Accepted Manuscript Title: Light regulation of mitochondrial alternative oxidase pathway during greening of etiolated wheat seedlings Author: Elena V. Garmash Olga I. Grabelnych Iliya O. Velegzhaninov Olga A. Borovik Igor V. Dalke Victor K. Voinikov Tamara K. Golovko PII: DOI: Reference:

S0176-1617(14)00283-1 http://dx.doi.org/doi:10.1016/j.jplph.2014.09.016 JPLPH 52047

To appear in: Received date: Revised date: Accepted date:

5-6-2014 21-8-2014 5-9-2014

Please cite this article as: Garmash EV, Grabelnych OI, Velegzhaninov IO, Borovik OA, Dalke IV, Voinikov VK, Golovko TK, Light regulation of mitochondrial alternative oxidase pathway during greening of etiolated wheat seedlings, Journal of Plant Physiology (2014), http://dx.doi.org/10.1016/j.jplph.2014.09.016 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

1   

Light regulation of mitochondrial alternative oxidase pathway during greening of etiolated wheat seedlings

V. Dalkea, Victor K. Voinikovb, Tamara K. Golovkoa

Institute of Biology, Komi Science Centre, Ural Branch, Russian Academy of Sciences, 28

b

us

Kommunisticheskaya Str., 167982 Syktyvkar, Russia

cr

a

ip t

Elena V. Garmasha*, Olga I. Grabelnychb, Iliya O. Velegzhaninova, Olga A. Borovikb, Igor

Siberian Institute of Plant Physiology and Biochemistry, Siberian Branch, Russian Academy

an

of Sciences, 132 Lermontov Str., 664033 Irkutsk, Russia

M

Summary

This study deals with effects of de-etiolation (48 hours ) of spring wheat (Triticum aestivum

d

L., var. Irgina) seedlings on differential expression of AOX1 genes, levels of AOX protein and

te

the alternative respiratory pathway (AP) capacity. As a result of exposure to continuous

Ac ce p

irradiation of dark-grown wheat seedlings, the respiratory activity and AP capacity in leaves significantly increased during the first 6 hours of studies. Expression of AOX1a was up-regulated by light and proved consistent with changes in the AP capacity. Effects on expression of AOX1c were less pronounced. Immunoblot analysis showed three distinct bands of AOX with molecular weights of 34, 36 and 38 kDa, with no significant changes in the relative levels during deetiolation. The lack of a clear correlation between AOX protein amount, AOX1a expression, and AP capacity suggests post-translational control of the enzyme activation. The AOX1a suppression and a decrease in the AP capacity correlated with the sugar pool depletion after 24 hours of the de-etiolation, which may mean a possible substrate dependence of the AOX activity in the green cells. More efficient malate oxidation by mitochondria as well as the higher AOX capacity during the first 6 hours of de-etiolation were detected, whereas respiration and AOX

Page 1 of 38

2   

capacity with exogenous NADH and glycine increased after 6 and 24 hours, respectively. We conclude that AOX plays an important role during development of an actively photosynthesizing

ip t

cell, and can rapidly adapt to changes in metabolism and photosynthesis.

cr

Keywords: Alternative oxidase, de-etiolation, gene expression, respiration, mitochondria

us

activity, photorespiration, Triticum aestivum

an

Abbreviations: AP, Alternative respiratory pathway; AOX, Alternative oxidase; BHAM, benzhydroxamic acid; COX, Cytochrome oxidase, CP, Cytochrome respiratory pathway; ETC,

M

electron transport chain; MDH, Malate dehydrogenase; SDH, Succinate dehydrogenase; NDin and NDex, Rotenone-insensitive internal and external type II NADH dehydrogenases

d

respectively; mETC, Mitochondrial electron transport chain; PAR, Photosynthetic active

te

radiation; PIB, post-illumination CO2 burst; PR, photorespiration; RD, Dark respiration; SHAM,

Ac ce p

Salicylhydroxamic acid; TCA, Tricarboxylic acid cycle; Valt and Vcyt, Capacity of alternative and cytochrome pathway of respiration, respectively; Vt, Total respiration measured as O2 uptake rate.

Page 2 of 38

3   

Introduction

De-etiolation, which occurs in plants after their transition from growth in the dark to that in the light, is usually accompanied by substantial physiological, biochemical, and

ip t

morphogenetic changes. The changes include those in seedling morphology and physiology,

cr

triggered by the light-regulated expression of numerous genes. The most prominent visual aspect of the process is a substantial increase in green color (greening) of tissues due to chlorophyll

us

formation and chloroplast development. This phenomenon has been thoroughly studied, including the signaling regulation of expression of nuclear and plastidic genes coding for

an

chloroplast proteins (López-Juez, 2007; Kravtsov et al., 2011). On the other hand, only scarce information is available on effects in mitochondria and mitochondrial activity during greening.

M

Moreover, the greening process is considered to be a suitable model for studies on regulatory aspects of respiration in a developing photosynthesizing cell and on the role of mitochondrial

d

respiratory chain components during formation of the photosynthetic machinery.

te

Mitochondrial ETC (mETC) in plants is more complicated and dynamic compared with ETC

Ac ce p

in mammalian mitochondria. The mETC in higher plants consists of two pathways for electron transport from ubiquinone (Q) to O2: the phosphorylating cytochrome pathway (CP) and the cyanide-insensitive alternative pathway (AP) that branches off the CP at the level of ubiquinone (Vanlerberghe and McIntosh, 1997). The enzyme catalyzing respiration through AP is alternative oxidase (AOX), occupying the inner mitochondrial membrane, and is encoded by a small group of nuclear genes. The AP bypasses proton-pumping Complexes III and IV in the mETC, therefore alternative respiration is considered an energetically wasteful process. However, AP plays an important role in cells. The electron flow through the AP is not limited by an adenylate control, which is advantageous for survival of plants when the main CP is restrained by some other factors (including the overflow of reductants) (Millenaar and Lambers, 2003). The AP is believed to execute some fine tuning of the reduction level of ubiquinone, and, more globally, of

Page 3 of 38

4   

the redox balance during the mitochondrial electron transport, thus limiting the formation of superoxides (Maxwell et al., 1999; Millenaar and Lambers, 2003). Recently, more evidences were reported pointing out to the importance of AOX pathway in the process of optimization of photosynthesis, and protection of cells against photoinhibition

ip t

(Krömer et al., 1993; Raghavendra and Padmasree, 2003; Yoshida et al., 2008, 2011; Dinakar et

cr

al., 2010; Zhang et al., 2012). AP is considered to play a role in the dissipation of excess reductants produced in chloroplasts and exported to mitochondria (Padmasree and Raghavendra,

us

1999; Yoshida et al., 2011; Zhang et al., 2012). Light can contribute to the regulation of AOX through some direct photoreceptor control and indirect photosynthesis-dependent variations in

an

metabolites, influencing the AOX transcript levels and affecting the abundance and posttranslational modification of protein (summarized in Rasmusson and Escobar, 2007; Noguchi

M

and Yoshida, 2008; Igamberdiev et al., 2014).

An increase in the AP activity was observed while using oxygen isotope fractionation

d

during the greening phase in soybean cotyledons (Ribas-Carbo et al. 2000). Patterns of electron

te

partitioning through AP changed dramatically during the first 12 h of greening which closely

Ac ce p

correlated with the time-course of change in the AOX gene expression earlier observed by Finnegan et al. (1997). The increased AOX1c expression and SHAM-sensitive respiration during 12 h of greening in etiolated rice seedlings was reported (Feng et al., 2007). Patterns of light regulation of the AOX1a gene and cyanide-resistant respiration in Arabidopsis seedlings were reported during de-etiolation in different light (Zhang et al., 2010). Recently, we also found that the respiratory activity and AP capacity (maximal activity) increased during the greening in wheat seedlings (Garmash et al., 2013). The highest values of these parameters were detected in the period ranging from 4 to 12 h of continuous illumination, when prolamellar bodies got already converted into thylakoids but the photosynthetic machinery wasn’t yet completely developed. All the changes in the AP capacity observed were accompanied by a heat emission in the dark, which proves AP to be an energy-dissipating system.

