Cell Biology International ISSN 1065-6995 doi: 10.1002/cbin.10269
SHORT COMMUNICATION
Long-term exposure of 3T3 fibroblast cells to endocrine disruptors alters sensitivity to oxidative injury Yuka Nishimura, Yasuyoshi Nakai, Aiko Tanaka, Tetsuji Nagao and Nobuyuki Fukushima* Department of Life Science, Kinki University, 3-4-1 Kowakae, Higashiosaka 577-8502, Japan
Abstract When Swiss 3T3 fibroblasts were exposed to bisphenol A (BPA) or nonylphenol (NP) within a range of 0.1–100 nM for 30–45 days, increased resistance to oxidative injury was found. Western blot analysis indicated concomitant increased expression of bcl-2 protein and reduced histone methylation levels in cells after BPA or NP exposure. Using a heterologous expression system, both chemicals could stimulate G protein-coupled receptor 30 (GPR30), a transmembrane estrogen receptor predominantly expressed in 3T3 cells, at lower concentrations, which gave increased survival. Taken together, these results suggest that BPA or NP exposure might cause alterations in cellular activity against oxidative stress, possibly through GPR30. Keywords: bisphenol A; G protein-coupled receptor 30; nonylphenol; oxidative injury; Swiss 3T3 fibroblast
Introduction A wide variety actions of chemicals with potential endocrine disrupting activities have not only endocrine functions, but neuronal and immune functions in vitro and in vivo (Richter et al., 2007; Wetherill et al., 2007). For example, two representative endocrine disruptors, bisphenol A (BPA) and nonylphenol (NP), show a number in vitro effects, including increased proliferation of cancer cells, enhanced differentiation of adipocytes, induction of cytokine production in immune cells, extracellular-regulated kinase phosphorylation in neural or pituitary cells, and inhibition of cell death in neuronal cells (see references in Wetherill et al., 2007). These various effects of BPA or NP might be mediated by binding to estrogen receptors, ERa or ERb, or estrogenrelated receptor g, ERRg (Kuiper et al., 1997; Takayanagi et al., 2006; Okada et al., 2008). Indeed, BPA inhibits estrogen binding to ERa and ERb with a Ki of 195 and 35 nM, respectively, and higher binding affinity to recombinant ERRg with a Kd of 5.5 nM. G protein-coupled receptor 30 (GPR30) or G protein coupled estrogen receptor 1 is a transmembrane estrogen receptor existing in plasma membranes as well as endoplasmic reticulum, and evidence indicates that BPA and NP bind to GPR30 to activate cyclic AMP (cAMP) production (Revankar et al., 2005; Thomas and Dong, 2006a; Sanden et al., 2011). Endogenous estrogen
shows neuronal cell protection from oxidative injury through activation of cAMP pathway (Green and Simpkins, 2000). In addition to these receptor-mediated actions, BPA has been implicated to act on non-receptor target, such as DNA, leading to induction of double-strand breaks, or unidentified pathway, leading to neurotoxicity (Atkinson and Roy, 1995; Lee et al., 2007). Endocrine disruptors has tended to be focused on their actions at lower concentrations or doses (Komada et al., 2012). We have examined whether long-term exposure to BPA or NP at lower concentrations induces alterations of cell survival or responses to oxidative injury in non-neuronal cells. Swiss 3T3 fibroblast cells were used, which are nontumor cells and widely used in pharmacological and toxicological studies (Vaziri and Faller, 1997; Shaw et al., 1998; Sinnett-Smith et al., 2004; Dekanty et al., 2006; Pennington et al., 2007).
Materials and methods
Chemicals BPA was purchased from Sigma-Aldrich Chemicals (Tokyo, Japan). NP was from Wako Pure Chemicals Industry (Osaka, Japan).
