Fish & Shellfish Immunology 38 (2014) 15e24
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Liposome-encapsulated cinnamaldehyde enhances zebrafish (Danio rerio) immunity and survival when challenged with Vibrio vulnificus and Streptococcus agalactiae Elok Ning Faikoh a, b,1, Yong-Han Hong c,1, Shao-Yang Hu a, * a b c
Department of Biological Science and Technology, National Pingtung University of Science and Technology, Pingtung 912, Taiwan Department of Water Resources Management, Marine and Fisheries Faculty, University of Brawijaya, Indonesia Department of Nutrition, I-Shou University, Kaohsiung 824, Taiwan
a r t i c l e i n f o
a b s t r a c t
Article history: Received 3 December 2013 Received in revised form 27 February 2014 Accepted 28 February 2014 Available online 12 March 2014
Cinnamaldehyde, which is extracted from cinnamon, is a natural compound with activity against bacteria and a modulatory immune function. However, the antibacterial activity and immunostimulation of cinnamaldehyde in fish has not been well investigated due to the compound’s poor water solubility. Thus, liposome-encapsulated cinnamaldehyde (LEC) was used to evaluate the effects of cinnamaldehyde on in vitro antibacterial activity against aquatic pathogens and in vivo immunity and protection parameters against Vibrio vulnificus and Streptococcus agalactiae. The minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) as well as bactericidal agar plate assay results demonstrated the effective bacteriostatic and bactericidal potency of LEC against Aeromonas hydrophila, V. vulnificus, and S. agalactiae, as well as the antibiotic-resistant Vibrio parahaemolyticus and Vibrio alginolyticus. Bacteria challenge test results demonstrated that LEC significantly enhances the survival rate and inhibits bacterial growth in zebrafish infected with A. hydrophila, V. vulnificus, and S. agalactiae. A gene expression study using a real-time PCR showed that LEC immersion-treated zebrafish had increased endogenous interleukin (IL)-1b, IL-6, IL-15, IL-21, tumor necrosis factor (TNF)-a, and interferon (INF)-g expression in vivo. After the zebrafish were infected with V. vulnificus or S. agalactiae, the LEC immersion treatment suppressed the expression of the inflammatory cytokines IL-1b, IL-6, IL-15, NF-kb, and TNF-a and induced IL-10 and C3b expression. These findings demonstrate that cinnamaldehyde exhibits antimicrobial activity against aquatic pathogens, even antibiotic-resistant bacterial strains and immunestimulating effects to protect the host’s defenses against pathogen infection in bacteria-infected zebrafish. These results suggest that LEC could be used as an antimicrobial agent and immunostimulant to protect bacteria-infected fish in aquaculture. Ó 2014 Elsevier Ltd. All rights reserved.
Keywords: Cinnamaldehyde Liposome Antimicrobial activity Immune response Danio rerio
1. Introduction During the past decade, diseases induced by bacteria, fungi, viruses, and parasites have caused severe economic loss in the aquaculture industry. Among such diseases, bacterial infections are the most important disease source in fish and shellfish species [1]. For instance, vibriosis is associated with an increased Gram-
* Corresponding author. Department of Biological Science and Technology, National Pingtung University of Science and Technology, No. 1, Hseufu Road, Neipu, Pingtung 912, Taiwan. Tel.: þ886 8 7703202x6356; fax: þ886 8 7740584. E-mail addresses: [email protected], [email protected] (S.-Y. Hu). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.fsi.2014.02.024 1050-4648/Ó 2014 Elsevier Ltd. All rights reserved.
negative Vibrio population in culture pond water. Vibrio vulnificus often causes invasive septicemia and is highly lethal in aquatic animals Vibrio parahaemolyticus and Vibrio alginolyticus seriously retard growth and induce anorexia and high mortality in shrimp [2,3]. Aeromonas hydrophila tends to be virulent toward most cultured and wild freshwater fish and is primarily associated with red fin diseases and hemorrhagic septicemia [4,5]. Gram-positive Streptococcus agalactiae causes meningoencephalitis and septicemia with high morbidity and mortality in many marine and freshwater fish species [6,7]. Thus, antibiotics and other therapeutic agents are widely used in aquaculture worldwide for prophylactic and therapeutic purposes. However, the indiscriminate application of such therapeutic chemicals has precipitated the rapid development and spread of various antibiotic-resistant pathogens in
16
E.N. Faikoh et al. / Fish & Shellfish Immunology 38 (2014) 15e24
exposed microbial ecosystems, has reduced the antibiotic treatment efficacy, has produced residual antibiotics in aquatic products and potential environmental hazards, and has enhanced public health risks [8]. Therefore, for a more sustainable aquaculture industry, alternative approaches to controlling pathogen infections are necessary and urgent. Several strategies have been developed to control bacterial infection, such as DNA vaccines [9], immunostimulants [10], antimicrobial peptides [11], and probiotics [12]. Among the alternatives to antibiotics, emerging approaches include plant extracts and their constituent active compounds, which have been used as antimicrobials to inhibit bacterial growth or immunostimulants to enhance the host’s defenses [13e15]. Cinnamaldehyde is a major constituent of cinnamon (Cinnamomum verum), which is a widely used flavoring compound that has traditionally been used to treat human diseases, including dyspepsia, gastritis, and inflammatory diseases. Studies have demonstrated that cinnamaldehyde exhibits antioxidant [16], antimicrobial [17], anti-inflammatory [18], and anticancer activity [19], and the compound has been classified as a generally recognized as safe (GRAS) molecule for food preservation by the United States Food and Drug Administration [20]. The bactericidal mechanism of cinnamaldehyde has been demonstrated through damaging bacterial cell membranes and disrupting cellular metabolism and energy generation [21,22]. Furthermore, cinnamaldehyde exhibits anti-inflammatory properties and immunity enhancement efficacy through inhibiting pro-inflammatory cytokine secretion from monocytes and macrophages in vitro and in vivo [18,23]. The benefits and biological functions of cinnamaldehyde and its derivatives have been widely applied for diverse purposes, including food preservation through inhibiting foodborne pathogen growth [24], preventing avian coccidiosis and intestinal spirochetosis [23,25], disease resistance in plants [26], and clinical applications [27,28]. However, although several studies show potentially diverse applications for cinnamaldehyde, thus far, the practical applications in fish and shellfish species have not been thoroughly investigated. A recent investigation demonstrated that essential oil extracted from Cinnamosma fragrans can significantly control bacterial loads and enhance Penaeus monodon larvae survival rates, which suggests a novel alternative to antibiotics in shrimp hatchery culture and implies that cinnamaldehyde may be