Journal of Infection (2014) 69, 607e615

www.elsevierhealth.com/journals/jinf

Loop-mediated isothermal amplification assay for rapid and sensitive diagnosis of tuberculosis Parveen Kumar a, Deepal Pandya b, Niti Singh c, Digambar Behera c,e, Praveen Aggarwal d, Sarman Singh a,* a

Division of Clinical Microbiology and Molecular Medicine, All India Institute of Medical Sciences, New Delhi 110029, India b AmpliGene India Biotech Pvt. Ltd., Ahmedabad, Gujarat, India c National Institute of Tuberculosis and Respiratory Diseases, New Delhi, India d Department of Emergency Medicine, All India Institute of Medical Sciences, New Delhi, India Accepted 12 August 2014 Available online 9 September 2014

KEYWORDS LAMP; esat-6; Mycobacterium tuberculosis; Multiplex PCR

Summary Objectives: Loop-mediated isothermal amplification (LAMP) is a newly developed molecular method that can be performed isothermally. We developed and evaluated a LAMP assay using novel primers to diagnose tuberculosis directly from clinical samples. Materials: Primers were designed to amplify the specific novel esat-6 gene target of Mycobacterium tuberculosis (MTB). Quantitated DNA was used to determine analytical sensitivity and specificity was evaluated by testing 29 NTM and 37 other bacterial species. After standardization, its sensitivity and specificity were evaluated on samples from 118 TB suspected and 31 non-TB patients and compared it with smear, culture and mPCR methods. Results: LAMP was able to detect 5 fg DNA (one MTB) within 21 min and found to be 10 times more sensitive than mPCR and showed 100% specificity against NTM and other bacterial species. In clinical samples, LAMP showed highest MTB detection rate (52.5%) as compared to mPCR (44%) and culture (30.5%). On culture positive and mPCR positive samples, the sensitivity of LAMP was found to be 100% (95% CI 90.2e100) and 96.1% (95% CI 86.7e99.5) respectively with 93.5% (95% CI 78.5e99.2) of overall specificity. Conclusion: LAMP was found to be more sensitive than culture and mPCR for the detection of MTB. It showed specificity comparable to mPCR but was rapid and cost effective. ª 2014 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

* Corresponding author. Tel.: þ91 11 2658 8484; fax: þ91 11 2658 8663, þ91 11 2658 8641. E-mail addresses: [email protected], [email protected] (S. Singh). e Present address: Post-Graduate Institute of Medical Education and Research, Chandigarh, India. http://dx.doi.org/10.1016/j.jinf.2014.08.017 0163-4453/ª 2014 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

608

Introduction Tuberculosis (TB) remains one of the leading infectious diseases, particularly in developing countries. India has more new TB cases annually than any other country. In 2012, out of the 8.6 million global annual incidental cases of TB, 2.0e2.4 million were estimated to be from India.1 The biggest challenges in TB control remain early and accurate diagnosis. Though smear microscopy is the simplest and most rapid diagnostic procedure currently available but its sensitivity is very low and requires at least 5  103 bacilli/ml in the clinical samples which is a very solemn issue specially in extra-pulmonary (EPTB) samples.2 The automated liquid culture based Mycobacteria Growth Indicator Tube (MGIT) system has reduced this time, but still it is not optimal.3 In last 6e7 years, the diagnosis of TB has undergone a major breakthrough with the introduction of nucleic acid amplification (NAA) techniques. Using these methods directly on clinical samples, results can be obtained within 1e3 days with high sensitivity and specificity. Centers for Disease Control and Prevention (CDC)4 and American Thoracic Society (ATS)5 recommend well-standardized NAA to be performed for rapid screening of patients with signs and symptoms of pulmonary TB (PTB). Currently, several commercial NAA methods based on different principles are available. These include, Roche’s COBAS Amplicor MTB test6,7 GenProbe’s Amplified M. tuberculosis Direct test (AMTD),6e8 BD’s ProbeTec-ET6,9 and Hain’s GenoType Mycobacteria Direct assay (GTMD).10 Available real-time polymerase chain reactions (RT-PCR) systems are, Roche COBAS TaqMan MTB test and the Cepheid Xpert MTB/RIF test.11 These assays have been widely evaluated on different clinical samples and strains. Most of the NAA showed consistent specificity and good positive predictive values but modest and variable sensitivity, particularly in smear-negative and extra-pulmonary TB samples. Even though these NAAs are well established but requirement of sophisticated infrastructure, prices of commercial kits and reagents are not affordable for most of the countries with high TB burden. To circumvent these limitations, many of these countries use poorly validated in-house PCR which show variability in their accuracy.12 Hence, there is a high demand of well validated, affordable commercial NAA for use in low-resource countries. In year 2000, Notomi et al.13 developed a loop-mediated isothermal amplification (LAMP) method for the detection of viral pathogens. This nucleic acid amplification test is found to be simple, rapid, highly efficient, specific and cost effective. LAMP assay has several advantages as compared to the conventional PCR such as requires fewer steps, performed at a fixed temperature and the amplified products can be visualized from naked eye by adding the dye. LAMP assay has been developed for the detection of a number of infectious agents, including Vibrio parahaemolyticus,14 Dengue virus,15 Trypanosoma brucei,16 Plasmodium parasitemia,17 Mycobacterium tuberculosis (MTB),18,19 M. bovis,20 M. avium21 and respiratory viruses22 as well as for nonhuman viruses.23 However, so far for MTB detection in clinical samples only one commercial version of this method has been developed. This commercial kit