Page 4 of 38

5   

In the current paper, more detailed studies were performed on the engagement of AOX in the first leaf of wheat seedlings during their de-etiolation in order to learn more on the role of alternative respiration in metabolic activities of cells during a light-to-dark transition. In order to accomplish the tasks outlined, we analyzed parameters of mitochondrial respiration showing

ip t

shifts in metabolism and electron transports via cytochrome and alternative pathways, in regards

cr

to the development of the photosynthetic and photorespiratory activity in a greening leaf. For the first time ever, changes in expression of the wheat AOX1 genes were studied from the standpoint

us

of their responsiveness to light. We also analyzed whether the AOX protein levels are related to the AOX gene expression and AP capacity, respectively, and attempted to reveal possible reasons

an

for discrepancy between these parameters. The data obtained shed more light on “the means by which AOX respiration is interacting with and aiding photosynthesis” (Vanlerberghe et al.,

te

Materials and methods

d

M

2009).

Plant material and growth conditions

Ac ce p

Plant material and culture condition: Wheat (Triticum aestivum L., cv. Irgina) seeds were

germinated in tap water. Three-day-old seedlings were transferred into 3-dm3 boxes with a halfstrength Knop medium and were grown in the dark for 2 days in a growth chamber (KBWF 720, Binder, Tuttlingen, Germany) at 23°C and 70% relative humidity. Thereafter, the etiolated seedlings were exposed to continuous light (190 µmol(photon) m–2 s–1, PAR) at 21°C and allowed to green for 48 h. Nutrient solution was changed every day. The light was produced by luminescent lamps (TL-D 30W, Philips, Amsterdam, The Netherlands). All measurements were carried out on the first leaf blade, the top segment (1.5 cm) of which was removed and, from the rest, a segment of 2 to 3 cm in length was used in the experiment. The leaves exposed to light during 0, 1, 2, 4, 6, 12, 24, and 48 h were used. In a separate experiment, the seedlings after 6 h of the de-etiolation phase were put into dark for 18 Page 5 of 38

6   

hours and thereafter again exposed to light for the next 24 hours to analyze the light- and sugardependent character of the respiratory pathway capacity and patterns of gene expression of mitochondrial proteins.

ip t

CO2 exchange (photosynthesis, dark respiration and photorespiration) measurements The rates of net photosynthesis, the post-illumination respiratory burst reflecting the

cr

photorespiratory activity, and the dark respiration rate were measured consistently using a portable photosynthesis system LCPro+ supplied with a compact Peltier heat transfer controller

us

(ADC BioScientific Ltd., Great Amwell, Herforshire, England). Twenty leaves on intact plants

an

from a midleaf region (4 cm long) were laid side by side in a 6.25 cm2 leaf chamber under conditions with relative humidity of 60–70%, temperature of 22°C and ambient CO2

M

concentration.

Primarily, the rate of PN in leaves exposed to 190 µmol(photon) m–2 s–1 was recorded.

d

Secondary, a transient post-illumination CO2 burst (PIB) was studied (Balaur et al. 2009, Huang

te

et al. 2013). PIB shows CO2 emission as a result of a higher rate of photorespiration (PR). The approach (Balaur et al. 2009), in our study, was applied to measure the CO2 emission rate after

Ac ce p

the light being switched off during 20 min. The PIB was identified as a peak recorder deflection lasting for the first 4 minutes after the light switching off. Later on, the PIB gradually faded, and the remaining emission of CO2 was attributed to the rate of dark respiration (RD).

Isolation of mitochondria

Mitochondria were isolated from wheat leaves applying methods developed for wheat shoots (Vojnikov et al., 1984; Grabelnych et al., 2014), and using mediums proposed by Keech et al. (2005) for preparation of leaf mitochondria, with some modifications. All isolation steps were taken at 4°C. 60 g of leaves was ground with a cold mortar and pestle in 240 ml of grinding buffer with pH 7.5 (pH 8.0 for isolation of mitochondria from leaves after 24 and 48 h of

Page 6 of 38

7   

exposition to the light) containing: 0.3 M sucrose, 40 mM MOPS, 2 mM EDTA, 10 mM KH2PO4, 1 mM glycine, 1% (w/v) PVP-40, 50 mM ascorbate, 20 mM cysteine, and 0.5% BSA. The homogenate was filtered through a nylon mesh, and mitochondria were isolated by differential centrifugation: 3000 g for 5 min and the resulting supernatant was centrifuged at

ip t

15000 for 15 min. The pellet was suspended in 24 ml of washing buffer (0.3 mM sucrose, 10

cr

mM MOPS and 10 mM KH2PO4, 0.5% (w/v) BSA, pH 7.5) and centrifuged at 15000 g for 14 min. The pellet was re-suspended in 1 ml of washing buffer, while mitochondria were purified

us

on a discontinuous Percoll gradient according to Nishimura et al. (1982), with some modifications. The discontinuous gradient was composed of 6 ml 60% (v/v) Percoll, 8 ml 45%

an

(v/v) Percoll and 22 ml 28% (v/v) Percoll, all in 0.3 M sucrose, 10 mM MOPS, 1% (w/v) PVP40, and 0.1% (w/v) BSA. The crude mitochondrial fraction (not more than 2.5 ml) was carefully

M

layered on top of the preformed Percoll gradient. The gradient was centrifuged at 24500 g for 1 h (Beckman Coulter Allegra 64R High Speed Centrifuge, angle rotor, USA). The mitochondrial

d

fraction appeared at the interface between 45 and 28% (v/v) Percoll. The mitochondrial fraction

te

was collected and washed in the washing buffer at the dilution factor of 1:20 (mitochondrial

Ac ce p

fraction: the washing buffer containing 0.1% (w/v) BSA) during centrifugation at 24,500 g for 15 min. The pellet was suspended in about 60 ml of washing buffer containing 0.1% (w/v) BSA and again centrifuged at 24,500 g for 5 min. Fraction of the purified mitochondria (about 0.6-1.2 mg of protein) re-suspended in the washing buffer containing 0.1% (w/v) BSA and stored on ice. Preparations of purified mitochondrial fraction for Western blotting were performed using washing buffer and Percoll gradient without BSA. Protein content in purified mitochondrial fraction was measured according to Lowry et al. (1951) using BSA as a standard.

Respiration in leaf and isolated mitochondria The O2 uptake rate was measured using a Clark-type thermoelectrically controlled oxygen electrode (Oxytherm system, Hansatech Inst., Pentney, Norfolk, England) at 21°C. Small leaf

Page 7 of 38

8   

slices (0.015 g FW) were placed in the reaction vessels of the electrode unit containing 1.5 mL HEPES buffer (50 mM, pH 7.2). The O2 uptake rate was measured in the presence of KCN (2 mM, inhibitor of cytochrome respiration, CP) to measure alternative pathway respiration (AP) capacity (Valt), salicylhydroxamic acid (SHAM, inhibitor of AP; dissolved in ethanol, 3 mM) to

ip t

measure CP capacity (Vcyt), and to measure total respiration in the absence of any inhibitors (Vt).

cr

Optimal concentrations of specific inhibitors were determined by titration of plant tissue pieces with increasing concentrations of the inhibitors to saturate the O2 uptake (Møller et al., 1988).

didn’t exceed 10% of the total respiration rate.

us

The residual respiration rate measured as an O2 uptake rate, insensitive to the both inhibitors,

an

Measurements of respiration and property of isolated mitochondria were performed at 25°C in a final volume of 1.4 ml of mitochondria-containing assay buffer, pH 7.4: 0.3 M sucrose, 18

M

mM KH2PO4, 125 mM KCl, 5 mM EDTA, 0.3% (w/v) BSA, and 0.1-0.2 mg of mitochondrial protein. Malate (10 mM) in the presence of 10 mM glutamate, succinate (8 mM) in the presence

d

of 5 mM glutamate, 1 mM NADH (with 0.06 mM CaCl2), and 10 mM glycine (with 0.2 mM

te

NAD+) were used as substrates to stimulate respiration. Two sequential ADP (100-200 μM)

Ac ce p

additions were performed in order to determine state 3 and state 4 oxidation rates. Complex I activity (with malate as a substrate) was inhibited by the addition of 3 μM rotenone. The cytochrome pathway was inhibited with 1.2 mM KCN in the presence of 1 mM pyruvate and 10 mM dithiotreitol (DTT) to activate the alternative pathway. The alternative pathway was inhibited with 3 mM benzhydroxamic acid (BHAM). The AOX capacity was calculated as a KCN-insensitive and BHAM-sensitive oxygen consumption. Respiratory control (RC) was calculated as a ratio of the oxygen uptake rate of mitochondria in the presence of both substrate and ADP (state 3) to the rate in the presence of substrate but the absence of ADP (state 4) since ADP has totally phosphorylated to form ATP. The ADP/O ratio reflecting the efficiency of ATP synthesis in the presence of the given substrate was calculated as

Page 8 of 38

9   

the amount of ADP phosphorylated to the amount of atoms of oxygen consumed and was expressed as nano-atoms ADP/nano-atoms O2. The mitochondrial integrity was calculated by comparison of cytochrome with oxidase (COX, EC 1.9.3.1) activity measured in isotonic medium, first in the absence and then in the

ip t

presence of 0.04% (w/v) Triton X-100 to disrupt mitochondrial membranes. The COX activity

cr

was assayed as the rate of oxygen uptake at 25°C in the presence of ascorbic acid as a reducing agent, and a saturating dose (50 μM) of cytochrome c in a medium containing 20-50 μg

us

mitochondrial protein. The COX activity was calculated as a difference between the rates of

protein min-1.