developed as an antibacterial agent against aquatic pathogens in aquaculture [28,29]. Hence, a study to demonstrate the antimicrobial activity and immunomodulatory function of cinnamaldehyde for disease resistance in fish is imperative. Zebrafish have been extensively used as models for studying human disease, vertebrate development and aquaculture research, and has recently also provided a suitable system to study the effects of immunostimulants on innate immune response and infectious diseases [30]. For instance, the activation of pro-inflammatory factor expression and an increase in the survival rate induced by bath vaccination with a live attenuated bacterial vaccine and the oral administration of recombinant antimicrobial peptide were respectively demonstrated in zebrafish [31,32]. Regarding the immunostimulatory effect of plant extracts, most investigations were performed in food fish species for practical application in aquaculture [14,33,34]. In the present study, zebrafish were used as a model to investigate the immunostimulatory function of cinnamaldehyde. In general, cinnamaldehyde should be given to aquatic animals through oral administration or direct mixture with feed ingredients. However, the feeding behavior of aquatic animals and the mixed feed consistency are issues due to the compound’s stimulating flavor and poor water solubility, respectively. Herein, liposome-encapsulated cinnamaldehyde (LEC) was developed to increase the compound’s water solubility, and its bacteriostatic and bactericidal activity against aquatic pathogens, including
A. hydrophila, S. agalactiae, V. vulnificus, V. parahaemolyticus, and V. alginolyticus, were evaluated. The efficacy of cinnamaldehyde in enhancing zebrafish survival rates was using V. vulnificus- and S. agalactiae-challenged zebrafish; the cinnamaldehyde-mediated immune responses of these fish were also investigated. These experiments could to shed light on cinnamaldehyde’s antimicrobial activity and its function in stimulating immunity for future aquaculture applications. 2. Materials and methods 2.1. Animals and bacterial strains Adult AB-strain zebrafish (Danio rerio) were acquired from the Taiwan Zebrafish Core Facility at Academia Sinica (Taipei, Taiwan). The fish were raised in 10-L tanks and maintained at 28 C in recirculating freshwater with a controlled light cycle (14 h light/ 10 h dark). The fish were fed daily with commercial pellet (Taikong, Taiper, Taiwan). All zebrafish were handled in compliance with the local animal welfare regulations and maintained according to standard protocols (http://ZFIN.org). The Gram-negative A. hydrophila, V. vulnificus, V. parahaemolyticus, and V. alginolyticus used herein were kindly provided by Dr. Chung-Hung Liu, Department of Aquaculture, National Pingtung University of Science and Technology, Pingtung, Taiwan. The Gram-positive S. agalactiae was kindly provided by Dr. Jyh-Yih Chen, Marine Research Station, Institute of Cellular and Organismic Biology, Academia Sinica, Ilan, Taiwan. The bacterial cells used in the bacteriostatic and bactericidal assays were stored in a glycerol stock at 20 C until use. 2.2. LEC preparation Cinnamaldehyde (2E-3-phenylprop-2-enal) (CAS RN: 104-55-2) was purchased from Panreac Quimica (Barcelona, Catalonia, Spain) and encapsulated in liposomes using high-pressure homogenization (HPH) via the following procedure: Six percent (wt/v) cinnamaldehyde, 10% (v/v) lecithin, and 0.5% (v/v) a-tocopherol were gently mixed in 5% ethanol, which was supplemented with potassium dihydrogen phosphate to maintain the mixture’s pH at 6.7. The mixed solution was processed into LEC using an HPH M-110P Microfluidizer (Microfluidics, Newton, MA, USA) with a fixed pressure of approximately 5000e30,000 psi and a 50e100 mL/min flow rate. The LEC was replaced with an equal volume of pure water, which is referred to as LE and was used as a control. 2.3. Determining the MIC and MBC of LEC Three microliters from the cell stocks containing V. vulnificus, V. parahaemolyticus, and V. alginolyticus were used to inoculate a 15-mL tube with 3 mL tryptic soy broth (TSB) medium supplemented with 1.5% NaCl in a shaking incubator at 150 rpm and 28 C. After 12 h of cultivation, 3 mL of culture was transferred to the same medium and incubated for 9 h under the same conditions as the seed culture. For A. hydrophila and S. agalactiae, the culture conditions were the same as for V. vulnificus, with the exception that the TBS medium did not include 1.5% NaCl. A modified resazurin assay was performed using sterile 96-well plates to determine the MIC and MBC for each bacteria sample examined (n ¼ 3) [35]. Resazurin was acquired from Sigma Chemicals (R-7017, St. Louis, MO., USA) and prepared as a 0.25 mg/mL sterile solution in water. The seed culture for each bacterial cell sample was diluted in individual culture broth samples at a cell density of 1 107 CFU/mL. A reaction mixture composed of 100 mL per well with 10 mL diluted seed culture, 67 mL individual culture broth, 13 mL resazurin solution, and 10 mL of various concentrations of LEC samples was cultured at
E.N. Faikoh et al. / Fish & Shellfish Immunology 38 (2014) 15e24
28 C for 12 h. Sterile water and the diluted LE that corresponded to the LEC concentration were used as a negative control. Ampicillin (Sigma A-0166), kanamycin (Sigma K-4000), and tetracycline (Sigma T-7660) with the respective bacterial strains over a serial concentration range were used as positive controls. After incubation, the color change from dark green to pink was visually assessed and compared with the negative control, which was dark green. The MIC value was defined as the lowest LEC concentration that prevented a color change in the test well. The MBC was determined by taking the entire sample from each well with a dark green color and streaking it on a TSB agar plate supplemented with or without 1.5% NaCl and then incubating the sample at 28 C for 24 h. The MBC value was defined as the lowest LEC concentration at which colonies did not form on the agar plate.
2.4. Bactericidal agar plate assay The antibacterial efficacy of LEC against A. hydrophila, V. vulnificus, V. parahaemolyticus, V. alginolyticus and S. agalactiae was evaluated via a bactericidal agar plate assay. One milliliter of seed culture for each bacterial sample was added to one liter of TSB broth with 1.5% (w/v) agar and 1.5% NaCl for V. vulnificus, V. parahaemolyticus, and V. alginolyticus or without NaCl for A. hydrophila and S. agalactiae and then mixed thoroughly. Twenty milliliters of the liquid agar plate was then poured into a Petri dish (90 15 mm). To determine the inhibition zone diameter, the LEC and LE were diluted 10-fold in sterile water, and 20 mL of the diluted LEC or LE were then placed on a piece of 0.7 cm-diameter filter paper positioned on the TSB plate with the bacteria sample and incubated for 24 h at 28 C. The LEC bactericidal efficacy against A. hydrophila, V. vulnificus, and S. agalactiae was determined through comparison with the inhibition zone diameters for 2 mg, 4 mg, 6 mg, and 8 mg of ampicillin on the plate.