Corresponding author: e-mail: [email protected]
868
Cell Biol Int 38 (2014) 868–874 © 2014 International Federation for Cell Biology
Y. Nishimura et al.
Cell culture Swiss 3T3 fibroblast cells or rat hepatoma RH7777 cells were maintained in phenol red-free Dulbecco’s modified Eagle’s medium (D-MEM, Wako Pure Chemicals Industry) containing 10% charcoal-stripped fetal calf serum (FCS). In some experiments, cells were cultured in D-MEM containing phenol red and FCS. For exposure, cells were plated at 30,000 cells per well in 24-well plates and cultured in the presence of BPA or NP at the concentrations indicated. Every 3–4 days, cells were split, replated in fresh wells, and cultured with the same compounds until cell death or growth was assayed. In 1-day exposures, cells were cultured for 2 days before BPA was added for 1 further day, followed by cell death assay. Establishment of RH7777 cells expressing FLAG-tagged GPR30 required retroviral infection followed by single cell cloning (Shano et al., 2008).
RT-PCR Total RNAs were extracted from cells, treated with RNasefree DNase (Invitrogen, Tokyo, Japan) and reversetranscribed with oligo(dT)12–18 and reverse transcriptase (cDNA synthesis kit, Roche, Tokyo). The resulting cDNAs were amplified by PCR using GoTaq DNA polymerase (Promega, Tokyo, Japan) for Esr1, Esr2, Esrra, Esrrb, Esrrg, or GPR30, which encoded ERa, ERb, ERRa, ERRb, ERRg, or GPR30, respectively. The combinations of primers used were as follows: ERa-s1 (sense, tgccctactacctggagaac) and ERa-as1 (antisense, ccaacaaggcactgaccatc) for Esr1, producing a 579-bp product; ERb-s1 (sense, cagccctgttactagtcc) and ERb-as1 (antisense, tctctcctggatccacac) for Esr2, producing a 264-bp product; mrEsrra-s1 (sense, gacagtccaaagggttcctc) and mrEsrra-as1 (antisense, gcttggtgatctcacactca) for Esrra, producing a 316-bp product; mrEsrrb-s1 (sense, tggcagatcgggagcttgtg) and mrEsrrb-as1 (antisense, aggcgagagtgttcctcatcc) for Esrrb, producing a 205-bp product; mrEsrrg-s1 (sense, atgcccaagagactgtgctt) and mrEsrrg-as1 (antisense, cagcatgcccactttgagac) for Esrrg, producing a 216bp product; GPR30mrh-s1 (sense, ggctttgtgggcaacatcc) and GPR30mrh-as1 (antisense, gacgctgctgtacatgttgatctg) for Gpr30, producing a 219-bp product. The cycling protocol was 60 s at 94 C, followed by 35 cycles of 30 s at 94 C, 30 s at 55 C, and 90 s at 72 C, followed by 7 min at 72 C at the end of the cycling. PCR products were analyzed on 1% agarose gel electrophoresis.
Cell death assay Cells were plated at 8,000 cells per well of 48-well plates, and cultured for 1 day. Cells were washed and cultured in serum-free D-MEM without chemicals. After 3 h, H2O2 was added and cultured for a further 2 days. The number of Cell Biol Int 38 (2014) 868–874 © 2014 International Federation for Cell Biology
Long-term exposure of 3T3 fibroblasts to EDs
viable cells was counted using Cell Counting Kit-8 (Dojin Chemistry Lab., Kumamoto, Japan). The experiments were all done in triplicate or quadruplicate and repeated at least three times.
Cell growth assay Cells were plated at 8,000 cells per well of 48-well plates, and cultured in growth medium without chemicals. The number of viable cells was counted using Cell Counting Kit-8. The experiments were done in triplicate or quadruplicate and repeated twice.