P. Kumar et al. was recently evaluated by WHO/FIND. The WHO expert group analyzed this evaluation data and agreed that LAMP technology has potential as a rapid TB diagnostic tool but made further recommendations to improve its performance.24 In the present study, we developed an improvised version of LAMP for the specific detection of MTB using the novel gene target. The efficacy of the LAMP assay was assessed by comparing it with other standard TB diagnostic methods.

Materials and methods Study settings The study was performed at the TB research laboratory, Division of Clinical Microbiology and Molecular Medicine, All India Institute of Medical Sciences, New Delhi, which is an accredited laboratory by the central TB division of the Government of India and certified by the STOP-TB for noncommercial rapid culture and drug susceptibility tests.25 The study was approved by the Institute Ethics Committee (Ref. No.IEC/NP-259/2010) and written informed consent was obtained from all the participants.

LAMP primer designing The primer designing is the most crucial step to develop a successful LAMP assay. LAMP primer sets were designed against MTB specific novel target east-6 gene by using the LAMP designer software version 1.10 (Optigene, UK). This software has special characteristics to design and short list superior five LAMP primer sets followed by checking the homology and specificity of primers by BLAST. A primer set was composed of outer primers F3 and B3, inner primers forward inner primer (FIP) and backward inner primer (BIP). Loop primers were forward loop primer (FLP) and backward loop primer (BLP). FIP consists of F1c sequence complementary to F1 and F2 sequence; BIP consists of B1c sequence complementary to B1 and B2 sequence (Table 1).

Optimization of the LAMP reaction LAMP reactions were performed in a volume of 25 mL consisting of 20 pmol each of inner primers FIP and BIP, 5 pmol each of outer primers F3 and B3, 10 pmol each of loop primers FLP and BLP. The reaction mixture contained of 15 mL of isothermal master mix ISO 0001 (Optigene, UK) which included Geobacillus species DNA polymerase, thermo stable inorganic pyrophosphatase, optimized buffer (containing MgCl2, deoxynucleotide triphosphates and double-stranded DNA dye) and 5 mL of extracted DNA as template. The LAMP assay was optimized at 65  C for 35 min on a real-time fluorometer Genie II (Optigene, UK). The amplification reaction was terminated at 85  C for 5 min. A melting curve was drawn after the amplification by measuring the fluorescence to detect the annealing temperature. Further, the specificity of MTB LAMP was examined by performing the assay on 100 ng of genomic DNA isolated from 6 reference mycobacterial strains [MTB H37Rv (TMC-102), M. avium (NCTC-8551), M. intracellulare

LAMP assay for TB diangosis Table 1

609

Nucleotide sequences of esat6-LAMP primers.

LAMP primers

Nucleotide sequences

Length (bp)

F3 B3 FIP(F1c þ F2) BIP(B1c þ B2) Loop F Loop B

CAAGCGCAATCCAGGG GCTTCGCTGATCGTCC CGCTGCGAGCTTGGTCATGTCACGTCCATTCATTCC TAGCGGTTCGGAGGCGTACGTTGTTCAGCTCGGTAG CTGCTTCCCCTCGTCAAG AAATGGGACGCCACGG

16 16 36 36 18 16

(TMC1406), M. terrae (TMC-1450), M. smegmatis MC2155, M. bovis BCG], 37 laboratory maintained mycobacterial species and 37 non mycobacterial species as given in Table 2. In order to investigate the analytical sensitivity, LAMP assay was performed at different dilutions of DNA. For this, a known concentration of MTB H37Rv genomic DNA was 10-fold serially diluted in 1 TE buffer (pH 8.8) from 5 ng to 5  107 ng. The genome copy number of each dilution was calculated considering that a single genome of MTB is equivalent to approximately 5 fg of DNA.18 After standardization the LAMP results could be read visually by a simply color change using SYBR green I dye (100) (Invitrogen, USA).