17
2.5. Evaluating bacteria-challenged zebrafish survival rates with LEC Adult zebrafish (approximately 4.12 0.3 cm body length and 0.85 0.12 g body weight) were individually cultured in a 10-L aquarium tank (n ¼ 20 for each tank) for the bacteria challenge. A seed culture from each bacterial strain was diluted in the appropriate volume of PBS buffer. Ten microliters of diluted V. vulnificus (1 106 CFU/mL), A. hydrophila (1 106 CFU/mL), and S. agalactiae (1 107 CFU/mL) were individually injected into the adult zebrafish intraperitoneally. The effect of LEC on the bacteria-challenged zebrafish survival rates was investigated by immersing the bacteria-challenged zebrafish in water with 75 mL/L of LEC or LE. The zebrafish injected with PBS buffer and PBS-containing bacteria without the LEC immersion treatment were used as the positive and negative controls, respectively. The water with LEC or with/ without LE was renewed daily to maintain the water quality and cinnamaldehyde efficacy. The bacteria challenge experiment was repeated three times. Each group’s survival rate was recorded daily after the injection. Student’s t-test was used to statistically analyze and compare two groups. The differences were defined as significant at p < 0.05.
2.6. In vivo LEC bactericidal assay To validate the LEC bactericidal activity in vivo, the bacterial colonies in bacteria-challenged zebrafish, which were generated under the conditions described in Materials and Methods 2.5, were quantified after 12 h, 24 h, and 36 h as follows: a zebrafish was anesthetized in 0.2% tricaine and then euthanized via incubation in ice water for 15 min. Each zebrafish (n ¼ 5) was washed with sterile water twice and then cut into pieces using a sterile clipper. The pieces of each zebrafish were placed into 10 mL of sterile PBS buffer.
Table 1 Primer sequences and gene names. Gene name
Primer sequence (50 / 30 )
PCR size (bp)
Accession number
Interleukin-1b (IL-1b)
TGGACTTCGCAGCACAAAATG CACTTCACGCTCTTGGATGA TCAACTTCTCCAGCGTGATG TCTTTCCCTCTTTTCCTCCTG TCACGTCATGAACGAGATCC CCTCTTGCATTTCACCATATCC ATGTCATTGGAACTCAGAGGTTTG CTGTTCTGGATGTCCTGCTTGA AATCATTCATCGTGGACAGTGTGT AACGTTCGGCTGTTGACCAT AAGGAGAGTTGCCTTTACCG ATTGCCCTGGGTCTTATGG GAGAGGCTGGCACATGTTCA CCCATAGCGTTTCTGCATACG AAGAGGACCAAAATAAGCACAG AAG TCCAAGGTACATCGCCATGA GATCTCCCAAATGCCAAGCA GGGCGAAGAAAGCAAACATG CGTCTCCGTACACCATCCATT GGCGTCTCATCAGGATTTGTTAC CGTGGATGTCCTCGTGTGAA G CCAATGGAGAATCCCTCAAA CAGAGCGAATGGTGCCACTAT GTGGCAGAGGCTCCAGAAGA TGGAGCATCACAGGGATAAAGA TGATGCCCATGCCTGTAAGA TTTCAGATGCCACATCAGA TCCACAAGAACAAGCCTTTG AACAGCTGATCGTTGGAGTCAA TTGATGTATGCGCTGACTTCCT
147
AY340959
73
JN698962
151
BC163031
100
BC162843
100
NM_001128574
152
BC165066
100
AB126869
100
AY163838
100
NM_153657
100
NM_131243
100
NM_139180
Interleukin-6 (IL -6) Interleukin-10 (IL-10) Interleukin-15 (IL-15) Interleukin-21 (IL-21) Tumor necrosis factor-a (TNF-a) Interferon-gamma (INF-g) Nuclear factor-kB (NF-kB) Cyclooxygenase-2 (COX-2) Complement component c3b Lysozyme Toll-like receptor-1 (TLR1) Toll-like receptor-3 (TLR3) Toll-like receptor-4a (TLR4a) Elongation factor 1a (ef-1a)
97
AY389444
100
AY616582
150
EU551724
100
AY422992
18
E.N. Faikoh et al. / Fish & Shellfish Immunology 38 (2014) 15e24
The solutions were mixed using a shaker for 3 h at 28 C; 1 mL from each solution was then collected for a serial dilution. One hundred microliters of each diluted solution were streaked on a TSB agar plate supplemented with or without 1.5% NaCl. The colonies on the plate were counted after the agar plate was cultivated for 24 h at 28 C, and the experiment was repeated three times. Student’s ttest was used to statistically analyze and compare two groups. The differences were defined as significant at p < 0.05. 2.7. Detecting immune-related gene expression through a real-time polymerase chain reaction The total RNA was isolated from the bacteria-challenged zebrafish with the LE or LEC immersion treatment or without the LEC immersion treatment (control group) at 1 h, 6 h, 12 h, and 24 h. The expression levels of IL-1b, IL-6, IL-10, IL-15, and IL-21; complement component C3b, lysozyme, TRL-1, TRL-3, and TRL-4a; and NF-kB, COX-2, TNF-a, and elongation factor 1-a (ef1-a) were determined using quantitative PCR. The ef1-a was used as an internal control. The specific PCR primers used herein are listed in Table 1. Real-time PCR was performed using SYBR Green PCR reagents and an Applied Biosystems StepOnePlus Real-Time PCR system. The cycling profile was as follows: 60 C for 2 min, 95 C for 10 min followed by 40 cycles of denaturing at 95 C for 15 s, and annealing and primer extension at 60 C for 1 min. Equal quantities of the total RNA from the three fish were mixed and examined in triplicate for each condition. The relative expression levels of each group were normalized to ef1-a and expressed as the means standard error (SE). Student’s t-test was used to statistically analyze and compare two groups. Multiple-group comparisons were examined using a one-way analysis of variance (ANOVA), and Tukey’s test was used to evaluate significant differences between groups. The differences were defined as significant at p < 0.05. 3. Results 3.1. The MIC and MBC of LEC Bactericidal activity is a prerequisite for regarding cinnamaldehyde as a natural antimicrobial compound. To estimate cinnamaldehyde’s bacteriostatic and bactericidal activity against diverse aquatic pathogens, the MIC and MBC of LEC were determined using a modified resazurin assay as described in the Materials and Methods section. The results in Table 2 show the LEC antimicrobial activities against Gram-positive and Gram-negative aquatic pathogens. The LEC MICs were 120.3 mg/L for Streptococcus agalactiae and Vibrio alginolyticus, 179.7 mg/L for Aeromonas hydrophila and Vibrio vulnificus, and 59.5 mg/L for Vibrio parahaemolyticus. The LEC MBCs were 179.7 mg/L for S. agalactiae and V. alginolyticus, 239.2 mg/L for A. hydrophila and V. vulnificus, and 120.3 mg/L for V. parahaemolyticus. Antibiotic antimicrobial