Western blot analyses Cells were washed with phosphate-buffered saline and directly lysed with 2 SDS-sample buffer. The lysates were sonicated, heated, and separated in polyacrylamide gels. The proteins were transferred to PVDF membranes (GE Healthcare, Tokyo, Japan). Bcl-2 or methylated histone H3 was detected using an anti-Bcl-2 antibody (50 ng/ml, Santa Cruz Biotechnology, Santa Cruz, CA) or anti-monomethyl histone H3 (lys9) antibody (MAB Institute, Sapporo, Japan), respectively. Bound antibodies were visualized with a peroxidase-labeled, anti-mouse IgG antibody (100 ng/ml, Jackson ImmunoResearch Laboratories, West Groves, PA) and Chemilumi super (Nacalai Tesque, Kyoto, Japan). The same PVDF membranes, from which bound antibodies were stripped, were reprobed with an anti-a-tubulin DM1A antibody (50 ng/ml, BioCarta, San Diego, CA) to detect a-tubulin. For detection of FLAG-GPR30, cells were homogenized in TED buffer (20 mM Tris–Cl, 1 mM EDTA, 1 mM dithiothreitol (DTT), pH 7.5) containing 1 protease inhibitor cocktail (Nacalai Tesque). The homogenates were centrifuged at 800g for 5 min, and the supernatants were centrifuged at 20,000g for 20 min. The cell membranes (50 mg) were subjected to Western blotting using anti-DYK antibody (100 ng/ml, Wako Pure Chemicals Industry).
Densitometric analysis For densitometric analysis, chemiluminescence was detected by exposing the membranes to X-ray films (RX-U, Fuji Film, Tokyo, Japan) for 15–180 s before development. Exposure times that did not saturate the signal in the darkest band on each gel were used for the quantitative analysis of signals. The developed film was digitized using a flat-bet scanner (GT9400UF, Epson, Japan) and densitometric and quantitative analysis of signals was performed using ImageJ (NIH).
[35S]-GTPgS binding [35S]-GTPgS binding was assayed as previously described (Shano et al., 2008). 869
Y. Nishimura et al.
Long-term exposure of 3T3 fibroblasts to EDs
[35S]-GTPgS binding and [35S]-GTPgS binding were assayed as previously described (Shano et al., 2008). Cell membranes (50 mg) were incubated with 0.1 nM [35S]-GTPgS (0.1 mCi per assay, American Radiolabeled Chemicals, St. Louis, MO), 10 mM GDP, and drugs at 32 C for 30 min in binding buffer (20 mM HEPES-Na, 100 mM NaCl, 1 mM EDTA, 10 mM MgCl2, 1 mM DTT, pH 7.5) containing 0.05% fatty acid-free bovine serum albumin (Nacalai Tesque). The bound [35S]-GTPgS was separated from free by rapid filtration through GF/C filters, which were counted by liquid scintillation.
Statistical Analysis Analysis of variance (ANOVA) followed by a post hoc test was applied to data to determine statistical significance by using StatView 4.5 statistical software (Abacus Concepts, Berkeley, CA). Results
Expression of Gpr30 gene in Swiss 3T3 fibroblast cells RT-PCR showed that Swiss 3T3 fibroblast cells expressed Gpr30 gene, but not Esr1, Esr2, or Esrrg genes (Figure 1). Although they also expressed Esrra and Esrrb genes, their endogenous ligands have yet been unidentified and BPA has not been known to bind to ERRa or ERRb. Thus, the use of 3T3 fibroblasts would provide some hint for understanding the mechanisms mediated through GPR30 or the nonestrogenic pathway.