Use of LAMP assay on clinical samples The optimized LAMP assay was performed on clinical samples to evaluate the feasibility of the test. For this, 118 clinical samples (one each) from suspected TB patients sent from various hospitals within and around Delhi for TB diagnosis were included. Of these 41 were pulmonary samples (29 sputa, 7 BAL and 5 GA) and 77 extra pulmonary samples (28 CSF, 11 pus, 15 pleural fluid, 2 ascitic fluid, 7 lymph node aspirate, 5 urine, 3 abscess pus and 6 other body fluids). The clinical suspicion of TB was based on standard clinico-radiological findings mentioned in the CDC and ATS guidelines,26,27 e.g. fever with or without cough; weight loss or night sweats lasting longer than 2 weeks; and/or cavitary lesions in the lung fields on radiological examination; or suppurating or non-suppurating cold single or mated lymph nodes. In addition, a total of 31 samples from patients having no past history of TB and having confirmed diagnosis of Non-TB infectious or non-infectious diseases were included as disease controls. These included 11 sputa from patients with chronic obstructive pulmonary diseases (COPD), 5 lymph node biopsies from patients of malignant lymphoma, 7 pus and 8 urine samples from patients with bacterial urinary tract infection. The methods of samples processing, mycobacterial culturing, DNA extraction and multiplex PCR (mPCR) were followed as described elsewhere.28,29 All study participants gave informed consent, as a standard routine TB diagnostic procedure of the laboratory.

calculate the sensitivity and specificity of the LAMP assay. Chi-squared test and Fisher’s exact test were also performed to analyze the results using Stata 11.1 software. The significance level for these analyzes was defined as a p level of 0.05.

Results Optimization of LAMP reaction time and temperature The LAMP reaction time, temperature, and primer concentrations were optimized for the rapid detection of MTB with the help of Genie II fluorometer. The Genie II displays the real time amplification signals and at the end of the assay it displays the time to positivity and annealing Tm for each sample. During the standardization, the LAMP reaction was standardized at 65  C isothermal temperature and the amplification times were observed ranging from 10.8 to 24 min. The mean time to positivity for all positive results was 17.2  6.19 min. Thus, the optimized LAMP reaction was set to run for 35 min for testing all other samples.

Analytical sensitivity and specificity of LAMP assay The optimized LAMP assay showed the lowest (5 fg) amount of MTB DNA was consistently detected within 21 min which is equivalent to one copy of the MTB genome (Fig. 1A). The results showed that a reaction time of 35 min was sufficient to amplify one copy of genomic DNA. The mPCR was able to detect 5  105 ng of DNA which is a minimum of 10 copies of purified MTB DNA (50 fg) (Fig. 1B). In conclusion, esat6LAMP assay was 10 times more sensitive than conventional mPCR. In addition, the LAMP results could be read visually by a change in the color/fluorescence after addition of 5 mL of SYBR green (Fig. 2). In order to investigate the specificity, the efficient amplification of DNA by esat6-LAMP was observed only in MTB strains within 35 min. In contrast, no DNA amplification was observed with the 29 NTM species and 37 other bacterial species, giving 100% specificity (Table 2).

LAMP assay on clinical samples Statistical analysis The results of LAMP assay were analyzed and compared with standard TB diagnostic methods. Data were maintained on MS Excel 7.0 and statistically analyzed to

A total of 118 suspected TB patients, 75 (63.5%) men and 43 (36.4%) women were enrolled in this study. Majority [80 (67.7%)] of patients were more than 15 years of age (mean age of 38.1  16.95) and 38 (32.2%) patients aged less than

610

P. Kumar et al.

Figure 1 Comparison of determination of analytical sensitivity of the LAMP (panel A) and mPCR (panel B). (A) Detection of sensitivity of LAMP assay by a real-time fluorometer Genie II. The results showed detection limit of esat6-LAMP was 5  106 ng (equal to one genome of MTB (5 fg)) (B) detection limit of mPCR was 5  105 ng (50 fg) of MTB DNA.

Figure 2 LAMP amplification results of positive and negative samples can be detected and differentiated with naked eyes (upper panel A) as well as under ultraviolet light (middle panel B). LAMP results on 2% agarose gel electrophoresis (lower panel C). Panels are showing LAMP positive results (3e10) and negative results (1e2).

