop-mediated isothermal amplification assay. J Clin Microbiol. 43:2895 2903. Parida M, Sannarangaiah S, Dash PK, Rao PVL, Morita K. 2008. Loop mediated isothermal amplification (LAMP): a new generation of innovative gene amplification technique; perspectives in clinical diagnosis of infectious diseases. Rev Med Virol. 18:407 421. Perez-Sancho M, Garcıa-Seco T, Arrogante L, Garcıa N, Martınez I, Diez-Guerrier A, Perales A, Goyache J, Domınguez L, Alvarez J. 2013. Development and evaluation of an IS711-based loop mediated isothermal amplification method (LAMP) for detection of Brucella spp. on clinical samples. Res Vet Sci. 95:489 494. Pike RM, Sulkin SE, Schulze ML. 1965. Continuing importance of laboratory-acquired infections. Am J Public Health. 55:190 199. Priyantha MAR. 2011. Identification of biovars of Brucella abortus in aborted cattle and buffaloes herd in Sri Lanka. Vet World. 4:542 545. Rodriguez JC, Fuentes E, Royo G. 1997. Comparison of two different PCR detection methods. Application to the diagnosis of pulmonary tuberculosis. APMIS. 105:612 616. Sambrook J, Russell DW. 2001. Molecular cloning: a laboratory manual. New York (NY): Cold Spring Harbour Laboratories Press. Soleimani M, Shams S, Majidzadeh AK. 2013. Developing a real-time quantitative loop-mediated isothermal amplification assay as a rapid and accurate method for detection of Brucellosis. J Appl Microbiol. 115:828 834. Song L, Li J, Hou S, Li X, Chen S. 2012. Establishment of loopmediated isothermal amplification (LAMP) for rapid detection of Brucella spp. and application to milk and blood samples. J Microbiol Methods. 90:292 297. Yu WL, Nielsen K. 2010. Review of detection of Brucella spp. by polymerase chain reaction. Croat Med J. 51:306 313.
Veterinary Quarterly Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/tveq20
Loop-mediated isothermal amplification (LAMP) test for specific and rapid detection of Brucella abortus in cattle a
a
a
a
a
a
K. Karthik , Rajesh Rathore , Prasad Thomas , T.R. Arun , K.N. Viswas , R.K. Agarwal , b
H.V. Manjunathachar & Kuldeep Dhama
c
a
Division of Bacteriology and Mycology, Indian Veterinary Research Institute, Bareilly, India b
Division of Parasitology, Indian Veterinary Research Institute, Bareilly, India
c
Division of Pathology, Indian Veterinary Research Institute, Bareilly, India Accepted author version posted online: 15 Sep 2014.Published online: 10 Oct 2014.
Click for updates To cite this article: K. Karthik, Rajesh Rathore, Prasad Thomas, T.R. Arun, K.N. Viswas, R.K. Agarwal, H.V. Manjunathachar & Kuldeep Dhama (2014) Loop-mediated isothermal amplification (LAMP) test for specific and rapid detection of Brucella abortus in cattle, Veterinary Quarterly, 34:4, 174-179, DOI: 10.1080/01652176.2014.966172 To link to this article: http://dx.doi.org/10.1080/01652176.2014.966172
PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http:// www.tandfonline.com/page/terms-and-conditions
Veterinary Quarterly, 2014 Vol. 34, No. 4, 174 179, http://dx.doi.org/10.1080/01652176.2014.966172
ORIGINAL ARTICLE Loop-mediated isothermal amplification (LAMP) test for specific and rapid detection of Brucella abortus in cattle K. Karthika, Rajesh Rathorea, Prasad Thomasa, T.R. Aruna, K.N. Viswasa, R.K. Agarwala, H.V. Manjunathacharb and Kuldeep Dhamac* a
Division of Bacteriology and Mycology, Indian Veterinary Research Institute, Bareilly, India; bDivision of Parasitology, Indian Veterinary Research Institute, Bareilly, India; cDivision of Pathology, Indian Veterinary Research Institute, Bareilly, India
Downloaded by [North Carolina State University] at 17:04 01 January 2015