potencies against S. agalactiae, A. hydrophila, and V. vulnificus are as follows: kanamycin yielded MICs of 0.5e3 mg/L and MBCs of 2.0e 6.0 mg/L. Ampicillin yielded MICs of 0.67e1.26 mg/L and MBCs of 0.96e1.91 mg/L. Tetracycline yielded MICs of 0.41e0.82 mg/L and MBCs of 0.82e1.24 mg/L. The antibiotics did not exhibit antimicrobial potency against V. parahaemolyticus and V. alginolyticus, which suggests that both pathogen strains are resistant to antibiotics. The antimicrobial potency was compared with that of the antibiotics; although the LEC bacteriostatic and bactericidal potency was lower than kanamycin, ampicillin, and tetracycline, LEC’s bacteriostatic and bactericidal activities against the antibioticresistant pathogens V. parahaemolyticus and V. alginolyticus were impressive. Such results suggest that cinnamaldehyde could replace antibiotics for treating antibiotic-resistant pathogens. 3.2. LEC exhibits efficient potency against aquatic pathogen species To further demonstrate cinnamaldehyde’s antibacterial potency against pathogenic bacteria, the LEC bactericidal activity was examined through an agar plate inhibition zone derived from 20 mL of 10-fold sterile water-diluted LEC (120 mg of cinnamaldehyde). When comparing the control and LE sample results, the obvious inhibition zones on the LEC sample agar plates suggest that the bactericidal activity due to the cinnamaldehyde. Based on the agar plate inhibition zone diameters against pathogens derived from known ampicillin levels, the equation y ¼ 0.0498x þ 0.7225 (R2 ¼ 0.9838) was used to calculate the LEC antimicrobial potency against Aeromonas hydrophila. The antimicrobial activity of 120 mg cinnamaldehyde against A. hydrophila was equivalent to 2.16 mg of ampicillin. Thus, the antibacterial potency for 1 mg cinnamaldehyde against A. hydrophila is equivalent to the potency for 0.018 mg of ampicillin (Fig. 1A, D, and G). The LEC antimicrobial potency against Vibrio vulnificus and Streptococcus agalactiae was examined using the same strategy. The results show an inhibition zone with a diameter of 1.31 0.02 cm on the agar plate derived from 20 mL of 10-fold diluted LEC against V. vulnificus. Based on the equation y ¼ 0.0597x þ 1.086 (R2 ¼ 0.9693), which was derived from the ampicillin inhibition zone diameter against V. vulnificus, the antimicrobial activity of 120 mg cinnamaldehyde against V. vulnificus was equivalent to 3.75 mg of ampicillin. This result indicates that the bactericidal efficacy of 1 mg cinnamaldehyde against V. vulnificus was equivalent to the potency for 0.031 mg of ampicillin (Fig. 1B, E and H). The equation y ¼ 0.0451x þ 0.7035 (R2 ¼ 0.9938), which is based on the inhibition zone diameter derived from ampicillin against S. agalactiae, was used to calculate the antimicrobial potency of LEC. The antimicrobial potency (inhibition zone with a diameter of 0.84 0.07 cm) of 120 mg cinnamaldehyde against S. agalactiae was equivalent to 3.02 mg of ampicillin (Fig. 1C, F and I). This result indicates that the bactericidal efficacy of 1 mg cinnamaldehyde against S. agalactiae was equivalent to the potency of 0.025 mg ampicillin. Although the ampicillin antimicrobial efficacy against antibiotic-resistant Vibrio parahaemolyticus and Vibrio
Table 2 Antimicrobial activity of liposome-encapsulated cinnamaldehyde (LEC) and antibiotics against aquaculture pathogens. Pathogen
A. hydrophila S. agalactiae V. vulnificus V. parahaemolyticus V. alginolyticus a
LEC (mg/L)
Kanamycin (mg/L)
Ampicillin (mg/L)
Tetracycline (mg/L)
MIC
MBC
MIC
MBC
MIC
MBC
MIC
MBC
179.7 120.3 179.7 59.5 120.3
239.2 179.7 239.2 120.3 179.7
0.5 2.0 3.0 Nona Nona
2.0 4.0 6.0 Nona Nona
1.26 1.26 0.67 Nona Nona
1.91 1.91 0.96 Nona Nona
0.41 0.41 0.82 Nona Nona
0.82 0.82 1.24 Nona Nona
Non indicates an antibiotic with no antimicrobial potency against the pathogen.
E.N. Faikoh et al. / Fish & Shellfish Immunology 38 (2014) 15e24
19
Fig. 1. The LEC antimicrobial potency against bacterial pathogens was investigated using a bactericidal agar plate assay. (A) A. hydrophila, (B) V. vulnificus, and (C) S. agalactiae were the bacteria examined. Discs were placed on the TBS agar plate surface. Twenty microliters of sterile water with 0 mg (control), 2 mg, 4 mg, 6 mg, or 8 mg of ampicillin were added to the discs as standards. After incubation, each inhibition zone diameter was measured. The ampicillin bactericidal standard curves against (G) A. hydrophila, (H) V. vulnificus, and (I) S. agalactiae were plotted, and the statistical equation was generated. Twenty microliters of sterile water (control), 10 diluted LEC and 10 diluted LE were added to the discs. The cinnamaldehyde bactericidal efficacy derived from the LEC inhibition zone diameter against (D) A. hydrophila, (B) V. vulnificus, and (C) S. agalactiae were measured using the bactericidal standard curves. The LEC-derived inhibition zone diameter against the bacterial pathogen is indicated by the red circle symbol. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
alginolyticus could not be determined using a bactericidal agar plate assay, the LEC-derived cinnamaldehyde bactericidal potency against V. parahaemolyticus and V. alginolyticus was also demonstrated through a clear inhibition zone (Supplementary Fig. 1S). These results demonstrate that LEC cinnamaldehyde exhibits effective bactericidal potency against A. hydrophila, V. vulnificus, and S. agalactiae, as well as the antibiotic-resistant V. parahaemolyticus and V. alginolyticus. 3.3. The immersion LEC treatment enhances the bacteriachallenged zebrafish survival rate by suppressing aquatic pathogen species To determine the optimal LEC dose for the zebrafish immersion treatment, the LEC tolerance in the range of w0e125 mL/L (w0e 7.5 mg/L cinnamaldehyde) was evaluated. Chest hemorrhage phenomenon, abnormal swimming behavior, and death were clearly observed 1 day post-incubation at >6.0 mg/L cinnamaldehyde. The zebrafish physiological status was healthy at
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Liposome-encapsulated cinnamaldehyde enhances zebrafish (Danio rerio) immunity and survival when challenged with Vibrio vulnificus and Streptococcus agalactiae Elok Ning Faikoh a, b,1, Yong-Han Hong c,1, Shao-Yang Hu a, * a b c
Department of Biological Science and Technology, National Pingtung University of Science and Technology, Pingtung 912, Taiwan Department of Water Resources Management, Marine and Fisheries Faculty, University of Brawijaya, Indonesia Department of Nutrition, I-Shou University, Kaohsiung 824, Taiwan
a r t i c l e i n f o
a b s t r a c t
Article history: Received 3 December 2013 Received in revised form 27 February 2014 Accepted 28 February 2014 Available online 12 March 2014