Effects of BPA or NP exposure on H2O2-induced cell death and bcl-2 expression in 3T3 fibroblasts We examined whether BPA or NP treatment of 3T3 fibroblasts affected the susceptibility against oxidative stress. When control 3T3 fibroblasts were serum-deprived and treated with H2O2 to cause oxidative injury, cell death occurred in a concentration-dependent manner, with an
EC50 of 30 mM (Figure 2A). 3T3 fibroblasts were exposed to varying concentrations of BPA for 30–45 days before measuring cell death. Cells treated with 1 nM BPA were resistant to 30 mM H2O2-induced cell death (Figure 2B). Similar increased resistance was seen in cells were exposed to NP for the same period (Figure 2C). Therefore, long-term exposure of 3T3 fibroblasts to BPA or NP influence mechanisms sensitive to oxidative injury. We also examined the expression of bcl-2, an antiapoptotic protein, because increased expression protects 3T3 fibroblasts from H2O2-induced cell death (Wang et al., 1998). Thirty to 40 days exposure to BPA or NP increased the expression of bcl-2 protein in 3T3 fibroblasts (Figure 2D). BPA affects gene expression via epigenetic pathways (Kundakovic and Champagne, 2011; Singh and Li, 2012), and regulation of bcl-2 expression by histone methylation has also been reported in breast cancer cells (Svotelis et al., 2011). Therefore, we checked whether histone methylation was altered by exposure to BPA or NP in 3T3 fibroblasts. One to 2 weeks exposure resulted in decrease of histone H3 methylation (Figure 2E). In contrast to enhanced survival, cell proliferation remained unchanged by BPA or NP exposure (Figure 2F). No oncogenic characteristic, such as colony formation, piling up of cells or loss of contact inhibition, was also seen in cells exposed to these chemicals for over 1 month (Figure 2G). The same cell death assay was used on 3T3 fibroblasts cultured with or without BPA or NP in D-MEM containing phenol red and FCS. Similar to the results in Figure 2, BPA exposure for 1 week or 1 month, but not 1 day, caused resistance to H2O2 treatment in a concentration-dependent or inverted “U” shape manner within a range of 0.1–100 nM (Figures 3A–3C). One-week exposure of 3T3 fibroblasts to NP also resulted in increase of cell viability against H2O2 treatment in an inverted “U” shape manner (Figure 3D). This finding suggests that phenol red or other small molecules, including steroid hormones present in FCS, have no clear influence on BPA- or NP-induced effects under our culture conditions.
Effects of BPA on GPR30 activation
Figure 1 Swiss 3T3 fibroblasts express Gpr30 gene. Total RNAs were extracted from cells, or mouse hippocampus (Hip) or cerebral cortex (Cor), and run through RT-PCR to detect genes of estrogen receptors (Esr1 and Esr2), Gpr30, estrogen-related receptors (Esrra, Esrrb, Esrrg).
870
Given that Swiss 3T3 fibroblasts expressed only Gpr30 gene (Figure 1), encoded GPR30 receptor would be a strong candidate for mediating the effect of BPA or NP. Previously, both compounds were thought to activate GPR30 using a homologous expression system where HEK293 cells endogenously expressed Gpr30 (our unpublished data). Thus, we developed a heterologous expression system to examine whether BPA or NP could activate GPR30 by searching several cell types that showed no endogenous Gpr30 gene expression. One subline did not express the Gpr30 gene. We Cell Biol Int 38 (2014) 868–874 © 2014 International Federation for Cell Biology
Y. Nishimura et al.
Long-term exposure of 3T3 fibroblasts to EDs
Figure 2 Long-term exposure to bisphenol A or nonylphenol ameliorates H2O2-induced cell death in 3T3 fibroblasts. (A) Effects of H2O2 treatment on 3T3 cell survival. Fibroblasts were treated with varying concentrations of H2O2 for 2 days and the number of cells were determined. Data express % of control (no H2O2) and are the mean SD of quadruplicates determinations. (B) Effects of 30–45 days exposure to varying concentrations of bisphenol A on H2O2-induced cell death. Fibroblasts were treated with 30 mM H2O2 for 2 days. Data express % of no H2O2 treatment in each group, and are the mean SEM of five independent experiments. *P < 0.05 versus no H2O2. (C) Effects of 30–45 days exposure to varying concentrations of nonylphenol on H2O2-induced cell death. Fibroblasts were treated with 30 mM H2O2 for 2 days. Data express % of no H2O2 treatment in each group, and are the mean SEM of five independent experiments. *P < 0.05 versus no H2O2. (D) Effects of bisphenol A or nonylpnehol on bcl-2 expression in 3T3 fibroblasts. 3T3 fibroblasts were exposed to bisphenol A (BPA) or nonylphenol (NP) for 30–40 days, and assayed by Western blotting for bcl-2 and atubulin. The ratio of bcl-2 to a-tubulin was determined. Data express % of control, and are the mean SEM of five independent experiments. * P