(Received 14 March 2014; accepted 11 September 2014) Background: Brucella abortus, the major causative agent of abortion in cattle and a zoonotic pathogen, needs to be diagnosed at an early stage. Loop-mediated isothermal amplification (LAMP) test is easy to perform and also promising to be adapted at field level. Objective: To develop a LAMP assay for specific and rapid detection of B. abortus from clinical samples of cattle. Methods: LAMP primers were designed targeting BruAb2_0168 region using specific software tool and LAMP was optimized. The developed LAMP was tested for its specificity with 3 Brucella spp. and 11 other non-Brucella spp. Sensitivity of the developed LAMP was also carried out with known quantity of DNA. Cattle whole blood samples and aborted fetal stomach contents were collected and used for testing with developed LAMP assay and results were compared with polymerase chain reaction (PCR). Results: The developed LAMP assay works at 61 C for 60 min and the detection limit was observed to be 100-fold more than the conventional PCR that is commonly used for diagnosis of B. abortus. Clinical sensitivity and specificity of the developed LAMP assay was 100% when compared with Rose Bengal plate test and standard tube agglutination test. SYBÒ green dye I was used to visualize the result with naked eye. Conclusion: The novelty of the developed LAMP assay for specifically detecting B. abortus infection in cattle along with its inherent rapidness and high sensitivity can be employed for detecting this economically important pathogen of cattle at field level as well be exploited for screening of human infections. Keywords: cattle; cow; Brucella abortus; LAMP; BruAb2_0168; whole blood
1. Introduction Brucellosis is a notable disease of animals prevalent throughout the world and it is zoonotic as well. Brucella abortus is one of the major abortion-causing agents in case of cattle population (Priyantha 2011). Each country employs different strategies to control this important disease from their cattle herd. To control a disease, accurate early detection of the pathogen is very important. With the advancements in science, various diagnostic techniques are available now for B. abortus, but still the basic bacteriological techniques remain as the standard testing options since serological and molecular assays have some limitations. Though there are lots of techniques available nowadays to diagnose brucellosis, definitive diagnosis still requires isolation and identification of the causative organism (Alton et al. 1988; Parida et al. 2008; Dhama et al. 2014). Basic bacteriological technique being used as gold standard requires lot of skill to purely isolate the organism and is also time consuming as the organism takes 2 3 days to grow. Other major disadvantages with these conventional techniques are that these are less sensitive when the pathogen load is low in the sample and that the organism is zoonotic in nature so need to be handled in biosafety cabinet 3 (Pike et al. 1965; Perez-Sancho et al. 2013). Serological techniques for detecting brucellosis are quite easy compared to the bacterial isolation as *Corresponding author. Email: [email protected] Ó 2014 Taylor & Francis
these take lesser time and can be employed for mass screening of animals (Chand & Sharma 2004). The major drawback with serological techniques like Rose Bengal plate test (RBPT) and standard tube agglutination test (STAT) are, they are not always specific as the antibodies can cross-react with other gram-negative bacteria like Yersinia enterocolitica serotype O:9 and Francisella spp. (Garin-Bastuji et al. 1999; Yu & Nielsen 2010). Further, these tests are not of high value in detecting infection at early stages since generation of antibodies requires some time. DNA detection methods like polymerase chain reaction (PCR) and its various versions are commonly used these days for detecting Brucella species as these are easy to perform, sensitive and specific but requirement of sophisticated instruments and post-amplification procedures make these impractical to be adapted at field level (Ilhan et al. 2008; Marianelli et al. 2008; Song et al. 2012). Accurate diagnosis of brucellosis at field level is of prime importance but due to the disadvantages of the existing assays, there is requirement of a specific, sensitive and reliable assay that can replace commonly employed serological assays. Loop-mediated isothermal amplification (LAMP) is one such technique having all the qualities for a field-level assay. LAMP assay has the advantage of working at constant temperature which eliminates the need for costly
