Clinical Nutrition xxx (2015) 1e8

Contents lists available at ScienceDirect

Clinical Nutrition journal homepage: http://www.elsevier.com/locate/clnu

Original article

Licochalcone F alleviates glucose tolerance and chronic inflammation in diet-induced obese mice through Akt and p38 MAPK Eun-Jung Bak a, Kyung-Chul Choi b, Sungil Jang c, d, e, Gye-Hyeong Woo f, Ho-Geun Yoon g, Younghwa Na h, Yun-Jung Yoo d, e, Youngseok Lee i, Yangsik Jeong j, **, Jeong-Heon Cha a, c, d, e, * a

Oral Cancer Research Institute, Yonsei University College of Dentistry, Seoul, South Korea Department of Biomedical Sciences, University of Ulsan College of Medicine, Seoul, South Korea BK21 PLUS Project, Yonsei University College of Dentistry, South Korea d Department of Oral Biology, Yonsei University College of Dentistry, Seoul, South Korea e Department of Applied Life Science, The Graduate School, Yonsei University, Seoul, South Korea f Department of Clinical Laboratory Science, Semyung University, Jecheon, South Korea g Department of Biochemistry and Molecular Biology, Center for Chronic Metabolic Disease Research, College of Medicine, Yonsei University, Seoul, South Korea h College of Pharmacy, CHA University, Seoul, South Korea i Department of Bio and Fermentation Convergence Technology, Kookmin University, Seoul, South Korea j Department of Biochemistry, Yonsei University Wonju College of Medicine, Wonju, South Korea b c

a r t i c l e i n f o

s u m m a r y

Article history: Received 28 October 2014 Accepted 7 March 2015

Background & aims: Licochalcone (lico) F is a novel synthetic retrochalcone. In this study, we investigated the anti-inflammatory effects of lico F in vitro, and its effects on obesity-induced chronic inflammation, glucose intolerance, and fatty liver in vivo. Methods: The inhibitory effects of lico F on TNFa-induced inflammation were investigated using NF-kB luciferase reporter assay and RT-PCR. Diet-induced obese mice were treated orally, once per day, with vehicle or lico F (10 mg/kg/day), for 3 weeks, and blood, liver, and adipose tissues were analyzed. Results: Lico F inhibited TNFa-induced NF-kB activation and mRNA expression of TNFa, COX-2, IL-6, IL1b, and NOS2. In obese mice, lico F administration significantly alleviated glucose tolerance without changes in body weight gain and food intake. Lico F reduced adipocyte size and macrophage infiltration into white adipose tissue and improved hepatic lesions, by decreasing fat droplets and glycogen deposition. The mRNA expression levels of TNFa, MCP-1, and CD68 in white adipose tissue also decreased markedly. Moreover, lico F enhanced Akt signaling, but reduced p38 MAPK signaling in white adipose tissue. Conclusions: Lico F had anti-inflammatory effects and showed beneficial effects on glucose metabolism, which could be partially caused by activation of the Akt signal pathway and obesity-induced chronic inflammation, probably by downregulating p38 signal pathway. Moreover, lico F could be used as a potential novel therapeutic compound against type 2 diabetes and obesity-induced chronic inflammation without the deleterious effects of body weight gain and fatty liver. © 2015 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.

Keywords: Licochalcone F Anti-inflammatory effect Obesity-induced chronic inflammation Diet-induced obese mice

1. Introduction * Corresponding author. Department of Oral Biology, Yonsei University College of Dentistry, 50 Yonsei-ro, Seodaemoon-gu, Seoul 120-752, South Korea. Tel.: þ82 2 2228 3061; fax: þ82 2 2227 7903. ** Corresponding author. Department of Biochemistry, Wonju College of Medicine, Yonsei University, Wonju, Gangwon-do 220-701, South Korea. Tel.: þ82 33 741 0284; fax: þ82 33 743 0411. E-mail addresses: [email protected] (Y. Jeong), [email protected] (J.-H. Cha).