Cinnamaldehyde, which is extracted from cinnamon, is a natural compound with activity against bacteria and a modulatory immune function. However, the antibacterial activity and immunostimulation of cinnamaldehyde in fish has not been well investigated due to the compound’s poor water solubility. Thus, liposome-encapsulated cinnamaldehyde (LEC) was used to evaluate the effects of cinnamaldehyde on in vitro antibacterial activity against aquatic pathogens and in vivo immunity and protection parameters against Vibrio vulnificus and Streptococcus agalactiae. The minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) as well as bactericidal agar plate assay results demonstrated the effective bacteriostatic and bactericidal potency of LEC against Aeromonas hydrophila, V. vulnificus, and S. agalactiae, as well as the antibiotic-resistant Vibrio parahaemolyticus and Vibrio alginolyticus. Bacteria challenge test results demonstrated that LEC significantly enhances the survival rate and inhibits bacterial growth in zebrafish infected with A. hydrophila, V. vulnificus, and S. agalactiae. A gene expression study using a real-time PCR showed that LEC immersion-treated zebrafish had increased endogenous interleukin (IL)-1b, IL-6, IL-15, IL-21, tumor necrosis factor (TNF)-a, and interferon (INF)-g expression in vivo. After the zebrafish were infected with V. vulnificus or S. agalactiae, the LEC immersion treatment suppressed the expression of the inflammatory cytokines IL-1b, IL-6, IL-15, NF-kb, and TNF-a and induced IL-10 and C3b expression. These findings demonstrate that cinnamaldehyde exhibits antimicrobial activity against aquatic pathogens, even antibiotic-resistant bacterial strains and immunestimulating effects to protect the host’s defenses against pathogen infection in bacteria-infected zebrafish. These results suggest that LEC could be used as an antimicrobial agent and immunostimulant to protect bacteria-infected fish in aquaculture. Ó 2014 Elsevier Ltd. All rights reserved.
Keywords: Cinnamaldehyde Liposome Antimicrobial activity Immune response Danio rerio
1. Introduction During the past decade, diseases induced by bacteria, fungi, viruses, and parasites have caused severe economic loss in the aquaculture industry. Among such diseases, bacterial infections are the most important disease source in fish and shellfish species [1]. For instance, vibriosis is associated with an increased Gram-
* Corresponding author. Department of Biological Science and Technology, National Pingtung University of Science and Technology, No. 1, Hseufu Road, Neipu, Pingtung 912, Taiwan. Tel.: þ886 8 7703202x6356; fax: þ886 8 7740584. E-mail addresses: [email protected], [email protected] (S.-Y. Hu). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.fsi.2014.02.024 1050-4648/Ó 2014 Elsevier Ltd. All rights reserved.
negative Vibrio population in culture pond water. Vibrio vulnificus often causes invasive septicemia and is highly lethal in aquatic animals Vibrio parahaemolyticus and Vibrio alginolyticus seriously retard growth and induce anorexia and high mortality in shrimp [2,3]. Aeromonas hydrophila tends to be virulent toward most cultured and wild freshwater fish and is primarily associated with red fin diseases and hemorrhagic septicemia [4,5]. Gram-positive Streptococcus agalactiae causes meningoencephalitis and septicemia with high morbidity and mortality in many marine and freshwater fish species [6,7]. Thus, antibiotics and other therapeutic agents are widely used in aquaculture worldwide for prophylactic and therapeutic purposes. However, the indiscriminate application of such therapeutic chemicals has precipitated the rapid development and spread of various antibiotic-resistant pathogens in
16
E.N. Faikoh et al. / Fish & Shellfish Immunology 38 (2014) 15e24
exposed microbial ecosystems, has reduced the antibiotic treatment efficacy, has produced residual antibiotics in aquatic products and potential environmental hazards, and has enhanced public health risks [8]. Therefore, for a more sustainable aquaculture industry, alternative approaches to controlling pathogen infections are necessary and urgent. Several strategies have been developed to control bacterial infection, such as DNA vaccines [9], immunostimulants [10], antimicrobial peptides [11], and probiotics [12]. Among the alternatives to antibiotics, emerging approaches include plant extracts and their constituent active compounds, which have been used as antimicrobials to inhibit bacterial growth or immunostimulants to enhance the host’s defenses [13e15]. Cinnamaldehyde is a major constituent of cinnamon (Cinnamomum verum), which is a widely used flavoring compound that has traditionally been used to treat human diseases, including dyspepsia, gastritis, and inflammatory diseases. Studies have demonstrated that cinnamaldehyde exhibits antioxidant [16], antimicrobial [17], anti-inflammatory [18], and anticancer activity [19], and the compound has been classified as a generally recognized as safe (GRAS) molecule for food preservation by the United States Food and Drug Administration [20]. The bactericidal mechanism of cinnamaldehyde has been demonstrated through damaging bacterial cell membranes and disrupting cellular metabolism and energy generation [21,22]. Furthermore, cinnamaldehyde exhibits anti-inflammatory properties and immunity enhancement efficacy through inhibiting pro-inflammatory cytokine secretion from monocytes and macrophages in vitro and in vivo [18,23]. The benefits and biological functions of cinnamaldehyde and its derivatives have been widely applied for diverse purposes, including food preservation through inhibiting foodborne pathogen growth [24], preventing avian coccidiosis and intestinal spirochetosis [23,25], disease resistance in plants [26], and clinical applications [27,28]. However, although several studies show potentially diverse applications for cinnamaldehyde, thus far, the practical applications in fish and shellfish species have not been thoroughly investigated. A recent investigation demonstrated that essential oil extracted from Cinnamosma fragrans can significantly control bacterial loads and enhance Penaeus monodon larvae survival rates, which suggests a novel alternative to antibiotics in shrimp hatchery culture and implies that cinnamaldehyde may be developed as an antibacterial agent against aquatic pathogens in aquaculture [28,29]. Hence, a study to demonstrate the antimicrobial activity and immunomodulatory function of cinnamaldehyde for disease resistance in fish is imperative. Zebrafish have been extensively used as models for studying human disease, vertebrate development and aquaculture research, and has recently also provided a suitable system to study the effects of immunostimulants on innate immune response and infectious diseases [30]. For instance, the activation of pro-inflammatory factor expression and