SHORT COMMUNICATION
Long-term exposure of 3T3 fibroblast cells to endocrine disruptors alters sensitivity to oxidative injury Yuka Nishimura, Yasuyoshi Nakai, Aiko Tanaka, Tetsuji Nagao and Nobuyuki Fukushima* Department of Life Science, Kinki University, 3-4-1 Kowakae, Higashiosaka 577-8502, Japan
Abstract When Swiss 3T3 fibroblasts were exposed to bisphenol A (BPA) or nonylphenol (NP) within a range of 0.1–100 nM for 30–45 days, increased resistance to oxidative injury was found. Western blot analysis indicated concomitant increased expression of bcl-2 protein and reduced histone methylation levels in cells after BPA or NP exposure. Using a heterologous expression system, both chemicals could stimulate G protein-coupled receptor 30 (GPR30), a transmembrane estrogen receptor predominantly expressed in 3T3 cells, at lower concentrations, which gave increased survival. Taken together, these results suggest that BPA or NP exposure might cause alterations in cellular activity against oxidative stress, possibly through GPR30. Keywords: bisphenol A; G protein-coupled receptor 30; nonylphenol; oxidative injury; Swiss 3T3 fibroblast
Introduction A wide variety actions of chemicals with potential endocrine disrupting activities have not only endocrine functions, but neuronal and immune functions in vitro and in vivo (Richter et al., 2007; Wetherill et al., 2007). For example, two representative endocrine disruptors, bisphenol A (BPA) and nonylphenol (NP), show a number in vitro effects, including increased proliferation of cancer cells, enhanced differentiation of adipocytes, induction of cytokine production in immune cells, extracellular-regulated kinase phosphorylation in neural or pituitary cells, and inhibition of cell death in neuronal cells (see references in Wetherill et al., 2007). These various effects of BPA or NP might be mediated by binding to estrogen receptors, ERa or ERb, or estrogenrelated receptor g, ERRg (Kuiper et al., 1997; Takayanagi et al., 2006; Okada et al., 2008). Indeed, BPA inhibits estrogen binding to ERa and ERb with a Ki of 195 and 35 nM, respectively, and higher binding affinity to recombinant ERRg with a Kd of 5.5 nM. G protein-coupled receptor 30 (GPR30) or G protein coupled estrogen receptor 1 is a transmembrane estrogen receptor existing in plasma membranes as well as endoplasmic reticulum, and evidence indicates that BPA and NP bind to GPR30 to activate cyclic AMP (cAMP) production (Revankar et al., 2005; Thomas and Dong, 2006a; Sanden et al., 2011). Endogenous estrogen
shows neuronal cell protection from oxidative injury through activation of cAMP pathway (Green and Simpkins, 2000). In addition to these receptor-mediated actions, BPA has been implicated to act on non-receptor target, such as DNA, leading to induction of double-strand breaks, or unidentified pathway, leading to neurotoxicity (Atkinson and Roy, 1995; Lee et al., 2007). Endocrine disruptors has tended to be focused on their actions at lower concentrations or doses (Komada et al., 2012). We have examined whether long-term exposure to BPA or NP at lower concentrations induces alterations of cell survival or responses to oxidative injury in non-neuronal cells. Swiss 3T3 fibroblast cells were used, which are nontumor cells and widely used in pharmacological and toxicological studies (Vaziri and Faller, 1997; Shaw et al., 1998; Sinnett-Smith et al., 2004; Dekanty et al., 2006; Pennington et al., 2007).
Materials and methods
Chemicals BPA was purchased from Sigma-Aldrich Chemicals (Tokyo, Japan). NP was from Wako Pure Chemicals Industry (Osaka, Japan).