LAMP assay for TB diangosis Table 2

611

Determination of specificity of esat6-LAMP assay.

Bacterial species (n)

Reference strains

LAMP Pos

LAMP Neg

TMC-102 NCTC-8551 TMC1406 TMC-1450 MC2155 BCG P3 Lab. maintained Lab. maintained Lab. maintained Lab. maintained Lab. maintained Lab. maintained Lab. maintained Lab. maintained

1 e e e e e 13 e e e e e e e

e 1 1 1 1 1 e 5 4 7 2 2 2 2

Lab. Lab. Lab. Lab. Lab. Lab.

e e e e e e

10 3 3 5 14 2

I. Mycobacterial species (43)

M. M. M. M. M. M. M. M. M. M. M. M. M. M.

tuberculosis H37Rv (1) avium (1) intracellulare (1) terrae (1) smegmatis (1) bovis BCG (1) tuberculosis (13) scrofulaceum (5) fortuitum (4) avium (7) smegmatis (2) terrae (2) kansasii (2) chelonae (2)

II. Non mycobacterial species (37)

Escherichia coli (10) Staphylococcus aureus (3) Klebsiella pneumonia (3) Pseudomonas aeruginosa (5) Acinetobacter species (14) Enterobacter species (2)

maintained maintained maintained maintained maintained maintained

15 years (mean age 8.6  3.92). Out of 118 patients, 41 were suspected cases of PTB and 77 of EPTB. In the suspected PTB patients, most common clinical manifestations were cough of more than 2 weeks in 35 (85.3%), fever in 31 (75.6%), weight loss in 26 (63.4%), and night sweats and chest pain in 13 (31.7%). Radiological examination showed consolidation, infiltration, cavitary lesions and fibrosis of lungs in 23 (56%) cases. Of the 77 suspected EPTB patients, they had varied manifestations including, suspected TB meningitis (28), pleural TB (15), subcutaneous abscess (11), lymphadenitis (7), genitourinary TB (5), Abdominal TB (2) and 9 were suspected cases of disseminated TB. Past history of TB was recorded in 33 (25.7%) and family history of TB in 27 (22.8%) patients. The LAMP results on 118 samples were analyzed by comparing the results with smear microscopy, MGIT culture and in-house mPCR individually and in combination. The performance of these tests is shown in Table 3. The positivity rate of LAMP was found to be highest of all the diagnostic tests used in this study (p Z 0.001). From 41

Table 3

pulmonary samples, 14 (34.14%) were bacteriologically (smear and/or MGIT culture) positive and 18 (43.9%) were mPCR positive; while 21 (51.2%) samples were positive by LAMP. All the culture and mPCR positive samples were positive by LAMP assay showing 100% sensitivity in bacteriologically confirmed cases. LAMP was able to detect 13% additional cases over the bacteriological and mPCR positive samples (Table 4, Fig. 3A). Similar results were obtained in EPTB samples. Of the 77 EPTB samples, 22 (28.5%) samples were bacteriologically positive and 34 (44.1%) by mPCR for MTB, while 41 (53.2%) were detected positive by the LAMP assay (Table 4, Fig. 3B). The difference in positivity rate of LAMP and culture was highly significant (p Z 0.001) in EPTB samples. In 2 bacteriologically and LAMP negative samples (CSF and PF one each) mPCR was found positive. Overall LAMP assay was able to detect 22% and 8.5% additional cases over the MGIT culture and mPCR, respectively (p Z 0.001) (Tables 3 and 4). These results indicate that esat6-LAMP is highly sensitive assay and can detect small quantity of mycobacterial DNA in clinical samples. The

Overall performance of esat6-LAMP in comparison with smear microscopy, MGIT culture and mPCR.

Bacteriological criteria

mPCR

Smear

Culture

þ



þ



þ  þ 

þ þ  

9 27 0 16

0 0 0 66

9 27 0 26

0 0 0 56

52 (44%)

66 (55.9%)

62 (52.5%)

56 (47.45%)

Total

9 27 0 82 118

LAMP

612

P. Kumar et al.

Table 4

Sensitivity of LAMP assay on pulmonary and extra-pulmonary samples from suspected TB patients.