an increase in the survival rate induced by bath vaccination with a live attenuated bacterial vaccine and the oral administration of recombinant antimicrobial peptide were respectively demonstrated in zebrafish [31,32]. Regarding the immunostimulatory effect of plant extracts, most investigations were performed in food fish species for practical application in aquaculture [14,33,34]. In the present study, zebrafish were used as a model to investigate the immunostimulatory function of cinnamaldehyde. In general, cinnamaldehyde should be given to aquatic animals through oral administration or direct mixture with feed ingredients. However, the feeding behavior of aquatic animals and the mixed feed consistency are issues due to the compound’s stimulating flavor and poor water solubility, respectively. Herein, liposome-encapsulated cinnamaldehyde (LEC) was developed to increase the compound’s water solubility, and its bacteriostatic and bactericidal activity against aquatic pathogens, including
A. hydrophila, S. agalactiae, V. vulnificus, V. parahaemolyticus, and V. alginolyticus, were evaluated. The efficacy of cinnamaldehyde in enhancing zebrafish survival rates was using V. vulnificus- and S. agalactiae-challenged zebrafish; the cinnamaldehyde-mediated immune responses of these fish were also investigated. These experiments could to shed light on cinnamaldehyde’s antimicrobial activity and its function in stimulating immunity for future aquaculture applications. 2. Materials and methods 2.1. Animals and bacterial strains Adult AB-strain zebrafish (Danio rerio) were acquired from the Taiwan Zebrafish Core Facility at Academia Sinica (Taipei, Taiwan). The fish were raised in 10-L tanks and maintained at 28 C in recirculating freshwater with a controlled light cycle (14 h light/ 10 h dark). The fish were fed daily with commercial pellet (Taikong, Taiper, Taiwan). All zebrafish were handled in compliance with the local animal welfare regulations and maintained according to standard protocols (http://ZFIN.org). The Gram-negative A. hydrophila, V. vulnificus, V. parahaemolyticus, and V. alginolyticus used herein were kindly provided by Dr. Chung-Hung Liu, Department of Aquaculture, National Pingtung University of Science and Technology, Pingtung, Taiwan. The Gram-positive S. agalactiae was kindly provided by Dr. Jyh-Yih Chen, Marine Research Station, Institute of Cellular and Organismic Biology, Academia Sinica, Ilan, Taiwan. The bacterial cells used in the bacteriostatic and bactericidal assays were stored in a glycerol stock at 20 C until use. 2.2. LEC preparation Cinnamaldehyde (2E-3-phenylprop-2-enal) (CAS RN: 104-55-2) was purchased from Panreac Quimica (Barcelona, Catalonia, Spain) and encapsulated in liposomes using high-pressure homogenization (HPH) via the following procedure: Six percent (wt/v) cinnamaldehyde, 10% (v/v) lecithin, and 0.5% (v/v) a-tocopherol were gently mixed in 5% ethanol, which was supplemented with potassium dihydrogen phosphate to maintain the mixture’s pH at 6.7. The mixed solution was processed into LEC using an HPH M-110P Microfluidizer (Microfluidics, Newton, MA, USA) with a fixed pressure of approximately 5000e30,000 psi and a 50e100 mL/min flow rate. The LEC was replaced with an equal volume of pure water, which is referred to as LE and was used as a control. 2.3. Determining the MIC and MBC of LEC Three microliters from the cell stocks containing V. vulnificus, V. parahaemolyticus, and V. alginolyticus were used to inoculate a 15-mL tube with 3 mL tryptic soy broth (TSB) medium supplemented with 1.5% NaCl in a shaking incubator at 150 rpm and 28 C. After 12 h of cultivation, 3 mL of culture was transferred to the same medium and incubated for 9 h under the same conditions as the seed culture. For A. hydrophila and S. agalactiae, the culture conditions were the same as for V. vulnificus, with the exception that the TBS medium did not include 1.5% NaCl. A modified resazurin assay was performed using sterile 96-well plates to determine the MIC and MBC for each bacteria sample examined (n ¼ 3) [35]. Resazurin was acquired from Sigma Chemicals (R-7017, St. Louis, MO., USA) and prepared as a 0.25 mg/mL sterile solution in water. The seed culture for each bacterial cell sample was diluted in individual culture broth samples at a cell density of 1 107 CFU/mL. A reaction mixture composed of 100 mL per well with 10 mL diluted seed culture, 67 mL individual culture broth, 13 mL resazurin solution, and 10 mL of various concentrations of LEC samples was cultured at
E.N. Faikoh et al. / Fish & Shellfish Immunology 38 (2014) 15e24
28 C for 12 h. Sterile water and the diluted LE that corresponded to the LEC concentration were used as a negative control. Ampicillin (Sigma A-0166), kanamycin (Sigma K-4000), and tetracycline (Sigma T-7660) with the respective bacterial strains over a serial concentration range were used as positive controls. After incubation, the color change from dark green to pink was visually assessed and compared with the negative control, which was dark green. The MIC value was defined as the lowest LEC concentration that prevented a color change in the test well. The MBC was determined by taking the entire sample from each well with a dark green color and streaking it on a TSB agar plate supplemented with or without 1.5% NaCl and then incubating the sample at 28 C for 24 h. The MBC value was defined as the lowest LEC concentration at which colonies did not form on the agar plate.
2.4. Bactericidal agar plate assay The antibacterial efficacy of LEC against A. hydrophila, V. vulnificus, V. parahaemolyticus, V. alginolyticus and S. agalactiae was evaluated via a bactericidal agar plate assay. One milliliter of seed culture for each bacterial sample was added to one liter of TSB broth with 1.5% (w/v) agar and 1.5% NaCl for V. vulnificus, V. parahaemolyticus, and V. alginolyticus or without NaCl for A. hydrophila and S. agalactiae and then mixed thoroughly. Twenty milliliters of the liquid agar plate was then poured into a Petri dish (90 15 mm). To determine the inhibition zone diameter, the LEC and LE were diluted 10-fold in sterile water, and 20 mL of the diluted LEC or LE were then placed on a piece of 0.7 cm-diameter filter paper positioned on the TSB plate with the bacteria sample and incubated for 24 h at 28 C. The LEC bactericidal efficacy against A. hydrophila, V. vulnificus, and S. agalactiae was determined through comparison with the inhibition zone diameters for 2 mg, 4 mg, 6 mg, and 8 mg of ampicillin on the plate.