Downloaded by [North Carolina State University] at 17:04 01 January 2015
Veterinary Quarterly instruments and its results can be viewed directly with no post-amplification protocols. It has higher sensitivity and specificity compared to PCR and hence can be used as a valuable diagnostic tool at field level (Notomi et al. 2000; Nagamine et al. 2002; Dhama et al. 2014). To our knowledge, there are only seven reports regarding detection of Brucella spp. using LAMP (Ohtsuki et al. 2008; Lin et al. 2011; Pan et al. 2011; Song et al. 2012; Perez-Sancho et al. 2013; Soleimani et al. 2013; Karthik et al. 2014a), but there is no report to date regarding development of a LAMP assay detecting specifically the B. abortus species. Keeping this in view, the present study was constructed to develop a LAMP assay to specifically detect B. abortus targeting BruAb2_0168 region and evaluate its diagnostic potential by comparing the results with commonly used PCR and serological tests. The sensitivity and specificity of the developed LAMP assay were also assessed by screening of whole blood samples (n D 200) of cattle for the presence of B. abortus. Results obtained were promising that the developed LAMP can be used under field conditions for specific detection of B. abortus from cattle and also this specific LAMP can serve as the first step towards development of a multiplex LAMP for Brucella spp. 2. Materials and methods 2.1. Bacterial strains used Three major Brucella species, namely B. abortus, B. meltensis and B. suis, were used in this study along with 11 other non-Brucella strains. The bacterial species used in the study were obtained from various laboratories of Indian Veterinary Research Institute and are enlisted in Table 1. DNA template from these isolates was extracted by Rodriguez et al.’s (1997) protocol. 2.2.
Design and optimization of LAMP
LAMP primers, namely F3, B3, FIP and BIP, were designed using primer explorer online software version 4 by targeting
175
conserved BruAb2_0168 region of B. abortus (sequence accession number AE017224.1). The primers used in the study are presented in Table 2. LAMP assay was optimized for different concentrations of MgSO4 (2 8 mM), dNTPs (0.8 1.4 mM), and betaine (0.6 1.4 M) and also the effect of different amplification temperatures (60 66 C) and time (30 90 min) were assessed. In brief, the final reaction mixture for the LAMP contained 5 pM of each outer primer (F3 and B3) and 50 pM of each inner primer (FIP and BIP). Other components comprised 2.5 ml of 10£ Thermopol buffer (1£ buffer comprised 25 mM Tris-HCl pH 8.8, 12.5 mM KCl, 12 mM (NH4)2SO4 and 0.125% Tween 20 (New England Biolabs, USA)), 8 mM MgSO4, 1.4 mM dNTPs and 1 M betaine, and the reaction mixture was adjusted to 22 ml with sterile nuclease free water (NFW). Then, 2 ml of standard B. abortus S99 DNA template and 1 ml Bst DNA polymerase (8 units) were added to the reaction mixture which was followed by incubation at 61 C for 60 min. The reaction was terminated by heating at 95 C for 5 min. NFW was used as a negative control while DNA from known standard strain (B. abortus S99) was used as a positive control in each run. Gel electrophoresis with 2% agarose was conducted to visualize the typical ladder like pattern using 5 ml of LAMP product. To confirm the LAMP product as of B. abortus, sequencing was carried out using F3 and B3 primers. LAMP products were also visualized by using 1 ml of SYBR green dye I (1000£ concentration, Sigma, USA).
2.3.