Samples

LAMP results

Detection rate %

Sensitivity % (95% CI)

P value (Fisher’s exact test)

100 25.9 100 13 100

0.001

Pos

Neg

14 7 18 3 14

0 20 0 20 0

100 25.9 100 13 100

4

0

100

100 (39.8e100)

3

20

13

13 (2.7e33.5)

22 23 32 7 22

0 32 2a 36 0

100 41.8 94.1 16.2 100

100 41.8 94.1 16.2 100

10

2a

83.3

83.3 (51.5e97.9)

9

34

26.4

26.4 (10e36)

I PTB samples (41)

Bacteriologicallyþ (14) Bacteriologicallye (27) mPCRþ (18) mPCRe (23) Bacteriologically and mPCRþ (14) Bacteriologicallye, mPCRþ (4) Bacteriologicallye, mPCRe (23)

(76.8e100) (11.1e46.2) (81.4e100) (2.7e33.5) (76.8e100)

0.001 0.001

II EPTB samples (77)

Bacteriologicallyþ (22) Bacteriologicallye (55) mPCRþ (34) mPCRe (43) Bacteriologicallyþ, mPCRþ (22) Bacteriologicallye,mPCRþ (12) Bacteriologicallye, mPCRe (43) a

(84.5e100) (28.6e55.8) (80.3e99.2) (68e30.7) (84.5e100)

0.001 0.001 0.001

One pleural fluid and one CSF sample was negative by LAMP.

overall specificity of LAMP assay was found to be 93.5% (95% CI: 78.6e99.2) and false-positive reaction was seen only in two samples (pus and urine, one each) (Table 5). The two false-positive results remained positive even after repeating the test. Out of 26 LAMP positive but bacteriologically negative samples, 19 (73%) were EPTB samples (6 CSF, 5 lymph node aspirate, 5 pus, lymph node aspirate, urine & pericardial fluid one of each) and 7 (26.9%) were PTB samples. Interestingly, 14 (73.7%) of these samples were also positive by mPCR and all 14 patients from whom these samples were obtained, gave past history of TB and 5 (26.3%) gave family

history of TB. In one patient both self and family history of TB could be elicited. Follow-up information was available only for 17 patients. Of these 15 were put on ATT on the basis of clinical, radiological and mPCR results and cured. Two patients died during ATT treatment (Table 6).

Discussion Early and accurate diagnosis of TB is of paramount importance for the better management of this disease particularly in high TB burden countries. Although smear

Figure 3 Concordance of the LAMP assay with bacteriological and mPCR results on PTB samples (panel A) and EPTB samples (panel B).

LAMP assay for TB diangosis

613

Table 5

Specificity of the LAMP assay on disease control samples.

Samples

Final disease diagnosis

Sputum (11) Pus (7) Urine (8) Lymph node (5)

LAMP results

COPD with pneumonia Abscess pus Bacterial UTI Lymphoma

Total (31) a b

Table 6

Negative

e 1a 1b e

11 6 7 5

100 85.7 87.5 100

2

29

93.5 (78.5e99.2)

(71.5.1e99.6) (42.1e99.6) (47.8e99.6) (47.8e1000)

more research is needed to improve its specificity and evaluation should be carried out in different geographical settings with different prevalence and incidence rates of TB and HIV-TB.24 Considering the above recommendation of WHO expert group, the present study was aimed to develop a new LAMP test and evaluate its diagnostic potential. For this we used a novel esat-6 gene target (process and product, patented in the names of Singh S & Sharma P: WO 2005/061730 A1, AU2004303629, EP 1711620 B1, and US 2007/0072188). The test was standardized on mycobacterial and other bacterial species and finally evaluated for its sensitivity and specificity directly on clinical samples. While comparing with three tests, LAMP assay showed 8.5% higher detection rate than mPCR and 22% higher than MGIT culture. High positivity of LAMP assay over the standard culture method could be explained by inclusion of a larger number of EPTB samples. The EPTB samples are known to be paucibacillary in nature thereby yielding low culture positivity, while molecular tests can amplify even a small quantity (as low a 5 fg) of mycobacterial DNA. However, the biggest limitation of DNA based molecular tests is that these tests can not differentiate between dead and live target organisms.6e12

Final diagnosis in diseased patients whose samples were LAMP positive but bacteriologically negative.

Bacteriologically negative LAMP positive (n Z 26)

Follow-up details (17)a Final diagnosis

Sample

No.