17
2.5. Evaluating bacteria-challenged zebrafish survival rates with LEC Adult zebrafish (approximately 4.12 0.3 cm body length and 0.85 0.12 g body weight) were individually cultured in a 10-L aquarium tank (n ¼ 20 for each tank) for the bacteria challenge. A seed culture from each bacterial strain was diluted in the appropriate volume of PBS buffer. Ten microliters of diluted V. vulnificus (1 106 CFU/mL), A. hydrophila (1 106 CFU/mL), and S. agalactiae (1 107 CFU/mL) were individually injected into the adult zebrafish intraperitoneally. The effect of LEC on the bacteria-challenged zebrafish survival rates was investigated by immersing the bacteria-challenged zebrafish in water with 75 mL/L of LEC or LE. The zebrafish injected with PBS buffer and PBS-containing bacteria without the LEC immersion treatment were used as the positive and negative controls, respectively. The water with LEC or with/ without LE was renewed daily to maintain the water quality and cinnamaldehyde efficacy. The bacteria challenge experiment was repeated three times. Each group’s survival rate was recorded daily after the injection. Student’s t-test was used to statistically analyze and compare two groups. The differences were defined as significant at p < 0.05.
2.6. In vivo LEC bactericidal assay To validate the LEC bactericidal activity in vivo, the bacterial colonies in bacteria-challenged zebrafish, which were generated under the conditions described in Materials and Methods 2.5, were quantified after 12 h, 24 h, and 36 h as follows: a zebrafish was anesthetized in 0.2% tricaine and then euthanized via incubation in ice water for 15 min. Each zebrafish (n ¼ 5) was washed with sterile water twice and then cut into pieces using a sterile clipper. The pieces of each zebrafish were placed into 10 mL of sterile PBS buffer.
Table 1 Primer sequences and gene names. Gene name
Primer sequence (50 / 30 )
PCR size (bp)
Accession number
Interleukin-1b (IL-1b)
TGGACTTCGCAGCACAAAATG CACTTCACGCTCTTGGATGA TCAACTTCTCCAGCGTGATG TCTTTCCCTCTTTTCCTCCTG TCACGTCATGAACGAGATCC CCTCTTGCATTTCACCATATCC ATGTCATTGGAACTCAGAGGTTTG CTGTTCTGGATGTCCTGCTTGA AATCATTCATCGTGGACAGTGTGT AACGTTCGGCTGTTGACCAT AAGGAGAGTTGCCTTTACCG ATTGCCCTGGGTCTTATGG GAGAGGCTGGCACATGTTCA CCCATAGCGTTTCTGCATACG AAGAGGACCAAAATAAGCACAG AAG TCCAAGGTACATCGCCATGA GATCTCCCAAATGCCAAGCA GGGCGAAGAAAGCAAACATG CGTCTCCGTACACCATCCATT GGCGTCTCATCAGGATTTGTTAC CGTGGATGTCCTCGTGTGAA G CCAATGGAGAATCCCTCAAA CAGAGCGAATGGTGCCACTAT GTGGCAGAGGCTCCAGAAGA TGGAGCATCACAGGGATAAAGA TGATGCCCATGCCTGTAAGA TTTCAGATGCCACATCAGA TCCACAAGAACAAGCCTTTG AACAGCTGATCGTTGGAGTCAA TTGATGTATGCGCTGACTTCCT
147
AY340959
73
JN698962
151
BC163031
100
BC162843
100
NM_001128574
152
BC165066
100
AB126869
100
AY163838
100
NM_153657
100
NM_131243
100
NM_139180
Interleukin-6 (IL -6) Interleukin-10 (IL-10) Interleukin-15 (IL-15) Interleukin-21 (IL-21) Tumor necrosis factor-a (TNF-a) Interferon-gamma (INF-g) Nuclear factor-kB (NF-kB) Cyclooxygenase-2 (COX-2) Complement component c3b Lysozyme Toll-like receptor-1 (TLR1) Toll-like receptor-3 (TLR3) Toll-like receptor-4a (TLR4a) Elongation factor 1a (ef-1a)
97
AY389444
100
AY616582
150
EU551724
100
AY422992
18
E.N. Faikoh et al. / Fish & Shellfish Immunology 38 (2014) 15e24
The solutions were mixed using a shaker for 3 h at 28 C; 1 mL from each solution was then collected for a serial dilution. One hundred microliters of each diluted solution were streaked on a TSB agar plate supplemented with or without 1.5% NaCl. The colonies on the plate were counted after the agar plate was cultivated for 24 h at 28 C, and the experiment was repeated three times. Student’s ttest was used to statistically analyze and compare two groups. The differences were defined as significant at p < 0.05. 2.7. Detecting immune-related gene expression through a real-time polymerase chain reaction The total RNA was isolated from the bacteria-challenged zebrafish with the LE or LEC immersion treatment or without the LEC immersion treatment (control group) at 1 h, 6 h, 12 h, and 24 h. The expression levels of IL-1b, IL-6, IL-10, IL-15, and IL-21; complement component C3b, lysozyme, TRL-1, TRL-3, and TRL-4a; and NF-kB, COX-2, TNF-a, and elongation factor 1-a (ef1-a) were determined using quantitative PCR. The ef1-a was used as an internal control. The specific PCR primers used herein are listed in Table 1. Real-time PCR was performed using SYBR Green PCR reagents and an Applied Biosystems StepOnePlus Real-Time PCR system. The cycling profile was as follows: 60 C for 2 min, 95 C for 10 min followed by 40 cycles of denaturing at 95 C for 15 s, and annealing and primer extension at 60 C for 1 min. Equal quantities of the total RNA from the three fish were mixed and examined in triplicate for each condition. The relative expression levels of each group were normalized to ef1-a and expressed as the means standard error (SE). Student’s t-test was used to statistically analyze and compare two groups. Multiple-group comparisons were examined using a one-way analysis of variance (ANOVA), and Tukey’s test was used to evaluate significant differences between groups. The differences were defined as significant at p < 0.05. 3. Results 3.1. The MIC and MBC of LEC Bactericidal activity is a prerequisite for regarding cinnamaldehyde as a natural antimicrobial compound. To estimate cinnamaldehyde’s bacteriostatic and bactericidal activity against diverse aquatic pathogens, the MIC and MBC of LEC were determined using a modified resazurin assay as described in the Materials and Methods section. The results in Table 2 show the LEC antimicrobial activities against Gram-positive and Gram-negative aquatic pathogens. The LEC MICs were 120.3 mg/L for Streptococcus agalactiae and Vibrio alginolyticus, 179.7 mg/L for Aeromonas hydrophila and Vibrio vulnificus, and 59.5 mg/L for Vibrio parahaemolyticus. The LEC MBCs were 179.7 mg/L for S. agalactiae and V. alginolyticus, 239.2 mg/L for A. hydrophila and V. vulnificus, and 120.3 mg/L for V. parahaemolyticus. Antibiotic antimicrobial