Analytical specificity and sensitivity of LAMP
Analytical specificity of LAMP assay was evaluated by using the three major Brucella species and also 11 other non-Brucella species (Table 1). Analytical sensitivity of LAMP test was carried out by performing optimized LAMP reaction with serially diluted (10-fold) B. abortus S99 DNA. The initial concentration of purified DNA was estimated using Nanodrop to be having 700 ng/ml
Table 1. Bacterial isolates used in the study. S. No 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
Bacterial isolates (collection code) Brucella abortus S19 (vaccine strain) Brucella abortus S99 (diagnostic reference strain) Brucella melitensis 16M (ATCC 23546) Brucella melitensis field isolate Brucella suis (1330) Escherichia coli (ATCC 25922) Salmonella Typhimurium (MTCC 3219) Yersinia enterocolitica (MTCC 4858) Pasteurella multocida B:2 Clostridium chauvoei (ATCC 10092) Clostridium perfringens Staphylococcus aureus field isolate Campylobacter jejuni field isolate 1 Campylobacter jejuni field isolate 2 Listeria monocytogenes (MTCC 1143) Shigella flexneri (MTCC 1457)
Source
LAMP result
Division of Biological Standardization, IVRI Division of Biological Standardization Division of Veterinary Public Health, IVRI General Bacteriology Lab, IVRI Division of Veterinary Public Health ATCC MTCC MTCC Division of Bacteriology and Mycology, IVRI Division of Bacteriology and Mycology Division of Bacteriology and Mycology General Bacteriology Lab Division of Veterinary Public Health Division of Veterinary Public Health MTCC MTCC
ATCC: American type culture collection; IVRI: Indian Veterinary Research Institute; MTCC: microbial type culture collection.
C C ¡ ¡ ¡ ¡ ¡ ¡ ¡ ¡ ¡ ¡ ¡ ¡ ¡ ¡
176
K. Karthik et al. Table 2. LAMP primers used in the study. S. No
Name
1 2 3 4
F3 B3 FIP BIP
Sequence (50 30 )
Base pair length
GGGTGGAACGACCTTTGC ATTGCCACCAATCTCTCCG CAAAACCTTGGCTGTCACCGCTTGGC AGTCTGGTGCAGAA CGGTACGACCACGGTGTCGACACCGC TATTCACCGTCAC
18 19 40 39
(Thermo Scientific, USA). Optimized conditions for the LAMP assay as mentioned above were followed during these reactions.
Downloaded by [North Carolina State University] at 17:04 01 January 2015
2.4.
Analysis of clinical samples
A total number of 200 whole blood samples as well as respective serum samples of cattle suspected from Brucellosis were collected from different parts of Uttar Pradesh and Tamil Nadu (India). Additionally, 10 aborted fetal stomach contents were also collected from Bareilly region of Uttar Pradesh. All the 210 samples were subjected for B. abortus detection using PCR and the developed LAMP assay. DNA from the 200 whole blood samples was extracted using modified protocol of Sambrook and Russell (2001) and from the 10 aborted stomach contents, DNA was extracted using the protocol of Rodriguez et al. (1997). PCR testing of all the 210 DNA samples was carried out using B. abortus specific primers targeting IS711 gene having an amplicon size of 498 bp (Bricker & Halling 1994; Doust et al. 2007). PCR was standardized with an initial denaturation at 95 C for 10 min followed by 35 cycles of denaturation (94 C for 1 min), annealing (58 C for 1 min) and extension (72 C for 1 min), and a final extension at 72 C for 7 min. Analytical sensitivity of the PCR test was performed using standard B. abortus S99 DNA and the results compared with those of the LAMP. Serum samples (n D 200) were subjected to RBPT and STAT according to the standard protocols described by Alton et al. (1975) for the detection of Brucella antibodies. The clinical sensitivity and specificity of the LAMP test was determined by comparing with serological tests.
3. Results 3.1.
Figure 1. Temperature gradient results. Lanes 1 7: 60, 61, 62, 63, 64, 65 and 66 C. M-100 bp ladder.
UV light in positive reaction. The optimized reaction did not yield positivity to the 11 non-Brucella spp. and also to Brucella species other than B. abortus (B. meltensis and B. suis), proving the self-designed primers to be specific for B. abortus (Table 1 and Figure 2). The detection limit of LAMP targeting BruAb2_0168 region was 7 pg/ml of DNA and that of IS711 PCR was 700 pg/ml (Figure 3). 3.2.
Analysis of clinical samples
Among the 200 whole blood samples, 12 samples were found positive for B. abortus by the developed LAMP assay, whereas IS711 PCR assay detected only 11 samples as positive. Both serological assays (RBPT and STAT) revealed the same 12 samples positive by LAMP to be positive and rest samples to be negative for Brucella antibodies. There was homology of the positive samples detected by different assays. Among the 10 aborted foetal stomach content, 5 samples were positive for B. abortus by both LAMP and PCR assay. Clinical sensitivity and specificity of the developed LAMP assay was 100% when compared with RBPT and STAT.