CSF Pleural fluid

6b 5b

3 4

Pus

5b

3

LN Aspirate. Urine Pericardial fluid Sputum

1 1b 1b 5

1 e e 5

BAL GA

1 1b

1 e

a

Positive

Pus from amebic liver abscess. This patient had bacterial urinary tract infection established by routine culture examination.

microscopy is the most rapid but has poor sensitivity. Mycobacterial culture is considered as gold standard, but it is tedious, time-consuming, and requires safety procedures in laboratories. However, in the last one decade, several new diagnostic tests have been commercialized, but most are expensive.30 Therefore, a test that combines the rapidity and specificity of microscopy and can improve the sensitivity of culture methods at a reasonable price would be a boon for the TB management. Although the NAA methods offer major advantages of speed and sensitivity for pathogen detection, these require sophisticated laboratory infrastructure and are not feasible for routine use in developing countries.31e34 Recent research and development efforts have, however, led to the development of novel molecular approaches which may change this paradigm. LAMP, is a new NAA method, that can be performed in one tube under isothermic condition and with high amplification efficiency in a very short time i.e. 30e35 min. Globally, two companies: Eiken Chemical Ltd, Japan and Optigene, UK, have developed LAMP based point of care test for the detection of various pathogens.22,24 The Eiken TB kit was evaluated by FIND at selected reference centers in high TB burden countries. This DATA was analyzed by WHO expert group and recommended that

b

Specificity (%) (95% CI)

Follow-up was available only for 17 cases. Remaining patients lost to follow-up.

TB meningitis (3) Pleural TB (4)

Treatment outcome

All 3 Cured with ATT Three patients cured with ATT and 1 patient died during treatment Cold abscess (2) All received prolonged Pott’s disease (1) ATT and cured TB lymphadenitis (1) ATT received and cured e e e e PTB (5) Four patients cured with ATT and 1 patient died during treatment PTB (1) ATT received and cured e e

614 Although culturing is gold standard test for diagnosis of TB but it can yield false-negative results when sample contains dormant bacilli, less than 102 bacilli/ml, or nonculturable bacilli (because of over decontamination process and under treatment). However, in the analysis of results, reference standard test is the comparator for the test under evaluation, especially for sensitivity evaluation. The selection and the quality of the reference standard test directly affect the measurement of test performance.35 In our study, the analytical sensitivity of our LAMP assay was higher than conventional mPCR. Aryan et al.18 also reported that LAMP is more sensitive than conventional PCR in paucibacillary sputum samples. However, other authors have observed that LAMP assay had broadly similar sensitivity and specificity in pulmonary samples as of PCR and culture results.19,36e38 The limitation of our study was small sample size. A study with larger sample size using the case control approach would be desirable. A prospective study to evaluate the utility of LAMP test in the disease prognosis and treatment success also need to be carried out. The specificity may be a concern in ultrasensitive test methods such as LAMP. But this can be improved by using the flouremeter Genie II real time system. This system provides a closed tube approach that minimizes the number of liquid handling steps, and reduces possibility of cross contamination significantly18 In conclusion, the LAMP assay could be highly useful tool for diagnosing pauci-bacillary cases of tuberculosis such as EPTB cases. The test is highly sensitive, cost effective, and rapid with a turnaround time of less than 6 h. The patient can be diagnosed on the same day and need not to come again to the laboratory.

Conflict of interest The corresponding author holds the process and product patent on using esta-6 primer sequences for the molecular diagnosis of Mycobacterium tuberculosis in the names of Singh S & Sharma P: WO 2005/061730 A1, AU2004303629, EP 1711620 B1, and US 2007/0072188. Another author (Deepal Pandya) works for AmpliGene India Biotech Pvt. Ltd., Ahmedabad, Gujarat, India, who markets fluorometer Genei-II in India.

Acknowledgments We wish to thank Ms. Syed Beenish Rufai, Deepika Anand and Mr. Vinod Kumar for their technical help. Financial support from the Department of Biotechnology, Government of India (vide grant no BT/PR-15206/Med/29/281/ 2011) to SS is acknowledged. A senior research fellowship to PK from Department of Biotechnology, Government of India is also acknowledged.

References 1. World Health Organization. Global tuberculosis report. 2013. WHO/HTM/TB/2013.11. Geneva, Switzerland. Retrieved from: http://apps.who.int/iris/bitstream/10665/91355/1/ 9789241564656_eng.pdf.