M

SDS-PAGE and Western blot analysis

an

oxygen utilization in the presence of Triton X-100 and KCN and expressed as nmol O2 mg-1

Protein gel blot analyses were performed using a purified mitochondrial fraction. Samples of

d

mitochondrial proteins were mixed 1:4 with Laemmli’s sample buffer with modifications (0.5 M

te

Tris, 0.2% glycerol, 10% (w/v) SDS, 0.02% (w/v) bromphenol blue) and boiled for 5 min. The

Ac ce p

portions of 30 μg of mitochondrial protein per lane were routinely separated by SDS-PAGE using Mini-PROTEAN III Electrophoretic Cell (Bio-Rad, USA) in 12.5% (v/v) polyacrylamide gels according to the standard protocol. The polypeptides were electrotransferred to nitrocellulose membranes in transfer buffer (25 mM Tris, 192 mM glycine, 10% v/v methanol, pH 9.2) using Mini Trans-Blot Electrophoretic Transfer Cell (Bio-Rad, USA) for 2.5 h at 360 mA for 4°C. The following antisera were used for immunodetection at the dilution factor of 1:1000: rabbit polyclonal antiserum against alternative oxidase, AOX1/2 (AS04 054, Agrisera, Sweden); rabbit polyclonal antiserum against cytochrome oxidase subunit II, COX2 (AS04 053A, Agrisera, Sweden). Monoclonal antiserum against voltage-dependent anion channel porin (VDAC) (from Dr. T. Elthon, Lincoln, NE) at a dilution factor 1:100 was used for immunodetection of porin as a reference protein. Visualization of the reduced form of AOX was

Page 9 of 38

10   

performed with a chemiluminescent reagent system (Sigma-Aldrich, CPS 1-60) using Kodak developing reagents (P 7042, P 7167 and F 5388) for X-ray films. Other proteins were visualized via colorimetric assay with a BCIP/NBT alkaline phosphatase system. Blots were quantified by

ip t

densitometry using Quantity One® 1-D Analysis Software, Version 4.6.9 (Bio-Rad, USA).

cr

Gene expression analysis

The analysis of gene expression was performed by Real-Time quantitative Reverse

us

Transcription PCR (qRT-PCR). Samples (5-6 midleaf regions) were removed and immediately frozen in liquid N2. Total RNA was isolated using the Aurum Total RNA Mini Kit («Bio-Rad»,

an

USA) containing polyvinylpyrrolidone (2% w/v) previously added to lysing buffer according to the manufacturer’s instruction. The RNA integrity was verified by electrophoresis in 1.2% (w/v)

M

agarose gels. RNAs were detected by ethidium bromide staining. The RNA concentration was determined using the Quant-iT™ RiboGreen® RNA Assay Kit (Invitrogen, USA) by the

d

Fluorat®-02-Panorama Spectrofluorometer (Lumex, Russia). For qRT-PCR analysis, 1 μg of the

te

total RNA was reverse transcribed with oligo-dT primer using the Maxima First Strand cDNA

Ac ce p

Synthesis Kit for qRT-PCR (Thermo scientific, USA). Reactions were carried out with the Maxima SYBR Green qPCR Master Mix (Thermo

scientific, USA) using CFX96 thermal cycler (BioRad, USA). The absence of non-specific products was checked by the melting curve analysis. The primer pairs were used: for AOX1a (forward 5’-CGATCTGACCAAGCACCACG; reverse 5’-CGGCACGGCGGCAACA), for AOX1c (forward 5’-CGTCCTCCTCCGCCACCTG; reverse 5’- CCTCCTCCCTCGCCGCCT) (Grabelnych et al., 2014), for COX2 (forward 5’- GGGTATTAGTAGATCCAGCCAT; reverse 5’- TCATCGGAACTGTTATAGTCCG) (Naydenov et al., 2008). The values of relative expression were obtained using the ∆Ct method, while normalizing the gene encoding ADPribosylation as a housekeeping gene (Ta2291; forward 5’-GCTCTCCAACAACATTGCCAAC; reverse 5’-GCTTCTGCCTGTCACATACGC) (Paolacci et al. 2009). Statistical analysis of data

Page 10 of 38

11   

was carried out using CFX Manager (Bio-Rad, USA). All experiments were repeated three times with cDNA isolated from independently prepared samples and each transcript analysis was repeated three times giving a total of nine replications per time period.

ip t

Soluble carbohydrate content The content of soluble low-molecular sugars (sum of mono-, di-, and oligosaccharides)

cr

were measured with normal phase HPLC. Samples (fresh leaves, 1–3 g) were fixed with 96%

us

ethanol. Carbohydrates were extracted from samples with 80% ethanol. Extracts were purified from contaminations by the method of solid phase extraction using Diapack-Amin concentrating

an

cartridges (BioKhimMak, Russia). Soluble carbohydrates were analyzed on the Diasorb 130 Amin column (250×4 mm); particles were of 6 μm (BioKhimMak, Russia), refractometer was

M

used for detection. Elution was performed with a mixture of acetonitrile and water (70 : 30); the rate of elution was 0.6 ml/min. D-xylose, D-fructose, D-maltose, D-galactose, sucrose, D-

d

raffinose, and other carbohydrates were used as standards. The amount of soluble carbohydrates

Ac ce p

te

was calculated by the method of absolute graduating.

Statistical analysis

The results presented were mean values with standard errors (SE) of n (n = 3–15) from three

or four independent experiments. After checking for normal distribution of variables, data were analyzed using one way ANOVA followed by parametric Duncan’s test and nonparametric Mann-Whitney U-test (P 0.05). Tests were implemented using Statistica 6.1 software (StatSoft. Inc., Tulsa, OK, USA).

Results CO2 exchange: photosynthesis, respiration, and photorespiration

Page 11 of 38

12   

During the first hours of de-etiolation the leaf net-photosynthetic rate (PN) was negative (Fig 1). Over time, the CO2-emission in the light decreased, and after 6 hours of illumination the net CO2-exchange became positive. During de-etiolation PN demonstrated a steady increase and after 48 hours of illumination reached nearly 6 μmol CO2 m-2 s-1.

ip t

During the first 6 hours of de-etiolation the rate of CO2 emission, reflecting the activity of dark respiration (RD), slightly increased. After 12 hours, RD decreased and stabilized at 2 μmol

cr

CO2 m-2 s-1.

us

To determine the activity of photorespiration (PR), we measured the light-to-dark respiration rates in greening leaves. We did not detect PIB during the first 6 hours of de-etiolation (Fig. 1).

an

The marked values of PIB were observed during the later stages of greening: after 24 hours of exposure to light the PIB increased to approx. 3 μmol CO2 m-2 s-1. This means that the actual rate

M

of photorespiration (PIB minus RD) was equal to approx. 1 μmol CO2 m-2 s-1.

d

O2 exchange and capacities of the cytochrome and alternative pathways in leaf tissue

te

Recently, the patterns in respiratory activity and changes in respiratory pathways capacity

Ac ce p

ratio in the first leaf of wheat seedlings during their de-etiolation were described (Garmash et al., 2013, 2014). The dynamics of CO2 and O2 consumption followed the same pattern; however, changes in O2 consumption were more distinct. Generally, the total respiration (Vt) changes during the first 1 or 2 hours became less obvious after being exposed to light (Fig. 2A). Later on, Vt increased during the first 6 hours. This initial spike was followed by a decline over the next 6 hours, and then Vt stabilized at approx. 250 nmol g-1FW min -1, and stayed as such until the end of the experiment. Changes in Vt were mainly associated with changes in AP capacity (Valt) (Fig. 2B). Valt value and the relative part of AP capacity in the total respiration (Valt/Vt) increased by 10 and 2 times respectively during the first 6 hours of de-etiolation (Fig. 2B,C). Thereafter, Valt and decreased twice and stabilized at approx. 70 nmol O2 g-1FW min -1.