Optimization of LAMP assay conditions, analytical sensitivity and specificity
LAMP reaction conditions were standardized to find out the optimum temperature, time, dNTPs concentration, MgSO4 and betaine. The electrophoretic analyses of the optimized LAMP reaction at various conditions showed typical ladder like pattern as presented in Figure 1. The optimized LAMP assay completed the reaction in 60 min at 61 C. The sequence results revealed 100% homology only with B. abortus when these were analyzed by BLAST tool (data not shown). The LAMP reaction results were visible under naked eye with the addition of SYBR green showing green color in positive and orange in negative sample. Similarly, there was green fluorescence under
4. Discussion Bovine brucellosis usually caused by B. abortus is a major concern to cattle owners as it causes abortion, is an economically important disease and has high public health concerns (Buyukcangaz & Sen 2007). Early diagnosis of this zoonotic disease is important to check its spread between animals as well as to humans. Presently, several different assays including basic bacteriological, serological and molecular tools are used for the diagnosis of brucellosis but still the gold standard test remains isolation and identification of the organism (Araj 2010). Isolation of organism requires high precautions, consumes time and
Downloaded by [North Carolina State University] at 17:04 01 January 2015
Veterinary Quarterly
177
Figure 2. Analytical specificity of LAMP. (A) Resolution of LAMP products in agarose gel. Lanes 1 9: E. coli, S. Typhimurium, Y. enterocolitica, P. multocida B:2, C. chauvoei, C. perfringens and S. aureus field isolate, Campylobacter jejuni and Listeria monocytogenes. Lanes 10 and 11: B. abortus S19 and B. abortus S99. Lanes 12 14: B. melitensis 16M, B. melitensis field isolate and B. suis. M100 bp ladder. B Blank. (B) and (C) SYBR green-based detection under day light and UV light, respectively. Tubes 1 8: E. coli, S. Typhimurium, Y. enterocolitica, P. multocida B:2, C. chauvoei, C. perfringens and S. aureus field isolate and Campylobacter jejuni. 9 and 10: B. abortus S19 and B. abortus S99. 11 and 12: B. melitensis 16M and B. suis.
hence cannot be used for mass screening of animals for brucellosis. Similarly, serological techniques lack specificity while molecular techniques, like PCR, need sophisticated instruments (Garin-Bastuji et al. 1999; Dhama et al. 2014; Kumar et al. 2014). Serological techniques are commonly employed in field to screen the animals for brucellosis. Rose Bengal plate agglutination test is one of the prescribed tests to detect brucellosis for international trade as per OIE (2009). As this existing serological assay has disadvantages, a specific, sensitive and reliable LAMP assay was developed in the present study so that it can be applied for mass screening of animals for B. abortus. LAMP assay revolutionized the world of diagnostics by its simplicity, rapidity and applicability at field level for detecting the infectious pathogens (Parida et al. 2005; Parida et al. 2008; Dhama et al. 2014) and has been developed for various pathogens including Brucella spp.
Promising results were obtained in the previous reports of LAMP for detecting Brucella at genus level but a specific LAMP assay for particularly detecting a Brucella spp. has not been reported to date (Ohtsuki et al. 2008; Lin et al. 2011; Pan et al. 2011; Song et al. 2012; Soleimani et al. 2013; Perez-Sancho et al. 2013). Hence, the present research work was designed for species-specific detection of B. abortus, a major pathogen causing abortion in cattle. Species-specific detection of brucellosis using PCR was reported by earlier workers (Hinic et al. 2008). The same target used by Hinic et al. (2008) for B. abortus detection was chosen in the present study to specifically detect the same pathogen. The IS711gene-based LAMP assay has been reported to be developed very recently (Perez-Sancho et al. 2013) detecting Brucella at genus level. However, the LAMP assay developed in the present study could detect specifically Brucella organism at the species level of B. abortus, and not detecting the other two
Figure 3. Analytical sensitivity of LAMP and PCR. (A) Resolution of PCR amplicons in agarose gel. Lanes 1 7: 700 ng/ml DNA, 70 ng, 7 ng, 700 pg, 70 pg, 7 pg and 700 fg. (B) Resolution of LAMP products. Lanes 1 7: 700 ng/ml DNA, 70 ng, 7 ng, 700 pg, 70 pg, 7 pg and 700 fg. M-100 bp ladder. (C) and (D) SYBR green-based detection under day light and UV light, respectively. Tubes 1 7: 700 ng/ml DNA, 70 ng, 7 ng, 700 pg, 70 pg, 7 pg and 700 fg.