P. Kumar et al. 2. Gopinath K, Kumar S, Sankar MM, Singh S. Novel method for clearing red blood cell debris from BacT/ALERT blood culture medium for improved microscopic and anti-mycobacterial drug susceptibility test results. J Clin Lab Anal 2007;21(4):220e6. 3. Lu PL, Yang YC, Huang SC, Jenh YS, Lin YC, Huang HH, et al. Evaluation of the Bactec MGIT 960 system in combination with the MGIT TBc identification test for detection of Mycobacterium tuberculosis complex in respiratory specimens. J Clin Microbiol 2011;49(6):2290e2. 4. Centers for Disease Control and Prevention (CDC). Updated guidelines for the use of nucleic acid amplification tests in the diagnosis of tuberculosis. MMWR Morb Mortal Wkly Rep 2009;58(01):7e10. 5. American Thoracic Society Documents (ATS), American Thoracic Society/Centers for Disease Control and Prevention/Infectious Diseases Society of America. Controlling tuberculosis in the United States. Am J Respir Crit Care Med 2005;172: 1169e227. 6. Ling DI, Flores LL, Pai M. Commercial nucleic-acid amplification tests for diagnosis of pulmonary tuberculosis in respiratory specimens: meta-analysis and meta-regression. PLoS One 2008; 3(2):e1536. 7. Goessens WHF, de Man P, Koeleman GM, Luijendijk A, te Witt R, Endtz HP, et al. Comparison of the COBAS AMPLICOR MTB and BDProbeTec ET assays for detection of Mycobacterium tuberculosis in respiratory specimens. J Clin Microbiol 2005; 43(6):2563e6.  M, Moreno C, Martı´ N. Routine use of gen-probe 8. Coll P, Garrigo amplified Mycobacterium Tuberculosis Direct (MTD) test for detection of Mycobacterium tuberculosis with smear-positive and smear-negative specimens. Int J Tuberc Lung Dis 2003; 7(9):886e91. 9. Miragliotta G, Antonetti R, Di Taranto A, Mosca A, Del Prete R. Direct detection of Mycobacterium tuberculosis complex in pulmonary and extrapulmonary samples by BD ProbeTec ET system. New Microbiol 2005;28(1):67e73. 10. de Luna FF, Ruiz P, Gutie ´rrez J, Casal M. Evaluation of the GenoType Mycobacteria Direct assay for detection of Mycobacterium tuberculosis complex and four atypical mycobacterial species in clinical samples. J Clin Microbiol 2006;44(8): 3025e7. 11. Antonenka A, Hofmann-Thiel S, Turaev L, Esenalieva A, Abdulloeva A, Sahalchyk E, et al. Comparison of Xpert MTB/RIF with ProbeTec ET DTB and COBAS TaqMan MTB for direct detection of M. tuberculosis complex in respiratory specimens. BMC Infect Dis 2013;13:280. 12. Flores LL, Pai M, Colford JM, Riley LW. In-house nucleic acid amplification tests for the detection of Mycobacterium tuberculosis in sputum specimens: meta-analysis and meta-regression. BMC Microbiol 2005;5:55. 13. Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, et al. Loop mediated isothermal amplification of DNA. Nucleic Acids Res 2000;28(12):e63. 14. Wataru Y, Ishibashi M, Kawahara R, Inoue K. Development of a loop-mediated isothermal amplification assay for sensitive and rapid detection of Vibrio parahaemolyticus. BMC Microbiol 2008;8:163. 15. Parida M, Horioke K, Ishida H, Dash PK, Saxena P, Jana AM, et al. Rapid detection and differentiation of dengue virus serotypes by a real-time reverse transcription-loop-mediated isothermal amplification assay. J Clin Microbiol 2005;43(6): 2895e903. 16. Njiru ZK, Mikosza ASJ, Armstrong T, Enyaru JC, Ndung’u JM, Thompson ARC. Loop-mediated isothermal amplification (LAMP) method for rapid detection of Trypanosoma brucei rhodesiense. PLoS Negl Trop Dis 2008;2:e147. lez IJ, Jolley SD, Angutoko P, Ategeka J, 17. Hopkins H, Gonza Asiimwe C, et al. Highly sensitive detection of Malaria

LAMP assay for TB diangosis

18.

19.

20.

21.

22.

23.

24.

25.

26.