Obesity is often accompanied by chronic low-grade inflammation that leads to metabolic disorders such as type 2 diabetes, cardiovascular disease, and fatty liver disease [1]. The onset of obesity begins with increasing adipose tissue mass, which results from hyperplasia and hypertrophy of adipocytes

http://dx.doi.org/10.1016/j.clnu.2015.03.005 0261-5614/© 2015 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.

Please cite this article in press as: Bak E-J, et al., Licochalcone F alleviates glucose tolerance and chronic inflammation in diet-induced obese mice through Akt and p38 MAPK, Clinical Nutrition (2015), http://dx.doi.org/10.1016/j.clnu.2015.03.005

2

E.-J. Bak et al. / Clinical Nutrition xxx (2015) 1e8

[2]. Hypertrophic adipocytes contribute to the production of proinflammatory cytokines, such as tumor necrosis factora (TNFa) and interleukin-6 (IL-6), and the activation of proinflammatory responses mediated by IkB kinase-b and c-Jun Nterminal kinase [3]. Hypertrophic adipocytes also promote chronic inflammation by adipose tissue macrophages (ATMs) which infiltrate into white adipose tissue [4]. TNFa and IL-6 were increased by ATMs which induced insulin resistance in adipocytes [5]. ATMs also played a key role in the pathophysiological conditions associated with obesity and other metabolic disorders [6]. Therefore, drugs that ameliorate the obesity-induced chronic inflammatory response may be useful as therapeutic treatments for the management of patients with type 2 diabetes and other metabolic disorders. Metformin and thiazolidinediones (TZDs), widely used as typical anti-diabetic drugs, are known to exert anti-inflammatory effects by reducing levels of TNF-a and IL-6 and by enhancing levels of adiponectin [7e9]. In addition, dietary constituents were reported to be beneficial for reducing chronic inflammation in obesity-associated metabolic disorders, and for improving hyperglycemia [10,11]. Licorice species, from the root of the leguminous Glycyrrhiza plant (G. inflata Batalin, G. uralensis Fischer, and G.glabra Linne) have been used as medicinal and sweetening agents in food products. Previous studies have reported that the constituents of licorice have various pharmacological properties [12,13]. Currently, six licochalcones (lico A-E) and echinatin have been isolated and characterized from licorice. Recently, we synthesized lico F, the seventh novel retrochalcone in a series, and investigated biological effects of lico F on inflammation in vitro and obesity-induced

chronic inflammation and glucose intolerance in vivo, using dietinduced obese mice. 2. Materials and methods 2.1. Lico F synthesis Lico F was synthesized by condensation of 1-(4-(tetrahydro-2Hpyran-2-yloxy)phenyl)ethanone with 2-methoxy-3-(3-methylbut3-en-2-yl)-4-(tetrahydro-2H-pyran-2-yloxy)benzaldehyde in EtOH with NaOH (Fig. 1A). The spectral data of synthesized lico F were consistent with the proposed structure [14]. 2.2. Luciferase reporter assay Luciferase reporter assays were conducted according to the method described previously [15]. Human HEK 293 cells were cultured in DMEM with 10% fetal bovine serum (FBS). Cells were seeded at a density of 60e70% confluency for transfection experiments. A luciferase reporter construct (0.1 mg) with the NF-kB-binding site and b-galactosidase were cotransfected using Lipofectamine PLUS reagent (Invitrogen, Carlsbad, CA, USA). After 2e3 h incubation, cells were treated with medium supplemented with charcoaldextrantreated FBS. Cells were incubated at 37  C for 24 h, washed with phosphate-buffered saline (PBS), and harvested. After 24 h, transfected cells were treated either with vehicle or lico F at a concentration of 20, 50, or 100 mM. And then, a luciferase substrate kit (Promega, Madison, WI, USA) and a MicroLumat Plus LB96V luminometer (ALT, East Lyme, CT, USA) were used to measure luciferase activity after 24 h.