Downloaded by [North Carolina State University] at 17:04 01 January 2015
178
K. Karthik et al.
Brucella species (B. melitensis and B. suis) or the 11 nonBrucella species tested. The developed LAMP assay targeting only a single species will be the first step towards developing a multiplex LAMP assay which can differentiate multiple Brucella spp. in a single reaction. The LAMP assay for detecting Brucella genus by Perez-Sancho et al. (2013) could detect 100 fg/ml of DNA but the developed LAMP assay in the present study could detect 7 pg/ml of DNA which is 10-fold lesser but compared to conventional PCR it is 100-fold more sensitive (7 pg/ml vs. 700 pg/ml). Use of loop primers increases the sensitivity of a LAMP assay (Nagamine et al. 2002; Perez-Sancho et al. 2013), and thus the additional usage of loop primers in the presently developed LAMP assay is suggested which could help achieve higher sensitivity for detecting B. abortus. During the present study, problems due to carry over contamination was observed rarely, as a precautionary measure three-room rule has been applied with one room for DNA extraction, one for reaction preparation and one for amplification (Lee et al. 2012), and master mix was made without any DNA template and it was stored at ¡20 C so as to prevent contamination of the chemicals and to save time (Angamuthu et al. 2012). Modifications like agar dye capsule method can be adapted to make the LAMP assay a closed tube system so that it can eliminate product cross contamination (Karthik et al. 2014a). Screening results of the field samples for B. abortus indicated that the developed LAMP assay could detect more positive samples than the conventional PCR. In the present study, since conventional DNA extraction protocol was followed, b-actin primers (Joseph et al. 2010) were used as internal amplification control to rule out the chance of PCR inhibitors. Amplification was noticed with b-actin primers during all the reactions indicating that there were no PCR inhibitors, supporting the fact that LAMP is more sensitive than the conventional PCR as reported by earlier workers (Ohtsuki et al. 2008; Lin et al. 2011; Pan et al. 2011). Whole blood samples were used for the detection of B. abortus in the study as it can be obtained from animals of all sex and age and are also convenient to collect under field conditions for the diagnosis of Brucella spp. Earlier studies have reported the use of whole blood for the detection of brucellosis using PCR (Guarino et al. 2000; Karthik et al. 2014b). Blood was also used by Lin et al. (2011) and Song et al. (2012) for the detection of Brucella spp. using LAMP assay and results were compared with PCR and serological tests. The developed LAMP assay could detect B. abortus within 1 hour of reaction time which is in accordance with earlier reports for the detection of Brucella spp. (Lin et al. 2011; Pan et al. 2011; Song et al. 2012; Perez-Sancho et al. 2013). Compared to conventional PCR and other assays commonly employed for the detection of B. abortus under field conditions, the rapidity of LAMP assay makes it a good assay for early diagnosis. To conclude, the developed LAMP assay detecting the Brucella organism at species level specifically could be applied in testing and screening of the samples for B.
abortus, an important animal pathogen having zoonotic concerns. This B. abortus specific LAMP assay can be used for the development of a multiplex LAMP test that can detect and differentiate multiple Brucella species. Besides having high specificity, the inherent rapidity and sensitivity in detecting pathogens, the results of LAMP assay can be interpreted by naked eye visualization by the addition of SYBR green dye and thus the requirement of sophisticated instruments is eliminated. Lyophilization of the master mix could also enable the end users to just add the DNA sample of a particular pathogen, making the assay highly suitable for field level and commercialization. Acknowledgements The authors are thankful to Indian Veterinary Research Institute for supporting this research.