parasitemia in a malaria-endemic setting: performance of a new loop-mediated isothermal amplification kit in a remote clinic in Uganda. J Infect Dis 2013;208(4):645e52. Aryan E, Makvandia M, Farajzadeha A, Huygenb K, Bifanib P, Mousavic SL, et al. A novel and more sensitive loop-mediated isothermal amplification assay targeting IS6110 for detection of Mycobacterium tuberculosis complex. Microbiol Res 2010; 165(3):211e20. George G, Mony P, Kenneth J. Comparison of the efficacies of loop-mediated isothermal amplification, fluorescence smear microscopy and culture for the diagnosis of tuberculosis. PLoS One 2011;6(6):1007. Zhu RY, Zhang KX, Zhao MQ, Liu YH, Xu YY, Ju CM, et al. Use of visual loop-mediated isotheral amplification of rimM sequence for rapid detection of Mycobacterium tuberculosis and Mycobacterium bovis. J Microbiol Methods 2009;78(3):339e43. Iwamoto T, Sonobe T, Hayashi K. Loop-mediated isothermal amplification for direct detection of Mycobacterium tuberculosis complex, M. avium, and M. ntracellulare in sputum samples. J Clin Microbiol 2003;41(6):2616e22. Mahony J, Chong S, Bulir D, Ruyter A, Mwawasi K, Waltho D. Development of a sensitive loop-mediated isothermal amplification assay that provides specimen-to-result diagnosis of respiratory syncytial virus infection in 30 minutes. J Clin Microbiol 2013;51(8):2696e701. Peng J, Shi M, Xia Z, Huang J, Fan Z. Detection of cucumber mosaic virus isolates from banana by one-step reverse transcription loop-mediated isothermal amplification. Arch Virol 2012;157(11):2213e7. World Health Organization. The use of a commercial loopmediated isothermal amplification assay (TB-LAMP) for the detection of tuberculosis. 2013. WHO/HTM/TB/2013.05. Geneva, Retrieved from: http://apps.who.int/iris/bitstream/ 10665/83142/1/WHO_HTM_TB_2013.05_eng.pdf. Singh S, Kumar P, Sharma S, Mumbowa F, Martin A, Durier N. Rapid identification and drug susceptibility testing of Mycobacterium tuberculosis: standard operating procedure for noncommercial assays: part 1: microscopic observation drug susceptibility assay v2.4.12. J Lab Physicians 2012;4:120e6. American Thoracic Society (ATS). Diagnostic standards and classification of tuberculosis in adults and children. This official statement of the American Thoracic Society and the Centers for Disease Control and Prevention was adopted by the ATS Board of Directors, July 1999. This statement was endorsed by the Council of the Infectious Disease Society of America. Am J Respir Crit Care Med 1999;161:1376e95.

615 27. Reves R, Reichman LB, Simone PM, Starke JR, Vernon AA. American Thoracic Society/Centers for Disease Control and Prevention/Infectious Diseases Society of America: treatment of tuberculosis. Am J Respir Crit Care Med 2003;167:603e62. 28. Kumar P, Benny P, Jain M, Singh S. Comparison of an in-house multiplex PCR with two commercial immuno-chromatographic tests for rapid identification and differentiation of MTB from NTM isolates. Int J Mycobacteriol 2014;3(1):50e6. 29. Gopinath K, Singh S. Multiplex PCR assay for simultaneous detection and differentiation of Mycobacterium tuberculosis, Mycobacterium avium complexes and other mycobacterial species directly from clinical specimens. J Appl Microbiol 2009; 107(2):1364e72. 30. Verma S, Dhole TN, Kumar M, Kashyap S. A novel approach for improving sensitivity of AFB microscopy using ReaSLR method. J Clin Microbiol 2013;51(11):3597e601. 31. Dora JM, Geib G, Chakr R, Paris Fd, Mombach AB, Lutz L, et al. Polymerase chain reaction as a useful and simple tool for rapid diagnosis of tuberculous meningitis in a Brazilian tertiary care hospital. Braz J Infect Dis 2008;12(3):245e7. 32. Lorino G, Lilli D, Rivanera D, Guarino P, Angeletti S, Gherardi G, et al. Polymerase chain reaction, with sequencing, as a diagnostic tool in culture-negative bacterial meningitis. Clin Microbiol Infect 1999;5(2):92e6. 33. Pai M, Flores LL, Pai N, Hubbard A, Riley LW, Colford JM. Diagnostic accuracy of nucleic acid amplification tests for tuberculous meningitis: a systematic review and meta-analysis. Lancet Infect Dis 2003;3(10):633e43. 34. Pal RB, Desai MM. Polymerase chain reaction for the rapid diagnosis of tuberculous meningitis. J Indian Med 2007;105(1): 21e4. 35. Peeling RW, Smith PG, Bossuyt PMM. A guide for diagnostic evaluations. Nat Rev Microbiol 2010:S2e6. 36. Tomita N, Mori Y, Kanda H, Notomi T. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nat Protoc 2008;3(5):877e82. 37. Leila K, Shahhosseiny MH, Razavi MR, Parivar K, Moslemi E, Werngren J. Evaluation of loop mediated isothermal amplification for diagnosis of Mycobacterium tuberculosis complex in clinical samples. Afr J Biotechnol 2011;10:5096e101. 38. Greco S, Rulli M, Girardi E, Piersimoni C, Saltini C. Diagnostic accuracy of in-house PCR for pulmonary tuberculosis in smear-positive patients: metaanalysis and metaregression. J Clin Microbiol 2009;47(3):569e76.