Page 12 of 38

13   

After a prolonged exposure in the dark for 18 hours, Vt dropped two times compared to that before darkening, and it was by 35% lower than the rate in the 6-day-old seedlings exposed to 24 hours of continuous light (Fig. 2A). The AP and the Valt/Vt value of darkened seedlings decreased by 3.2 and 1.5, respectively (Fig. 2B,C). The CP capacity decreased also but to a lesser

ip t

extent (by 1.4). Moving darkened seedlings back to light conditions caused a spike in respiration

cr

activity, which was mainly associated with the increased AP capacity. Interestingly enough, the Valt and the Valt/Vt values in leaves of the 7-day-old seedlings exposed to variable light

us

conditions was higher than that in the experiment having continuous light conditions (after 48 h

an

of de-etiolation).

Respiratory activity of isolated mitochondria

M

Mitochondria isolated from greening wheat leaves were quite pure and intact. Broken thylakoids are usually the main contaminants of mitochondria extracted from green tissues

d

(Keech et al., 2005). Contamination of purified mitochondrial fraction expressed as chlorophyll

te

content was very low and equal to 0.07 ± 0.05 and 0.17 ± 0.03 μg ml-1 for preparation of

Ac ce p

mitochondria from leaves after 24 and 48 hours of de-etiolation, respectively. The integrity of the outer membrane estimated by the latency of cytochrome c oxidase (COX) was about 90% (Table).

Purified mitochondria showed a reasonable, within the range normally reported for some

other species, respiratory coupling (respiratory coefficient, RC) and ADP/O ratios on different substrates (Szal et al., 2003, 2009; Keech et al., 2005; Juszczuk et al., 2007) (Table). The oxidation rates in the presence of ADP (state 3) and in the presence of four different substrates demonstrated less typical values for monocotyledonous species (Szal et al., 2003; Hong et al., 2004). The oxidative properties of mitochondria isolated from the leaves of wheat seedlings during de-etiolation were tested on four substrates (Fig. 3). The rate of respiratory oxidation on different

Page 13 of 38

14   

substrates in state 3 changed during greening (Fig. 3A). On the average, the highest rates of respiration were observed with malate (in the presence of glutamate), the lowest – with glycine. Respiration of mitochondria during oxidation of malate increased after exposure of seedlings to light and reached its peak values after 6 hours of de-etiolation, but dropped two times after 24

ip t

hours of greening. Contrary to that was reported with malate, succinate oxidation gradually

mitochondria after 6 and 24 hours of greening, respectively.

cr

decreased during de-etiolation. Exogenous NADH and glycine were more rapidly oxidized by

us

The level of AOX capacity was substrate-dependent (Fig. 3B). The higher AOX capacity during oxidation of malate (30% of total respiration in state 3) was observed in mitochondria

an

isolated after 6 hours of de-etiolation. On the contrary, AOX capacity with succinate did not change significantly during de-etiolation. When NADH and glycine were used as a respiratory

M

substrate, the higher AOX capacity (up to 40%) was observed after 6 and 24 hours of deetiolation, respectively. The higher sensitivity of respiratory rates to the AOX inhibitor (BHAM)

d

was followed by a decrease in the ADP/O value, indicating a decline in mitochondrial coupling.

Ac ce p

etiolation (Fig. 3C).

te

COX activities had the highest values in mitochondria of etiolated leaves and after 6 hours of de-

AOX and COX protein levels The observed changes in respiration patterns in greening leaves and isolated mitochondria

showed that components of mitochondrial ETC responded to light conditions. In order to find out if these modulations can be attributed to changes of the content of respiratory proteins, immunoblotting of nucleus-encoded proteins of AOX pathway and COX2 as a cytochrome pathway component was carried out, using VDAC as a reference. It is known that a common wheat genome contains two non-homologous genes (AOX1a and AOX1c) encoding AOX1 proteins (Takumi et al. 2002). Both AOX1a and AOX1c are located in three homologous loci at least, and additional AOX genes with a lower homology are also

Page 14 of 38

15   

present in the genome of common wheat (Takumi et al. 2002). Previously, only a single monomeric band corresponding to the reduced form of AOX with molecular weight 40 kDa (Naydenov et al. 2008) and 37 kDa deduced from the cDNA sequences of the two AOX genes (Takumi et al. 2002) was detected. Thanks to the immunoblot analysis using anti-AOX specific

ip t

polyclonal antibodies, we were able to detect three well expressed bands with molecular weights

cr

of 34, 36 and 38 kDa, respectively (Fig. 4A). We can hardly attribute each isoform of AOX protein to a specific gene and, thus, believe that all isoforms are rather a mixed product resulting

us

from expression of both AOX1 genes. Relative values of AOX were slightly higher in the etiolated leaves (Fig. 4B). From the start of de-etiolation, the abundance of all AOX isoforms

an

decreased, and was the lowest after 6 h. During the followed period of 42 hours, levels of AOX 36 kDa isoform slightly increased, whereas other AOX bands (34 and 38 kDa) stayed

M

unchanged. Relative values of the COX2 protein were not significantly affected during greening.

d

AOX and COX gene expression

te

To study the relationship between the respiratory activity and mitochondrial ETC proteins,

Ac ce p

on the one hand, and expression of representative genes, on the other, qRT-PCR analysis using specific pairs of primers was carried out. We also checked which genes were up-regulated directly by light. The relative abundance of АОХ1а transcripts was considerably higher compared to that of AOX1c (Fig. 5). Among the genes examined, only expression of AOX1a during the de-etiolation phase and after retransfer to the light following the prolonged darkness, exhibited a pattern of a prominent dependence on light. Interestingly enough, the AOX1a expression, while having increased right after the retransfer to the light, remained as such later on (Fig. 5). Expression of the other gene encoding AOX protein in wheat – AOX1c – mainly proceeded in a complementary to AOX1a manner. The relative values of expression of a gene encoding cytochrome c oxidase (COX2) during the first 6 hours of the de-etiolaton phase changed not significantly, however, later increased

Page 15 of 38

16   

during the next 6 hours with a subsequent decrease at the end of the experiment (Fig. 5). After the prolonged exposure to darkness, the abundance of COX2 transcripts did not change. Retransferring the seedlings to the light led to a significant increase in the gene expression only

ip t

after 4 hours of exposure to light. Thereafter, COX2 suppression was detected.

cr

Changes in the soluble carbohydrates content

5-day-old etiolated seedlings had the highest soluble sugar concentration – approx. 5 % of

us

dry weight (Fig. 6). The concentration of sugars decreased during de-etiolation and was reduced by almost two times at the end of the experimental period. In the first leaf of wheat seedlings,

an

transferred to the prolonged 18-h darkness after 6-h exposure to the light, the sugar concentration decreased by 35% compared to the initial level. After returning the seedlings from the darkness

M

to the light conditions for the next 24 h, the carbohydrate content in the leaves of 7-day-old seedlings was two times lower than in the leaves of seedlings left under continuous light

Ac ce p

Discussion

te

d

conditions (after 48 hours of de-etiolation).

In the present study, the etiolated wheat leaves exposed to the light responded by

changing the transcript, protein level, and AOX capacity. We discuss the relationship between these shifts in AOX engagement and changes in mitochondrial respiratory chain activity, as well as metabolic changes in developing photosynthesizing leaf tissues. In wheat, AOX proteins are encoded by two AOX1 genes (a, c) (Takumi et al., 2002). The

steady-state level of AOX1a and AOX1c transcripts increased under the cold stress, while only levels of AOX1a increased following a treatment by cyanide (Takumi et al., 2002; Mizuno et al., 2008). Our results indicated that only AOX1a was up-regulated by light. A tangible proof of this phenomenon was the increased AOX1a expression both in the beginning of the de-etiolation phase, and after exposure of seedlings to the light following a period of the prolonged darkness

Page 16 of 38

17   

(Fig. 5). Light regulation of AOX1a in Arabidopsis leaves is considered to be phytochromemediated (Escobar et al., 2004, Tepperman et al., 2004; Zhang et al., 2010). Phytochromes, phototropins and cryptochromes can influence response to light of AOX1a gene (Zhang et al., 2010). Expression of AOX1c in wheat leaf did not demonstrate any response to light (Fig. 5)

ip t

though expression of AOX1c in rice turned out to be light-dependent (Feng et al., 2007).