Corresponding author: e-mail: [email protected]
868
Cell Biol Int 38 (2014) 868–874 © 2014 International Federation for Cell Biology
Y. Nishimura et al.
Cell culture Swiss 3T3 fibroblast cells or rat hepatoma RH7777 cells were maintained in phenol red-free Dulbecco’s modified Eagle’s medium (D-MEM, Wako Pure Chemicals Industry) containing 10% charcoal-stripped fetal calf serum (FCS). In some experiments, cells were cultured in D-MEM containing phenol red and FCS. For exposure, cells were plated at 30,000 cells per well in 24-well plates and cultured in the presence of BPA or NP at the concentrations indicated. Every 3–4 days, cells were split, replated in fresh wells, and cultured with the same compounds until cell death or growth was assayed. In 1-day exposures, cells were cultured for 2 days before BPA was added for 1 further day, followed by cell death assay. Establishment of RH7777 cells expressing FLAG-tagged GPR30 required retroviral infection followed by single cell cloning (Shano et al., 2008).
RT-PCR Total RNAs were extracted from cells, treated with RNasefree DNase (Invitrogen, Tokyo, Japan) and reversetranscribed with oligo(dT)12–18 and reverse transcriptase (cDNA synthesis kit, Roche, Tokyo). The resulting cDNAs were amplified by PCR using GoTaq DNA polymerase (Promega, Tokyo, Japan) for Esr1, Esr2, Esrra, Esrrb, Esrrg, or GPR30, which encoded ERa, ERb, ERRa, ERRb, ERRg, or GPR30, respectively. The combinations of primers used were as follows: ERa-s1 (sense, tgccctactacctggagaac) and ERa-as1 (antisense, ccaacaaggcactgaccatc) for Esr1, producing a 579-bp product; ERb-s1 (sense, cagccctgttactagtcc) and ERb-as1 (antisense, tctctcctggatccacac) for Esr2, producing a 264-bp product; mrEsrra-s1 (sense, gacagtccaaagggttcctc) and mrEsrra-as1 (antisense, gcttggtgatctcacactca) for Esrra, producing a 316-bp product; mrEsrrb-s1 (sense, tggcagatcgggagcttgtg) and mrEsrrb-as1 (antisense, aggcgagagtgttcctcatcc) for Esrrb, producing a 205-bp product; mrEsrrg-s1 (sense, atgcccaagagactgtgctt) and mrEsrrg-as1 (antisense, cagcatgcccactttgagac) for Esrrg, producing a 216bp product; GPR30mrh-s1 (sense, ggctttgtgggcaacatcc) and GPR30mrh-as1 (antisense, gacgctgctgtacatgttgatctg) for Gpr30, producing a 219-bp product. The cycling protocol was 60 s at 94 C, followed by 35 cycles of 30 s at 94 C, 30 s at 55 C, and 90 s at 72 C, followed by 7 min at 72 C at the end of the cycling. PCR products were analyzed on 1% agarose gel electrophoresis.
Cell death assay Cells were plated at 8,000 cells per well of 48-well plates, and cultured for 1 day. Cells were washed and cultured in serum-free D-MEM without chemicals. After 3 h, H2O2 was added and cultured for a further 2 days. The number of Cell Biol Int 38 (2014) 868–874 © 2014 International Federation for Cell Biology
Long-term exposure of 3T3 fibroblasts to EDs
viable cells was counted using Cell Counting Kit-8 (Dojin Chemistry Lab., Kumamoto, Japan). The experiments were all done in triplicate or quadruplicate and repeated at least three times.
Cell growth assay Cells were plated at 8,000 cells per well of 48-well plates, and cultured in growth medium without chemicals. The number of viable cells was counted using Cell Counting Kit-8. The experiments were done in triplicate or quadruplicate and repeated twice.