Fig. 1. Structure of lico F and effect of lico F on the TNFa-induced NF-kB-dependent inflammatory response in vitro. (A) Synthetic method and structure of lico F. Lico F was synthesized by condensation of 1-(4-(tetrahydro-2H-pyran-2-yloxy)phenyl)ethanone (1) with 2-methoxy-3-(3-methylbut-3-en-2-yl)-4-(tetrahydro-2H-pyran-2-yloxy)benzaldehyde (2) in EtOH with NaOH. (B) TNFa-induced NF-kB-dependent promoter activity of lico F. HEK293 cells were transfected with a NF-kB binding site driven luciferase reporter plasmid and treated with TNFa or various concentrations of lico F. Whole cell extracts were used in the luciferase assay. Results are presented as the means of two independent experiments performed in triplicate. (C) The mRNA level of pro-inflammatory cytokines in HEK293 cells. The mRNA expression levels were evaluated via quantitative RT-PCR. lico F, licochalcone F.

Please cite this article in press as: Bak E-J, et al., Licochalcone F alleviates glucose tolerance and chronic inflammation in diet-induced obese mice through Akt and p38 MAPK, Clinical Nutrition (2015), http://dx.doi.org/10.1016/j.clnu.2015.03.005

E.-J. Bak et al. / Clinical Nutrition xxx (2015) 1e8

2.3. Animal examinations Five-week-old male C57BL/6J mice (Orient-Bio Inc., Seoul, Korea) were obtained and maintained in a temperature controlled room at 22 ± 2  C and a lightedark cycle every 12 h. Mice were acclimated for one week. The mice in control and lico F groups were fed with a 58% high fat diet (Research Diets, New Brunswick, NJ, USA) during the experimental period. The mice in lean group (n ¼ 4) were fed with normal diet (Orient-Bio Inc.) during the experimental period. After 8 weeks, in order to select mice with glucose intolerance for control and lico F groups, the glucose tolerance test (GTT) was performed. The control vehicle group (n ¼ 6) and a lico F group (n ¼ 7) were randomly selected among mice. For 3 weeks, the mice were orally administrated daily with vehicle (10% alcohol, 10% tween 80, and 80% saline) alone for the control group, or 10 mg/kg of lico F dissolved in the vehicle for the lico F group. The mice in lean group were orally administrated daily with the vehicle alone for 3 weeks. After the treatment, GTT was re-conducted and for serum biochemical analysis, blood samples were attained. Epididymal or perirenal white adipose tissue (WAT) and parenchymal organs of the liver, heart, and kidney, were dissected and weighed at necropsy. Histological analysis were performed with WAT and liver. Daily food intake and change in body weight were measured for the experimental period. The animal ethics committee of College of Dentistry in Yonsei University approved animal protocols. 2.4. Glucose tolerance test (GTT) Diet-induced obese mice were fasted for 16 h and administered with 2 g/kg glucose by intraperitoneal injection. The Accu-Check® active system (Roche, Mannheim, Germany) was used to measure blood glucose levels in accordance with the manufacturer's instructions at indicated times such as 0, 30, 60, 90 and 120 min after the glucose treatment. 2.5. Serum biochemical analysis ALT and AST assay kits were obtained from Asan Pharmaceutical (Seoul, Korea) and used to determine concentrations of alanine aminotransferase (ALT) and aspartate aminotransferase (AST), respectively. Serum insulin level was measured using an enzyme linked immunosorbent assay kit (Shibayagi, Gunma, Japan). 2.6. Histopathological analysis Tissue samples such as the epididymal WAT (EWAT) and liver were immersed in 10% neutral-buffered formalin and embedded in paraffin. Paraffin sections with thickness of 4 mm were stained with H&E. To calculate the average adipocyte cell size, the total adipocyte cell number was counted in the seven randomly selected microscopic areas of independent animals by using an Olympus CKX41 inverted microscope system (Tokyo, Japan). 2.7. Semi-quantitative reverse transcription-PCR (RT-PCR) Isolation of total RNA in human HEK 293 cells or EWAT was performed with Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. RT premix kit (Bioneer, Seoul, Korea) was used to convert two micrograms of total RNA to cDNA according to the manufacturer's instructions. In order to determine the range of exponential phase, PCR was performed with two concentrations of cDNA template and several PCR cycles using i-Star Taq (Intron, Seoul, Korea). The primers for amplification are showed in Table 1. In vitro, all assays were performed in triplicate, and three separate assays, at least, were carried out. In EWAT, in order to