cr

To which degree the main respiratory pathway components respond to light remains unclear (Rasmusson and Escobar 2007). In our experiments, expression of COX2 cytochrome c oxidase

us

subunit gene increased during the de-etiolation phase and after the retransfer to the light. However, an increase occurred later than in the case of AOX1a expression (Fig. 5). The increase

an

in COX activity in isolated mitochondria after 6 hours of de-etiolation (Fig. 3), while the levels of COX2 protein remained unchanged, also was detected (Fig. 4). Our results suggest that during

M

de-etiolation the main respiratory chain component, cytochrome c oxidase, didn’t show any direct dependence from light. However, this fact cannot be considered as diminishing the

d

importance of cytochrome pathway activity as that supporting photosynthesis. Photosynthetic

te

metabolites, sugars in particular, are potential light-dependent factors for the main respiratory

Ac ce p

chain component’s induction (Rasmusson and Escobar, 2007). In Arabidopsis plants adapted to the darkness, light produced an increase in transcript levels of genes encoding cytochrome c and subunits of Complex IV, although being smaller than that produced by sugars (Welchen et al., 2002). We detected significant positive correlations of the CP capacity with sugar levels and growth rate of the first wheat greening leaf (Garmash et al., 2014). Recently, effects of high light induction of AOX genes expression in Arabidopsis leaves,

followed by an increase in the amount of AOX protein, were reported (Yoshida, Noguchi, 2009; Yoshida et al., 2011). Treatment of pea mesophyll protoplasts intense light led to stimulation of AOX capacity and AOX protein abundance (Dinakar et al., 2010). Noguchi et al. (2005) observed that in the low light, most of the AOX protein in Alocasia odora leaves remained in their inactive, oxidized dimmer form, but was converted to its reduced active form when plants

Page 17 of 38

18   

were grown in high light. However, in our studies, the АОХ1а expression of wheat closely followed the dynamics of AP capacity during de-etiolation and dark-to-light transition (Fig. 2, 5) but did not correlate with the protein level of AOX (Fig. 4). The absence of any correlation between the abundance of AOX and the AP activity or the capacity was previously reported in

ip t

experiments with soybean cotyledons during greening (Ribas-Carbo et al., 2000) and in leaves of

cr

cucumber grown under different light intensities (Florez-Sarasa et al., 2009). This indicates that additional mechanisms of enzyme regulation such as a post-translational control and substrate

us

limitation, as mentioned by McDonald et al. (2002), Rasmuson and Escobar (2007), and FlorezSarasa et al. (2009) were present.

an

During the first 6 h of de-etiolation both AOX1a expression and AP capacity values increased (Fig. 2, 5), however, changes in AOX protein abundance showed a declining trend

M

(Fig. 4). After this period, AOX1a expression and AP capacity dropped following a decrease in the respiratory activity. On the other hand, there was a slight increase in the concentration of the

d

AOX protein (mainly the AOX 36 kDa isoform). The decrease in respiration could be associated

te

with depletion of the carbohydrate pool during de-etiolation under continuous light conditions

Ac ce p

(Fig. 1). Carbohydrate levels could affect levels of α-keto acids (pyruvate and α-keto glutatrate) (summarized in Noguchi, 2005, Vanlerberghe, 2013). It is known that biochemical control of the partitioning of electrons to AOX is, at least to some extent, is the result of a feed-forward activation of AOX by upstream carbon (pyruvate) and redox (NAD(P)H) status (Vanlerberghe, 2013). It’s probable that sugar depletion affected AOX1a expression, which, in turn, might be the reason for changes in AOX activity (Rasmusson and Escobar 2007). After the prolonged period of darkness in the case of wheat seedlings, AOX1a expression, respiratory activity, and AP capacity significantly decreased following depletion of the carbohydrate pool (Fig. 2, 5, 6). At the same time, COX2 expression did not change, and the CP capacity decreased at a slower pace compared to the capacity of AP. These results can be considered as a confirmation of the fact

Page 18 of 38

19   

that plant cells avoid AOX engagement when it is either not necessary or deleterious to the energetic metabolism (Priault et al. 2007). The discrepancy between the levels of AOX protein and changes in the AP capacity points to a possible conclusion that for many diurnally cycling genes, protein abundance and/or enzyme

ip t

activity are regulated primarily post-translationally, simply because daily protein turnover

cr

(degradation and resynthesis) would become energetically exhaustive for the plant (Rasmusson and Escobar 2007).

us

We may conclude that the upkeep of the relatively steady level of the AOX protein in its reduced form might be associated with way mitochondria respond to changes in metabolism in

an

the developing greening cells, while only reduced state of AOX can be further activated by the metabolic intermediate pyruvate and redox (NAD(P)H) (summarized in McDonald et al., 2002;

M

Vanlerberghe et al., 2013). There is no sufficient evidence that the inactive oxidized form of the AOX protein even exists in vivo (Millenaar and Lambers, 2003). Nevertheless, in our studies

d

plants were not exposed to light-induced stress to cause prominent changes in AOX protein

te

level, reported for high light conditions (Noguchi et al., 2005; Yoshida and Noguchi, 2009;

Ac ce p

Dinakar et al., 2010; Yoshida et al., 2011). In the case of the AOX 36 kDa isoform, a small increase in its abundance after 24 h of illumination, was likely caused by some increase in the photosynthetic and photorespiratory activity. This AOX isoform in wheat leaves might be more sensitive to changes in levels of photosynthetic-generated metabolites. Therefore, additional studies are needed on effects of light on the AOX pathway during de-etiolation. The oxidative activity of mitochondria (state 3) and AOX capacity, when malate was used

as a respiratory substrate, increased during the first 6 hours of exposure to light (Fig. 3) due to an increase in the capacity of Complex I (Juszczuk et al., 2007; Szal et al., 2009). It could also be an indirect sign of an enhanced activity of mitochondrial malate dehydrogenase (MDH). The TCA cycle is not completely inactive when exposed to the light, and has important functions, with supplying a photosynthesizing cell with carbon skeletons being the major one (Nunes-Nesi et al.,

Page 19 of 38

20   

2007). Several genes for enzymes of the TCA cycle including MDH were reported to be light activated (Tepperman et al., 2004; summarized in Igamberdiev et al., 2014). We suppose that the enhanced ability to oxidize malate could be connected with complemental pathway for supply of oxaloacetate (OAA) derived from MDH for the partial TCA cycle in the light (Gardeström et al.,

ip t

2002).

cr

The rate of succinate oxidation showed dynamics different to that observed in the case of the malate oxidation during the first 6 hours of the de-etiolation phase. These data support

us

previously reported findings in the case of light inhibition of succinate dehydrogenase (SDH) (Popov et al., 2010). It was also reported that OAA, formed during malate oxidation, competed

an

with succinate and, subsequently, inhibited the activity of SDH (Shugaev and Vyskrebentseva, 1988, Abdrakhimova et al., 1998). We suppose that the higher mitochondrial activity with malate

M

to the 6th hour of de-etiolation, which correlated with the increased respiration and AOX capacity in leaf tissue (Table 1), could supply a greening cell with carbon skeletons to promote a rapid

d

development of chloroplasts. At that time, prolamellar bodies were already converted into

te

thylakoids (Garmash et al., 2013), and net-photosynthetic activity became positive (Fig. 1).

Ac ce p

After 6 hours of de-etiolation, respiration in isolated mitochondria had higher values in the case of NADH added as a substrate, thus indicating the increased NDex activities. Moreover, the AOX capacity and AOX engagement level expressed as a percentage of state 3 respiration, when NADH was added as the respiratory substrate, also turned out to be a highly reliable parameter at this stage of de-etiolation (Fig. 3). This fact can be attributed to the supply of an additional NADH for mETC due to increased photosynthetic activity. In the light, the respiratory chain is thought to dissipate excess reductants produced in the chloroplasts and imported to the mitochondria via different valves (Raghavendra and Padmasree, 2003; Noguchi and Yoshida, 2008). Photorespiration is required for the optimal photosynthesis (Keys and Leegood, 2002). Expression of several photorespiratory enzymes as well as development of peroxisomes were

Page 20 of 38

21   

reported as being directly up-regulated by light (McClung et al., 2000; Hu and Desai, 2008). A large amount of photorespiratory NADH is considered to be consumed by the respiratory chain, whereas internal NADH dehydrogenase (NDin) and AOX are important for oxidation of photorespiratory NADH (Igamberdiev et al., 2001). Our data are in line with the statements

ip t

mentioned above. We found that the rate of glycine oxidation in the presence of rotenone,

cr

reflecting the NDin activity (Gardeström et al., 2002) and AOX capacity with glycine, increased after 24 hours of greening (Fig. 3A,B). This was accompanied by an increase in the

us

photorespiration activity as well (Fig. 1). It should also be mentioned that AOX is activated by pyruvate, which, in turn, can be directly caused by the NAD-malic enzyme functioning in the

an

light since pyruvate kinase is inhibited by NH4+, a product of photorespiratory glycine decarboxylase complex (summarized in Igamberdiev et al., 2014).