Western blot analyses Cells were washed with phosphate-buffered saline and directly lysed with 2 SDS-sample buffer. The lysates were sonicated, heated, and separated in polyacrylamide gels. The proteins were transferred to PVDF membranes (GE Healthcare, Tokyo, Japan). Bcl-2 or methylated histone H3 was detected using an anti-Bcl-2 antibody (50 ng/ml, Santa Cruz Biotechnology, Santa Cruz, CA) or anti-monomethyl histone H3 (lys9) antibody (MAB Institute, Sapporo, Japan), respectively. Bound antibodies were visualized with a peroxidase-labeled, anti-mouse IgG antibody (100 ng/ml, Jackson ImmunoResearch Laboratories, West Groves, PA) and Chemilumi super (Nacalai Tesque, Kyoto, Japan). The same PVDF membranes, from which bound antibodies were stripped, were reprobed with an anti-a-tubulin DM1A antibody (50 ng/ml, BioCarta, San Diego, CA) to detect a-tubulin. For detection of FLAG-GPR30, cells were homogenized in TED buffer (20 mM Tris–Cl, 1 mM EDTA, 1 mM dithiothreitol (DTT), pH 7.5) containing 1 protease inhibitor cocktail (Nacalai Tesque). The homogenates were centrifuged at 800g for 5 min, and the supernatants were centrifuged at 20,000g for 20 min. The cell membranes (50 mg) were subjected to Western blotting using anti-DYK antibody (100 ng/ml, Wako Pure Chemicals Industry).
Densitometric analysis For densitometric analysis, chemiluminescence was detected by exposing the membranes to X-ray films (RX-U, Fuji Film, Tokyo, Japan) for 15–180 s before development. Exposure times that did not saturate the signal in the darkest band on each gel were used for the quantitative analysis of signals. The developed film was digitized using a flat-bet scanner (GT9400UF, Epson, Japan) and densitometric and quantitative analysis of signals was performed using ImageJ (NIH).
[35S]-GTPgS binding [35S]-GTPgS binding was assayed as previously described (Shano et al., 2008). 869
Y. Nishimura et al.
Long-term exposure of 3T3 fibroblasts to EDs
[35S]-GTPgS binding and [35S]-GTPgS binding were assayed as previously described (Shano et al., 2008). Cell membranes (50 mg) were incubated with 0.1 nM [35S]-GTPgS (0.1 mCi per assay, American Radiolabeled Chemicals, St. Louis, MO), 10 mM GDP, and drugs at 32 C for 30 min in binding buffer (20 mM HEPES-Na, 100 mM NaCl, 1 mM EDTA, 10 mM MgCl2, 1 mM DTT, pH 7.5) containing 0.05% fatty acid-free bovine serum albumin (Nacalai Tesque). The bound [35S]-GTPgS was separated from free by rapid filtration through GF/C filters, which were counted by liquid scintillation.
Statistical Analysis Analysis of variance (ANOVA) followed by a post hoc test was applied to data to determine statistical significance by using StatView 4.5 statistical software (Abacus Concepts, Berkeley, CA). Results
Expression of Gpr30 gene in Swiss 3T3 fibroblast cells RT-PCR showed that Swiss 3T3 fibroblast cells expressed Gpr30 gene, but not Esr1, Esr2, or Esrrg genes (Figure 1). Although they also expressed Esrra and Esrrb genes, their endogenous ligands have yet been unidentified and BPA has not been known to bind to ERRa or ERRb. Thus, the use of 3T3 fibroblasts would provide some hint for understanding the mechanisms mediated through GPR30 or the nonestrogenic pathway.