References Alton GG, Jones LM, Angus RD, Verger JM. 1988. Techniques for the brucellosis laboratory. Paris: Inra Publications. Alton GG, Jones LM, Pietz A. 1975. Laboratory techniques in brucellosis. Geneva: World Health Organization. Angamuthu R, Baskaran S, Gopal DR, Devarajan J, Kathaperumal K. 2012. Rapid detection of the Marek’s disease viral genome in chicken feathers by loop-mediated isothermal amplification. J Clin Microbiol. 50:961 965. Araj GF. 2010. Update on laboratory diagnosis of human brucellosis. Int J Antimicrob Agents. 36:S12 S17. Bricker BJ, Halling SM. 1994. Differentiation of Brucella abortus bv. 1, 2, and 4, Brucella melitensis, Brucella ovis, and Brucella suis bv. 1 by PCR. J Clin Microbiol. 32:2660 2666. Buyukcangaz E, Sen A. 2007. The first isolation of Brucella melitensis from Bovine aborted fetus in Turkey. J Biol Environ Sci. 1:139 142. Chand P, Sharma AK. 2004. Situation of brucellosis in bovines at organized cattle farms belonging to three different states. J Immunol Immunopathol. 6:11 15. Dhama K, Karthik K, Chakraborty S, Tiwari R, Kapoor S, Kumar A, Thomas P. 2014. Loop-mediated isothermal amplification of DNA (LAMP) a new diagnostic tool lights the world of diagnosis of animal and human pathogens: a review. Pak J Biol Sci. 17:151 166. Doust SRH, Ahmadi Z, Ahamdi A, Hajia M, Izadi M, Mobarez AM. 2007. Detection of Brucella abortus by alkB and IS711 based primers. JRMS. 12:62 67. Garin-Bastuji B, Hummel N, Gerbier G, Cau C, Pouillot R, Da Costa M, Fontaine JJ. 1999. Non specific serological reactions in the diagnosis of bovine brucellosis: experimental oral infection of cattle with repeated doses of Yersinia enterocolitica O:9. Vet Microbiol. 66: 223 233. Guarino A, Serpe L, Fusco G, Scaramuzzo A, Gallo P. 2000. Detection of Brucella species in buffalo whole blood by gene-specific PCR. Vet Rec. 147:634 636. Hinic V, Brodard I, Thomann A, Cvetnic Z, Makaya PV, Frey J, Abril C. 2008. Novel identification and differentiation of Brucella melitensis, B. abortus, B. suis, B. ovis, B. canis, and B. neotomae suitable for both conventional and realtime PCR systems. J Microbiol Methods. 75:375 378. Ilhan Z, Aksakal A, Ekin IH, Gulhan T, Solmaz H, Erdenlig S. 2008. Comparison of culture and PCR for the detection of Brucella melitensis in blood and lymphoid tissues of serologically positive and negative slaughtered sheep. Lett Appl Microbiol. 46:301 306. Joseph SJ, Pratt SL, Pavan E, Rekaya R, Duckett SK. 2010. Omega-6 fat supplementation alters lipogenic gene
Downloaded by [North Carolina State University] at 17:04 01 January 2015
Veterinary Quarterly expression in bovine subcutaneous adipose tissue. Gene Regul Syst Bio. 4:91 100. Karthik K, Rathore R, Thomas P, Arun TR, Viswas KN, Dhama K, Agarwal RK. 2014a. New closed tube loop mediated isothermal amplification assay for prevention of product cross contamination. MethodsX. 1:e137 e143. Available from: http://dx.doi.org/10.1016/j.mex.2014.08.009 Karthik K, Rathore R, Thomas P, Elamurugan A, Arun TR, Dhama K. 2014b. Serological and molecular detection of Brucella abortus from Cattle by RBPT, STAT and PCR, and sample suitability of whole blood for PCR. Asian J Anim Vet Adv. 9:262 269. Kumar PP, Agarwal RK, Thomas P, Sailo B, Prasannavadhana A, Kumar A, Kataria JL, Singh DK. 2014. Rapid detection of Salmonella enterica subspecies enterica serovar Typhimurium by loop mediated isothermal amplification (LAMP) test from field chicken meat samples. Food Biotechnol. 