M

The ability of mitochondrial ETC to induce a flow of electrons through the non-protonpumping paths (NDex, NDin and AOX) was observed after 24 hours of the de-etiolation phase,

d

when mitochondria were able to obtain and oxidize a larger amount of reductants from the

te

completely developed photosynthetic machinery and photorespiration, thereby preventing over-

Ac ce p

reduction of mETC and protecting cells against oxidative stress.

Conclusions

During de-etiolation of wheat seedlings the AOX1a expression in leaves was up-regulated

by light. The light-sensitive expression of AOX1a was followed by an increase in the AP capacity during the first 6 hours of de-etiolation, with further decrease thereafter.

Three

isoforms of AOX protein with molecular weights of 34, 36 and 38 kDa were detected. The АОХ1а expression and AP capacity did not correlate with relative concentrations of AOX proteins. This speaks in favor of a presence of a post-translational control of the enzyme activation. The decrease in the respiratory activity and AP capacity could be associated with depletion of the carbohydrate pool after 24 hours of de-etiolation, pointing to effects of substrate

Page 21 of 38

22   

regulation on AOX engagement in greening cells. The experiments with isolated mitochondria allowed certain assumptions in regards to reasons governing changes in mitochondrial respiration during development of a photosynthesizing cell. Higher mitochondrial activities and the AOX capacity when using malate along with a simultaneous decrease in succinate oxidation

ip t

during the first 6 hours of de-etiolation, may suggest an enhanced activity of MDH. This, in turn,

cr

can stimulate the partial TCA cycle operation to provide a greening cell with carbon skeletons and encourage fast development of chloroplasts under continuous light conditions. The increased

us

ability of mitochondrial ETC to induce the electron flow through the non-proton-pumping paths (AOX, NDin, NDex) after 24 hours of de-etiolation was argued to be a result of the increasing

an

photosynthetic and photorespiratory activities. Overall, our results suggest that AOX plays an important role during development of photosynthesizing cells and can rapidly react to changes in

M

metabolism and photosynthetic activity. Further studies on mechanisms of light-induced effects

Ac ce p

Acknowledgments

te

d

on AOX pathway activation during de-etiolation are needed.

This work is supported by the grant from the Ural Branch of the Russian Academy of

Sciences (No 12-Y-4-1008). The authors would like to thank Anna M. Rychter for helpful comments and Monika Ostaszewska for performing of AOX immunodetection, Institute of Experimantal Biology and Biotechnology, Faculty of Biology, University of Warsaw, Poland.

Page 22 of 38

23   

References Abdrakhimova IR, Khokhlova LP, Abdrakhimov FA. Respiration and morphology of mitochondria in the crown of winter wheat plants exposed to low temperature and cartolin. Russ

ip t

J Plant Physiol 1998; 45(2): 213–20. Balaur NS, Vorontsov VA, Kleiman EI, Ton YuD. Novel technique for component

cr

monitoring of CO2 exchange in plants. Russ J Plant Physiol 2009; 56(3): 423–27.

us

Dinakar C, Raghavendra AS, Padmasree K. Importance of AOX pathway in optimizing photosynthesis under high light stress: Role of pyruvate and malate in activating of AOX.

an

Physiol Plant 2010; 139(1): 13-26.

Escobar MA, Franklin KA, Svensson ÅS, Salter MG, Whitelam GC, Rasmusson AG. Light

M

regulation of the Arabidopsis respiratory chain. Multiple discrete photoreceptor responses

2710–21.

d

contribute to induction of type II NAD(P)H dehydrogenase genes. Plant Physiol 2004; 136:

te

Feng HQ, Li HY, Zhou GM, Liang HG, Duan JG, Zhi DJ, Li X, Ma J. Influence of

Ac ce p

irradiation on cyanide-resistant respiration and AOX1 multi-gene family expression during greening of etiolated rice seedlings. Photosynthetica 2007; 45(2): 272–9. Finnegan PM, Whelan J, Millar AH, Zhang Q, Smith MK, Wiskich JT, Day DA. Differential

expression of the multigene family encoding the soybean mitochondrial alternative oxidase. Plant Physiol 1997; 114: 455–66. Florez-Sarasa I, Ostaszewska M, Galle A, Flexas J, Rychter AM, Ribas-Carbó M. Changes

of alternative oxidase activity, capacity and protein content in leaves of Cucumis sativus wild type and MSC16 mutant grown under different light intensities. Physiol Plant 2009; 137(4): 419–26. Gardeström P, Igamberdiev AU, Raghavendra AS. Mitochondrial functions in the light and significance to carbon–nitrogen interaction. In: Foyer CH, Noctor G, editors. Photosynthetic Page 23 of 38

24   

nitrogen assimilation and associated carbon and respiratory metabolism. Dordrecht: Kluwer Academic Publishers; 2002. p. 151–72. Garmash EV, Dymova OV, Malyshev RV, Plyusnina SN, Golovko TK. Developmental

ip t

changes in energy dissipation in etiolated wheat seedlings during the greening process. Photosynthetica 2013; 51(4): 497-508.

cr

Garmash EV, Malyshev RV, Shelyakin MA, Golovko TK. Activities of respiratory

seedlings. Russ J Plant Physiol 2014; 61(2): 160–8.

us

pathways and the pool of nonstructural carbohydrates in greening leaves of spring wheat

an

Grabelnych OI, Borovik OA, Tauson EL, Pobezhimova TP, Katyshev AI, Pavlovskaya NS, Koroleva NA, Lyubushkina IV, Bashmakov VYu, Popov VN, Borovskii GB, Voinikov VK.

M

Mitochondrial energy-dissipating systems (alternative oxidase, uncoupling proteins, and external NADH dehydrogenase) are involved in development of frost-resistance of winter wheat

te

d

seedlings. Biochemistry (Moscow) 2014; 79(6): 647–62. Hong HTK, Nose A, Agarie S. Respiratory properties and malate metabolism in Percoll-

Ac ce p

purified mitochondria isolated from pineapple, Ananas comosus (L.) Merr. cv. smooth cayenne. J Exp Bot 2004; 55(406): 2201–11. Hu J, Desai M. Light control of peroxisome proliferation during Arabidopsis

photomorphogenesis. Plant Signaling Behavior 2008; 3: 801–803. Huang S., Jacoby RP, Shingaki-Wells RN, Li L, Millar AH. Differential induction of

mitochondrial machinery by light intensity correlates with changes in respiratory metabolism and photorespiration in rice leaves. New Phytologist 2013; 198: 103–115. Igamberdiev AU, Bykova NV, Lea PJ, Gardeström P. The role of photorespiration in redox and energy balance of photosynthetic plant cells: A study with a barley mutant deficient in glycine decarboxylase. Physiol Plant 2001; 111: 427–38.

Page 24 of 38

25   

Igamberdiev AU, Eprintsev AT, Fedorin DN, Popov VN. Phytochrome-mediated regulation of plant respiration and photorespiration. Plant Cell Environ 2014; 37(2): 290–9. Juszczuk IM, Flexas J, Szal B, Dąbrowska Z, Ribas-Carbo M, Rychter AM. Effect of mitochondrial genome rearrangement on respiratory activity, photosynthesis, photorespiration

ip t

and energy status of MSC16 cucumber (Cucumis sativus) mutant. Physiol Plant 2007; 131: 527–

cr

41.

Keech O, Dizengremel P, Gardeström P. Preparation of leaf mitochondria from Arabidopsis

us

thaliana. Physiol Plant 2005; 124: 403–9.

Keys AJ, Leegood RC. Photorespiratory carbon and nitrogen recycling: evidence from

an

mutant and transgenic plants. In:Foyer CH, Noctor G, editors. Photosynthetic nitrogen assimilation and associated carbon and respiratory metabolism. Dordrecht: Kluwer Academic

M

Publishers; 2002. p. 115–34.