potencies against S. agalactiae, A. hydrophila, and V. vulnificus are as follows: kanamycin yielded MICs of 0.5e3 mg/L and MBCs of 2.0e 6.0 mg/L. Ampicillin yielded MICs of 0.67e1.26 mg/L and MBCs of 0.96e1.91 mg/L. Tetracycline yielded MICs of 0.41e0.82 mg/L and MBCs of 0.82e1.24 mg/L. The antibiotics did not exhibit antimicrobial potency against V. parahaemolyticus and V. alginolyticus, which suggests that both pathogen strains are resistant to antibiotics. The antimicrobial potency was compared with that of the antibiotics; although the LEC bacteriostatic and bactericidal potency was lower than kanamycin, ampicillin, and tetracycline, LEC’s bacteriostatic and bactericidal activities against the antibioticresistant pathogens V. parahaemolyticus and V. alginolyticus were impressive. Such results suggest that cinnamaldehyde could replace antibiotics for treating antibiotic-resistant pathogens. 3.2. LEC exhibits efficient potency against aquatic pathogen species To further demonstrate cinnamaldehyde’s antibacterial potency against pathogenic bacteria, the LEC bactericidal activity was examined through an agar plate inhibition zone derived from 20 mL of 10-fold sterile water-diluted LEC (120 mg of cinnamaldehyde). When comparing the control and LE sample results, the obvious inhibition zones on the LEC sample agar plates suggest that the bactericidal activity due to the cinnamaldehyde. Based on the agar plate inhibition zone diameters against pathogens derived from known ampicillin levels, the equation y ¼ 0.0498x þ 0.7225 (R2 ¼ 0.9838) was used to calculate the LEC antimicrobial potency against Aeromonas hydrophila. The antimicrobial activity of 120 mg cinnamaldehyde against A. hydrophila was equivalent to 2.16 mg of ampicillin. Thus, the antibacterial potency for 1 mg cinnamaldehyde against A. hydrophila is equivalent to the potency for 0.018 mg of ampicillin (Fig. 1A, D, and G). The LEC antimicrobial potency against Vibrio vulnificus and Streptococcus agalactiae was examined using the same strategy. The results show an inhibition zone with a diameter of 1.31 0.02 cm on the agar plate derived from 20 mL of 10-fold diluted LEC against V. vulnificus. Based on the equation y ¼ 0.0597x þ 1.086 (R2 ¼ 0.9693), which was derived from the ampicillin inhibition zone diameter against V. vulnificus, the antimicrobial activity of 120 mg cinnamaldehyde against V. vulnificus was equivalent to 3.75 mg of ampicillin. This result indicates that the bactericidal efficacy of 1 mg cinnamaldehyde against V. vulnificus was equivalent to the potency for 0.031 mg of ampicillin (Fig. 1B, E and H). The equation y ¼ 0.0451x þ 0.7035 (R2 ¼ 0.9938), which is based on the inhibition zone diameter derived from ampicillin against S. agalactiae, was used to calculate the antimicrobial potency of LEC. The antimicrobial potency (inhibition zone with a diameter of 0.84 0.07 cm) of 120 mg cinnamaldehyde against S. agalactiae was equivalent to 3.02 mg of ampicillin (Fig. 1C, F and I). This result indicates that the bactericidal efficacy of 1 mg cinnamaldehyde against S. agalactiae was equivalent to the potency of 0.025 mg ampicillin. Although the ampicillin antimicrobial efficacy against antibiotic-resistant Vibrio parahaemolyticus and Vibrio
Table 2 Antimicrobial activity of liposome-encapsulated cinnamaldehyde (LEC) and antibiotics against aquaculture pathogens. Pathogen
A. hydrophila S. agalactiae V. vulnificus V. parahaemolyticus V. alginolyticus a
LEC (mg/L)
Kanamycin (mg/L)
Ampicillin (mg/L)
Tetracycline (mg/L)
MIC
MBC
MIC
MBC
MIC
MBC
MIC
MBC
179.7 120.3 179.7 59.5 120.3
239.2 179.7 239.2 120.3 179.7
0.5 2.0 3.0 Nona Nona
2.0 4.0 6.0 Nona Nona
1.26 1.26 0.67 Nona Nona
1.91 1.91 0.96 Nona Nona
0.41 0.41 0.82 Nona Nona
0.82 0.82 1.24 Nona Nona
Non indicates an antibiotic with no antimicrobial potency against the pathogen.
E.N. Faikoh et al. / Fish & Shellfish Immunology 38 (2014) 15e24
19
Fig. 1. The LEC antimicrobial potency against bacterial pathogens was investigated using a bactericidal agar plate assay. (A) A. hydrophila, (B) V. vulnificus, and (C) S. agalactiae were the bacteria examined. Discs were placed on the TBS agar plate surface. Twenty microliters of sterile water with 0 mg (control), 2 mg, 4 mg, 6 mg, or 8 mg of ampicillin were added to the discs as standards. After incubation, each inhibition zone diameter was measured. The ampicillin bactericidal standard curves against (G) A. hydrophila, (H) V. vulnificus, and (I) S. agalactiae were plotted, and the statistical equation was generated. Twenty microliters of sterile water (control), 10 diluted LEC and 10 diluted LE were added to the discs. The cinnamaldehyde bactericidal efficacy derived from the LEC inhibition zone diameter against (D) A. hydrophila, (B) V. vulnificus, and (C) S. agalactiae were measured using the bactericidal standard curves. The LEC-derived inhibition zone diameter against the bacterial pathogen is indicated by the red circle symbol. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
alginolyticus could not be determined using a bactericidal agar plate assay, the LEC-derived cinnamaldehyde bactericidal potency against V. parahaemolyticus and V. alginolyticus was also demonstrated through a clear inhibition zone (Supplementary Fig. 1S). These results demonstrate that LEC cinnamaldehyde exhibits effective bactericidal potency against A. hydrophila, V. vulnificus, and S. agalactiae, as well as the antibiotic-resistant V. parahaemolyticus and V. alginolyticus. 3.3. The immersion LEC treatment enhances the bacteriachallenged zebrafish survival rate by suppressing aquatic pathogen species To determine the optimal LEC dose for the zebrafish immersion treatment, the LEC tolerance in the range of w0e125 mL/L (w0e 7.5 mg/L cinnamaldehyde) was evaluated. Chest hemorrhage phenomenon, abnormal swimming behavior, and death were clearly observed 1 day post-incubation at >6.0 mg/L cinnamaldehyde. The zebrafish physiological status was healthy at