Effects of BPA or NP exposure on H2O2-induced cell death and bcl-2 expression in 3T3 fibroblasts We examined whether BPA or NP treatment of 3T3 fibroblasts affected the susceptibility against oxidative stress. When control 3T3 fibroblasts were serum-deprived and treated with H2O2 to cause oxidative injury, cell death occurred in a concentration-dependent manner, with an
EC50 of 30 mM (Figure 2A). 3T3 fibroblasts were exposed to varying concentrations of BPA for 30–45 days before measuring cell death. Cells treated with 1 nM BPA were resistant to 30 mM H2O2-induced cell death (Figure 2B). Similar increased resistance was seen in cells were exposed to NP for the same period (Figure 2C). Therefore, long-term exposure of 3T3 fibroblasts to BPA or NP influence mechanisms sensitive to oxidative injury. We also examined the expression of bcl-2, an antiapoptotic protein, because increased expression protects 3T3 fibroblasts from H2O2-induced cell death (Wang et al., 1998). Thirty to 40 days exposure to BPA or NP increased the expression of bcl-2 protein in 3T3 fibroblasts (Figure 2D). BPA affects gene expression via epigenetic pathways (Kundakovic and Champagne, 2011; Singh and Li, 2012), and regulation of bcl-2 expression by histone methylation has also been reported in breast cancer cells (Svotelis et al., 2011). Therefore, we checked whether histone methylation was altered by exposure to BPA or NP in 3T3 fibroblasts. One to 2 weeks exposure resulted in decrease of histone H3 methylation (Figure 2E). In contrast to enhanced survival, cell proliferation remained unchanged by BPA or NP exposure (Figure 2F). No oncogenic characteristic, such as colony formation, piling up of cells or loss of contact inhibition, was also seen in cells exposed to these chemicals for over 1 month (Figure 2G). The same cell death assay was used on 3T3 fibroblasts cultured with or without BPA or NP in D-MEM containing phenol red and FCS. Similar to the results in Figure 2, BPA exposure for 1 week or 1 month, but not 1 day, caused resistance to H2O2 treatment in a concentration-dependent or inverted “U” shape manner within a range of 0.1–100 nM (Figures 3A–3C). One-week exposure of 3T3 fibroblasts to NP also resulted in increase of cell viability against H2O2 treatment in an inverted “U” shape manner (Figure 3D). This finding suggests that phenol red or other small molecules, including steroid hormones present in FCS, have no clear influence on BPA- or NP-induced effects under our culture conditions.
Effects of BPA on GPR30 activation
Figure 1 Swiss 3T3 fibroblasts express Gpr30 gene. Total RNAs were extracted from cells, or mouse hippocampus (Hip) or cerebral cortex (Cor), and run through RT-PCR to detect genes of estrogen receptors (Esr1 and Esr2), Gpr30, estrogen-related receptors (Esrra, Esrrb, Esrrg).
870
Given that Swiss 3T3 fibroblasts expressed only Gpr30 gene (Figure 1), encoded GPR30 receptor would be a strong candidate for mediating the effect of BPA or NP. Previously, both compounds were thought to activate GPR30 using a homologous expression system where HEK293 cells endogenously expressed Gpr30 (our unpublished data). Thus, we developed a heterologous expression system to examine whether BPA or NP could activate GPR30 by searching several cell types that showed no endogenous Gpr30 gene expression. One subline did not express the Gpr30 gene. We Cell Biol Int 38 (2014) 868–874 © 2014 International Federation for Cell Biology
Y. Nishimura et al.
Long-term exposure of 3T3 fibroblasts to EDs
Figure 2 Long-term exposure to bisphenol A or nonylphenol ameliorates H2O2-induced cell death in 3T3 fibroblasts. (A) Effects of H2O2 treatment on 3T3 cell survival. Fibroblasts were treated with varying concentrations of H2O2 for 2 days and the number of cells were determined. Data express % of control (no H2O2) and are the mean SD of quadruplicates determinations. (B) Effects of 30–45 days exposure to varying concentrations of bisphenol A on H2O2-induced cell death. Fibroblasts were treated with 30 mM H2O2 for 2 days. Data express % of no H2O2 treatment in each group, and are the mean SEM of five independent experiments. *P < 0.05 versus no H2O2. (C) Effects of 30–45 days exposure to varying concentrations of nonylphenol on H2O2-induced cell death. Fibroblasts were treated with 30 mM H2O2 for 2 days. Data express % of no H2O2 treatment in each group, and are the mean SEM of five independent experiments. *P < 0.05 versus no H2O2. (D) Effects of bisphenol A or nonylpnehol on bcl-2 expression in 3T3 fibroblasts. 3T3 fibroblasts were exposed to bisphenol A (BPA) or nonylphenol (NP) for 30–40 days, and assayed by Western blotting for bcl-2 and atubulin. The ratio of bcl-2 to a-tubulin was determined. Data express % of control, and are the mean SEM of five independent experiments. * P