Kravtsov AK, Zubo YO, Yamburenko MV, Kulaeva ON, Kusnetsov VV. Cytokinin and

te

Regul 2011; 64:173–83.

d

abscisic acid control plastid gene transcription during barley seedling de-etiolation. Plant Growth

Ac ce p

Krömer S, Malmberg G, Gardeström P. Mitochondrial contribution to photosynthetic metabolism. A study with barley (Hordeum vulgare L.) leaf protoplasts at different light intensities and CO2 concentrations. Plant Physiol 1993; 102: 947–55. López-Juez E. Plastid biogenesis, between light and shadows. J Exp Bot 2007; 58:11–26. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the folin phenol

re agent. J Biol Chem 1951; 193: 265–75. Maxwell DP, Wang Y, McIntosh L. The alternative oxidase lowers mitochondrial reactive oxygen production in plant cells. Proc Nat Acad Sci USA 1999; 96: 8271–76. McClung CR, Hsu M, Painter JE, Gagne JM, Karlsberg SD, Salomé PA. Integrated temporal regulation of the photorespiratory pathway. Circadian regulation of two Arabidopsis genes encoding serine hydroxymethyltransferase. Plant Physiol 2000;123: 381–92.

Page 25 of 38

26   

McDonald AE, Sieger SM, Vanlerberghe GC. Methods and approaches to study plant mitochondrial alternative oxidase. Physiol Plant 2002; 116: 135–43. Millenaar FF, Lambers H. The alternative oxidase: In vivo regulation and function. Plant Biol. 2003; 5: 2–15.

ip t

Mizuno N, Sugie A, Kobayashi F, Takumi S. Mitochondrial alternative pathway is associated

cr

with development of freezing tolerance in common wheat. J Plant Physiol 2008; 165: 462–7. Møller IM, Bérczi A, van der Plas LHW, Lambers H. Measurement of the activity and

us

capacity of the alternative pathway in intact plant tissues: Identification of problems and possible

an

solutions. Physiol Plant 1988; 72: 642–9.

Naydenov NG, Khanam SM, Atanassov A, Nakamura G. Expression profiles of respiratory

M

components associated with mitochondrial biogenesis during germination and seedling growth under normal and restricted conditions in wheat. Genes Genet Syst 2008; 83: 31–41.

d

Nishimura M, Douce R, Akazawa T. Isolation and characterization of metabolically

te

competent mitochondria from spinach leaf protoplast. Plant Physiol 1982; 669: 916–20.

Ac ce p

Noguchi K., Taylor N.L., Millar A.H., Lambers H., Day D.A. Response of mitochondria to light intensity in the leaves of sun and shade species. Plant Cell Environ 2005; 28: 760–771. Noguchi K, Yoshida K. Interaction between photosynthesis and respiration in illuminated

leaves. Mitochondrion 2008; 8: 887–99. Noguchi K. Effects of light intensity and carbohydtrate status on leaf and root respiration. In:

Lambers H, Ribas-Carbo M, editors. Plant respiration: from cell to ecosystem. Dordrecht: Springer; 2005. p. 63-83. Nunes-Nesi A, Sweetlove LJ, Fernie AR. Operation and function of the tricarboxylic cycle in the illuminated leaf. Physiol Plant 2007; 129: 45–56.

Page 26 of 38

27   

Padmasree K, Raghavendra AS. Response of photosynthetic carbon assimilation in mesophyll protoplasts to restriction on mitochondrial oxidative metabolism: Metabolites related to the redox status and sucrose biosynthesis. Photosyn Res. 1999; 62: 231–9. Paolacci AR, Tanzarella OA, Porceddu E, Ciaffi M. Identification and validation of reference

ip t

genes for quantitative RT-PCR normalization in wheat./ BMC Mol Biol 2009; 10:11,

cr

doi:10.1186/1471-2199-10-11.

Popov VN, Eprintsev AT, Fedorin DN, Igamberdiev AU. Succinate dehydrogenase in

us

Arabidopsis thaliana is regulated by light via phytochrome A. FEBS Letters 2010; 584: 199– 202.

an

Priault P, Vidal G, De Paepe R, Ribas-Carbo M. Leaf age-related changes in respiratory pathways are dependent on Complex I activity in Nicotiana sylvestris. Physiol Plant 2007;

M

129(2):152–62.

Raghavendra AS, Padmasree K. Beneficial interactions of mitochondrial metabolism with

d

photosynthetic carbon assimilation. Trends Plant Sci 2003; 8: 546–53.

te

Rasmusson AG, Escobar M. Light and diurnal regulation of plant respiratory gene

Ac ce p

expression. Physiol Plant 2007;129(1): 57–67. Ribas-Carbo M, Robinson SA, González-Meler MA, Lennon AM, Giles L, Siedow JN, Berry

JA. Effects of light on respiration and oxygen isotope fractionation in soybean cotyledons. Plant Cell Environ 2000; 23: 983–9.

Shugaev AG, Vyskrebentseva EI. Succinate “monopolizes” the mitochondrial respiration

chain of developing sugar beet roots. Fiziol Rast (Moscow) (Sov Plant Physiol) 1988; 35: 421–8. Szal B, Jolivet Y, Hasenfratz-Sauder M-P, Dizengremel P, Rychter AM. Oxygen concentration regulates alternative oxidase expression in barley roots during hypoxia and posthypoxia. Physiol Plant 2003; 119: 494–502.

Page 27 of 38

28   

Szal B, Łukawska K, Zdolińska I, Rychter AM. Chilling stress and mitochondrial genome rearrangement in the MSC16 cucumber mutant affect the alternative oxidase and antioxidant defense system to a similar extent. Physiol Plant 2009; 137:435–45. Takumi S, Tomioka M, Eto K, Naydenov N, Nakamura C. Characterization of two non-

ip t

homoeologous nuclear genes encoding mitochondrial alternative oxidase in common wheat. Gen

cr

Cenet Syst 2002; 77: 81–8.

Tepperman JM, Hudson ME, Khanna R, Zhu T, Chang SH, Wang X, Quail PH. Expression

us

profiling of phyB mutant demonstrates substantial contribution of other phytochromes to redlight-regulated gene expression during seedling de-etiolation. Plant Journal 2004; 38: 725–39.

an

Vanlerberghe GC, Cvetkovska M, Wang J. Is the maintenance of homeostatic mitochondrial signaling during stress a physiological role for alternative oxidase? Physiol Plant 2009; 137(4):

M

392–6.

Vanlerberghe GC, McIntosh L. Alternative oxidase: From gene to function. Annu Rev Plant

d

Physiol Plant Mol Biol 1997; 48: 703–34.

te

Vanlerberghe GC. Alternative oxidase: a mitochondrial respiratory pathway to maintain

Ac ce p

metabolic and signaling homeostasis during abiotic and biotic stress in plants. Int J Mol Sci 2013; 14: 6805–47. doi:10.3390/ijms14046805 Vojnikov V, Korzun A, Pobezhimova T, Varakina N. Effect of cold shock on the

mitochondrial activity and on the temperature of winter wheat seedlings. Biochem Physiol Pflanzen 1984; 179: 327–30.

Welchen E, Chan RL, Gonzalez DH. Metabolic regulation of genes encoding cytochrome c

and cytochrome c oxidase subunit vb in Arabidopsis. Plant Cell Environ 2002; 25: 1605–15. Yoshida K., Noguchi K. Differential gene expression profiles of the mitochondrial respiratory components in illuminated Arabidopsis leaves. Plant Cell Physiol 2009; 50: 1449– 1462.

Page 28 of 38

29   

Yoshida K, Watanabe C, Kato Y, Sakamoto W, Noguchi K. Influence of chloroplastic photooxidative stress on mitochondrial alternative oxidase capacity and respiratory properties: a case study with Arabidopsis yellow variegated 2. Plant Cell Physiol 2008; 49: 592–603. Yoshida K., Watanabe C.K., Hachiya T., Tholen D., Shibata M., Terashima I., Noguchi K.

ip t

Distinct responses of the mitochondrial respiratory chain to long- and short-term high-light

cr

environments in Arabidopsis thaliana. Plant Cell Environ 2011; 34: 618–628.

Zhang D.-W., Xu F., Zhang Z.-W., Chen Y.-E., Du J.-B., Jia S-D., Yuan S., Lin H.-H.

Ac ce p

te

d

M

an

seedlings. Plant Cell Environ 2010; 33: 2121-2131.

us

Effects of light on cyanide-resistant respiration and alternative oxidase function in Arabidopsis

Page 29 of 38

30   

Legends to figures Fig. 1. The net CO2 gas exchange in the first leaf of wheat seedlings during de-etiolation: 1 – net photosynthetic rate (PN); 2 – light-to-dark respiration rate during the first 4 min; 3 –

ip t

remnant dark respiration (RD). Data are presented as mean values ± SE (n = 8 – 10) collected during three independent experiments. Significant differences between mean values of each

cr

parameter during the de-etiolation phase are indicated by different letters (ANOVA, Duncan’s

us

test, P 0.05).