3

Table 1 Primers for RT-PCR. Sequence (50 e30 )

Primers TNFa COX-2 IL-6 Human

IL-1b NOS2 GAPDH TNFa COX-2 IL-6

Mouse

IL-1b CD68 MCP-1 GAPDH

F:AGCCCATGTTGTAGCAAACC R:GGAAGACCCCTCCCAGATAG F: GTCCCTGAGCATCTACGGTTT R: CAACTGCTCATCACCCCATT F: CCCCCAGGAGAAGATTCCAA R: GCTGCTTTCACACATGTTACTCTTG F:ACCTGAGCTCGCCAGTGAA R:TCGGAGATTCGTAGCTGGAT F: ACATTCAGATCCCCAAGCTCTA R: GCCGAGATTTGAGCCTCATG F:GAGTCCACTGGCGTCTTCA R:CAGAGGGGGCAGAGATGAT F: ACGGCATGGATCTCAAAGAC R: AGATAGCAAATCGGCTGACG F: ACTCACTCAGTTTGTTGAGTCATTC R: TTTGATTAGTACTGTAGGGTTAATG F: GTTCTCTGGGAAATCGTGGA R: GGAAATTCGGGGTAGGAAGGA F: TGCAGAGTTCCCCAACTGGTACATC R: GTGCTGCCTAATGTCCCCTTGAATC F: CTTCCCACAGGCAGCACAG R: AATGATGAGAGGCAGCAAGAGG F: ACTGAAGCCAGCTCTCTCTTCCTC R: TTCCTTCTTGGGGTCAGCACAGAC F: TGATGGGTGTGACCACGAG R: TTGAAGTCGCAGGAGACAACC

CD68, cluster of differentiation 68; COX-2, cyclooxygenase 2; IL-1b, interleukin 1b; IL-6, interleukin 6; MCP-1, monocyte chemoattractant protein-1; NOS2, nitric oxide synthase 2; TNFa, tumor necrosis factor a; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

compare the relative mRNA expression levels between the control and lico F groups, the expression value of the control group was set as 1.

2.8. Western blots EWAT was washed with PBS and homogenized in 1  lysis buffer, as described by the manufacturer (Cell Signaling Technology, Beverly, MA, USA). BSA protein assay kit (Bio-Rad, Hercules, CA, USA) was used to determine protein concentrations. Post SDS gel electrophoreses of 30 mg protein, the separated proteins were transferred to polyvinylidene difluoride membranes (Bio-Rad). After blocking with blocking buffer composed of Tris-buffered saline containing 0.1% Tween 20 and 5% bovine serum albumin (Sigma, St Louis, MO, USA) for 1 h at room temperature, the membranes were incubated with the following potential antibodies: phosphorylated and total forms of Akt, p38 MAPK, Erk1/2, and JNK at 1:1000 dilutions (Cell Signaling) and GAPDH at 1:1000 dilutions overnight at 4  C. Subsequently, membranes were incubated with peroxidase-conjugated anti-rabbit antibody (Jackson ImmunoResearch, West Grove, PA, USA) at 1:2500 dilution for 1 h at room temperature. The protein bands were visualized using the enhanced chemiluminescence solution (Amersham Bioscience, Buckinghamshire, UK) as described by the manufacturer. Multi Gauge Version 3.0 software (Fuji Film, Tokyo, Japan) was used to measure band intensity.

2.9. Statistical analysis For all statistical analyses, we utilized the SPSS 12.0 statistical package software program (SPSS Inc., Chicago, IL, USA). The data of the same groups were assessed via paired Students' t-tests. All data obtained from the control and lico F groups were analyzed and compared using unpaired t-tests. A P value of