28:50 62. Lee PW, Ji DD, Liu CT, Rampao HS, Rosario VE, Lin IF, Shaio MF. 2012. Application of loop-mediated isothermal amplification for malaria diagnosis during a follow-up study in S~ao Tome. Malar J. 11:408. Lin GZ, Zheng FY, Zhou JZ, Gong XW, Wang GH, Cao XA, Qiu CQ. 2011. Loop-mediated isothermal amplification assay targeting the omp25 gene for rapid detection of Brucella spp. Mol Cell Probes. 25:126 129. Marianelli C, Martucciello A, Tarantino M, Vecchio R, Iovane G, Galiero G. 2008. Evaluation of molecular methods for the detection of Brucella species in water buffalo milk. J Dairy Sci. 91:3779 3786. Nagamine K, Hase T, Notomi T. 2002. Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol Cell Probes. 16:223 229. Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, Hase T. 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28:E63. Ohtsuki R, Kawamoto K, Kato Y, Shah MM, Ezaki T, Makino SI. 2008. Rapid detection of Brucella spp. by the loop-mediated isothermal amplification method. J Appl Microbiol. 104:1815 1823. [OIE] World Organization for Animal Health. 2009. Bovine brucellosis, Section 2.4.3. In: Edwards S, editor. OIE manual of standards for diagnostic tests and vaccines. 5th ed. Paris: OIE.
179
Pan W, Wang JY, Shen H, Zhao M, Ju C, Dong X, Yi L, Chen JD. 2011. Development and application of the novel visual loop-mediated isothermal amplification of Omp25 sequence for rapid detection of Brucella sp. J Anim Vet Adv. 10:2120 2126. Parida M, Horioke K, Ishida H, Dash PK, Saxena P, Jana AM. 2005. Rapid detection and differentiation of dengue virus serotypes by a real-time reverse transcription-loop-mediated isothermal amplification assay. J Clin Microbiol. 43:2895 2903. Parida M, Sannarangaiah S, Dash PK, Rao PVL, Morita K. 2008. Loop mediated isothermal amplification (LAMP): a new generation of innovative gene amplification technique; perspectives in clinical diagnosis of infectious diseases. Rev Med Virol. 18:407 421. Perez-Sancho M, Garcıa-Seco T, Arrogante L, Garcıa N, Martınez I, Diez-Guerrier A, Perales A, Goyache J, Domınguez L, Alvarez J. 2013. Development and evaluation of an IS711-based loop mediated isothermal amplification method (LAMP) for detection of Brucella spp. on clinical samples. Res Vet Sci. 95:489 494. Pike RM, Sulkin SE, Schulze ML. 1965. Continuing importance of laboratory-acquired infections. Am J Public Health. 55:190 199. Priyantha MAR. 2011. Identification of biovars of Brucella abortus in aborted cattle and buffaloes herd in Sri Lanka. Vet World. 4:542 545. Rodriguez JC, Fuentes E, Royo G. 1997. Comparison of two different PCR detection methods. Application to the diagnosis of pulmonary tuberculosis. APMIS. 105:612 616. Sambrook J, Russell DW. 2001. Molecular cloning: a laboratory manual. New York (NY): Cold Spring Harbour Laboratories Press. Soleimani M, Shams S, Majidzadeh AK. 2013. Developing a real-time quantitative loop-mediated isothermal amplification assay as a rapid and accurate method for detection of Brucellosis. J Appl Microbiol. 115:828 834. Song L, Li J, Hou S, Li X, Chen S. 2012. Establishment of loopmediated isothermal amplification (LAMP) for rapid detection of Brucella spp. and application to milk and blood samples. J Microbiol Methods. 90:292 297. Yu WL, Nielsen K. 2010. Review of detection of Brucella spp. by polymerase chain reaction. Croat Med J. 51:306 313.