Fig. 2. Changes in the total respiration rate (Vt) (A), capacity of alternative (Valt) and

an

cytochrome (Vcyt) pathways (B), and Valt/Vt value (the ratio of capacity of alternative pathway to total respiration rate, %) (C) during 48 h of de-etiolation (solid lines), after prolonged exposure

M

(18 h) of seedlings de-etiolated during the first 6 hours in the darkness (d), and after retransfer to the light during the next 24 hours (L24, dashed lines). The data are presented as mean values ±

d

SE (n = 4–6) collected during three independent experiments. Significant differences between

te

mean values (ANOVA, Duncan’s test, P 0.05) are indicated by different letters.

Ac ce p

Fig. 3. Respiratory activities of mitochondria isolated from the first leaf of wheat seedlings during de-etiolation. Substrate concentrations used: 10 mM malate, 8 mM succinate, 1 mM NADH, 10 mM glycine and 100-200 μM ADP. The AOX capacity was measured in the presence of 1.2 mM KCN, 1 mM pyruvate and 10 mM DTT, and inhibited by 3 mM BHAM. Depending on the substrate, 50-100 μg of mitochondrial protein were used for measurements of respiration. The data are presented as mean values ± SE and averages from four mitochondrial isolations. Significant differences between mean values during de-etiolation (ANOVA, Duncan’s test, P 0.05) are indicated by different letters. Fig. 4. Purified mitochondria preparation immunoblots of AOX (three isoforms), COX and mitochondrial porin (VDAC) proteins in wheat leaves after different stages of de-etiolation (A). Thirty micrograms of mitochondrial protein were loaded per lane, separated by SDS-PAGE,

Page 30 of 38

31   

immunoblotted and visualized by chemiluminescence (AOX) and BCIP/NBT system (COX, VDAC). Relative values of AOX (B) and COX2 (C) protein levels, using VDAC as a reference, obtained by dividing densitometry of AOX or COX2 and VDAC bands. Blots were quantified by densitometry using Quantity One 4.6.9 software (Bio-Rad, USA). Data are presented as mean

ip t

values ± SE of three replicates. Significant differences between mean values of each parameter

cr

during the de-etiolation phase are indicated by different letters (ANOVA, Mann-Whitney U-test, P 0.05).

us

Fig. 5. Relative expression patterns of AOX1 and COX2 genes measured using

an

quantitative Real‐Time RT-PCR in wheat leaves during 48 h of de-etiolation (solid lines), after prolonged exposure (18 h) of seedlings de-etiolated during the first 6 hours in the darkness (d),

M

and after a retransfer to the light during the next 24 hours (L1-L24, dashed lines). Experiments were repeated three times with cDNA isolated from independently prepared samples and each

d

transcript analysis was repeated three times with a total of nine replications/period. The

te

transcript amounts are presented in relation to the Ta2291 housekeeping gene expression values. Significant differences between mean values of each gene expression during de-etiolation are

Ac ce p

indicated by different letters (ANOVA, Duncan’s test, P 0.05). Fig. 6. Soluble carbohydrates content during 48 h of de-etiolation (solid lines), after

prolonged exposure (18 h) of seedlings de-etiolated during the first 6 hours in the darkness (d), and after retransfer to the light during the next 24 hours (L24, dashed lines). The data are presented as mean values ± SE (n = 4–6) collected during three independent experiments. Significant differences between mean values (ANOVA, Duncan’s test, P 0.05) are indicated by different letters.

Page 31 of 38

33   

Table. Respiratory properties of mitochondria isolated from the first leaf of wheat seedlings during de-etiolation. Substrate concentrations used: 10 mM malate, 8 mM succinate, 1 mM NADH, 10 mM glycine and 100-200 μM ADP. Depending on the substrate, 50-100 μg of mitochondrial protein were used for measurements. The data are presented as mean values ± SE

3 

6

ADP/O  2.59 ± 0.21a 

2.05 ± 0.24ab 

Succinate 

1.99 ± 0.48a 

1.96 ± 0.24a 

NADH 

2.30 ± 0.46a 

Glycine 

1.65 ± 0.21a 

48 

 

2.08 ± 0.29ab 

1.93 ± 0.13b 

1.92 ± 0.32a 

1.85 ± 0.96a 

1.91 ± 0.13a 

1.82 ± 0.37b 

1.74 ± 0.11b 

1.29 ± 0.10c 

1.59 ± 0.20c 

1.83 ± 0.36a 

2.00 ± 0.35b 

1.38 ± 0.18c 

1.45 ± 0.32c 

1.98 ± 0.14 

1.64 ± 0.07 

1.59 ± 0.07 

1.74 ± 0.11 

M

d

Respiratory coefficient 

1.86 ± 0.15b 

an

Malate  

us

h 

24 

cr

0 

De‐etiolation, 

ip t

and averages from four mitochondrial isolations. Significant differences between mean values of

1.66 ± 0.09 

Succinate 

1.38 ± 0.12 

1.47 ± 0.14 

1.46 ± 0.14 

1.28 ± 0.15 

1.30 ± 0.05 

NADH 

1.53 ± 0.25 

1.54 ± 0.12 

1.53 ± 0.13 

1.79 ± 0.11 

1.50 ± 0.08 

Glycine 

1.72 ± 0.11 

1.80 ± 0.03 

1.80 ± 0.26 

1.72 ± 0.14 

1.30 ± 0.03 

93 ± 1 

87 ± 6 

88 ± 3 

Ac ce p

te

Malate  

Intactness of outer mitochondrial membrane (%)   

91 ± 5 

85 ± 2 

ADP/O during de-etiolation (ANOVA, Duncan’s test, P 0.05) are indicated by different letters.    

Page 32 of 38

an

us

cr

ip t

Figure

Ac

ce pt

ed

M

Fig. 1.

Page 33 of 38

Figure

400 d a

a b

200

ad

bc

b

c

150

100

a

a

b

d

c

a

ac

b

c e

a b

b

c

Valt

e

a

cd ae

e

e

a

ce

C

cd

M

40

b

Vcyt

e

a

50

a

b

ed

30

B

d

cr

a

us

0 180 160 140 120 100 80 60 40 20

ip t

50

0 60

Valt/Vt, %

ad

an

O2 uptake, nmol g–1(FM) min–1

300 250

A

e

350

20 10

ce pt

0

Ac

0

1

2

4

6

12 24 48

d

L24

De-etiolation, h

Fig. 2.

Page 34 of 38

Figure

malate succinate NADH glycine

b

a

100

a

b

a

80 60

a ab

a

40 a

20

b

a

a

c

c ac b

b

ac c b

0

c

a

20

c

a a

10 ab

b b

cd a

c

b

b

b

an

a

a

us

25

a

b

0 400 a

300

M

5

cr

c

30

15

B

b

35

A

ip t

120

c

b

ed

b

200

C

b

100

ce pt

COX activity, nmol O2 mg–1protein min–1

AOX capacity, Respiration (state 3), –1 –1 nmol O2 mg protein min nmol O2 mg–1protein min–1

140

0

Ac

0

3

6

24

48

De-etiolation, h

Fig. 3.

Page 35 of 38

Figure

A 38 kDa 36 kDa 34 kDa

АОХ

1

0

6

3

24

48

ip t

CОХ2

VDAC

24

6

48

B

us

De-etiolation, h 2.5

AOX 38 kDa AOX 36 kDa AOX 34 kDa

a

a

1.5

M

a

ab

0 2

a

C

b

b

b

ab

ab

ab

ed

0.5

a

a

a

ce pt

Relative value

1

a

an

a

2

cr

1

0

COX2

a

1.5

a

a

6

24

a

Ac

1

0.5 0

0

1

48

De-etiolation, h

Fig. 4.

Page 36 of 38

an

us

cr

ip t

Figure

Ac

ce pt

ed

M

Fig. 5.

Page 37 of 38

60

a

50 b b

40

b

c

30

c

cd

d

d

ip t

20

e

0 0

1

2

4

6

12

cr

10

24

48

d

L24

us

Soluble carbohydrates, mg g-1 (DM)

Figure

an

De-etiolation, h

Ac

ce pt

ed

M

Fig. 6.

Page 38 of 38