Nucleic Acids Research, Vol. 18, No. 9 2789
Library subtraction of in vitro cDNA libraries to identify differentially expressed genes in scrapie infection John R.Duguid1 2'3 and Mary C.Dinauer4'5 'Geriatric Research, Education and Clinical Center, Edith N.Rogers Memorial Veterans Hospital, Bedford, MA 01730, 2 Departments of Biochemistry and 3Neurology, Boston University School of Medicine, Boston, MA 02118, 4Division of Hematology-Oncology, Children's Hospital, Boston, MA 02115 and 5Dana-Farber Cancer Institute, Boston, MA 02115, USA Received September 25, 1989; Revised and Accepted December 4, 1989
ABSTRACT We have developed a system where double-stranded cDNA can be amplified using a synthetic oligonucleotide primer and the polymerase chain reaction, generating cDNA libraries in vitro. Using a library subtraction strategy (1), scrapie and control brain in vitro cDNA libraries were used to identify sequences whose expression is modulated in scrapie infection. One of these sequences represents ,B-2 microglobulin, while the other two have not been previously described. The use of in vitro libraries offers increased speed and efficiency of construction, and their subtraction is more efficient and powerful, compared with the previous system (1). INTRODUCTION Scrapie is a transmissible neurodegenerative disease of sheep and goats, and has become the experimental prototype of the spongiform encephalopathies, manifest in humans as kuru and Creutzfeld-Jakob disease (2,3,4). While the nature of the scrapie agent is controversial (2,3,4), one possibility is that the agent lacks a nucleic acid genome, as suggested by Prusiner in the prion hypothesis (5). Identifying the changes in brain gene expression that occur in scrapie might contribute to the understanding of the pathogenesis of this condition. A library subtraction strategy has recently been used to isolate several genes whose transcription products are increased in scrapie infected hamster brain (1,6). This strategy was based on the generation of single-stranded cDNA libraries from scrapie and control brains, and the subtractive hybridization of these cDNA libraries to generate a subtracted library enriched for scrapie-specific sequences. In this study we ligated a duplex oligonucleotide, referred to as an oligovector, to double-stranded cDNA and used the polymerase chain reaction to amplify the sequences, generating cDNA libraries in vitro. These libraries are well suited to the library subtraction strategy described previously (1), and were used to identify three additional genes whose expression is significantly increased in scrapie infected brain. These may reflect the gene expression of a cell type with increased prevalence in the scrapie infected brain (e.g. fibrous
EMBL accession nos. X17002, M29894, M29895
astrocytes) or a change in gene expression in cells present in the normal brain caused by the disease process.
MATERIALS AND METHODS Library construction-The hamster brain tissue, RNA preparation and cDNA synthesis have been previously described (1). Two oligonucleotides, dCTCTTGCTTGAATTCGGACTA and dTAGTCCGAATTCAAGCAAGAGCACA were synthesized using an Applied Biosystems apparatus. After phosphorylation using T4 polynucleotide kinase (New England Biolabs, Beverly, MA), the two oligonucleotides (1 mg/ml) were hybridized in the kinase buffer at 450 for 10 min (7). This yielded the duplex oligovector, which was blunt on one end, had a four nucleotide 3' overhang on the other end, and had an EcoRI restriction site 7 nucleotides from the blunt end. The ds-cDNA from 1.5 /Ag mRNA was phenol extracted and precipitated with ethanol, then mixed with 5 Ag of the oligovector and incubated with 5 units of T4 ligase (New England Biolabs) as described (7) in a 100 ul reaction for 8 hrs at 200. The reaction product was fractionated to remove excess oligovector by centrifugation through a 5-20% potassium acetate gradient containing 1 itg/ml ethidium bromide (7) for 4 hrs at 60,000 rpm using a Sorval TST 60.4 rotor. The cDNA was removed from the bottom of the tube using a hypodermic needle, leaving the oligovectors, visualized with UV light, behind. The cDNA was precipitated with ethanol. Onehalf of the product was amplified with Taq polymerase through 20 cycles in a 100 ,ul reaction containing 1 jig of the 21-mer
oligonucleotide specified above, using a Perkin-Elmer/Cetus (Norwalk, CT) thermal cycler as described by the manufacturer,
using the following parameters: denaturation-30 sec, 940; annealing-30 sec, 500; elongation-120 sec, 720. cDNA libraries from both control and scrapie-infected brain were constructed and amplified in this manner and represent the starting material used in the steps below.
Library subtraction-The strategy used in the preparation of subtracted libraries is presented in Figure 1. 60 ng of the normal hamster brain library DNA was amplified in 600 ,tl reaction mix as described above, yielding approximately 30 ,ug of DNA. The DNA was digested with 400 units of EcoRl (New England
2790 Nucleic Acids Research, Vol. 18, No. 9 Biolabs) for 2 hrs to cleave the oligovector and reduce the amplification potential of the normal library DNA. After phenol extraction and ethanol precipitation, the DNA was dissolved in 50 Al 5 mM HEPES, 1 mM EDTA, pH 7.5, and boiled for 5 min. The DNA was cooled and mixed with 50 itl photo-probe biotin (Vector Labs, Burlingame, CA), irradiated with a sunlamp, and processed as described (1). 15 /tg of the biotinylated normal library DNA was mixed with 2.5 ,tg of scrapie-infected brain library DNA, denatured and hybridized, after which the mixture was subjected to a stringency incubation and applied to a biocytin affinity resin (1). Alternatively, biotinylated molecules were removed with streptavidin and phenol extraction (8), with similar efficiency (95%). The resulting subtracted DNA was ethanol precipitated and hybridized with another 15 yl biotinylated normal library DNA and the cycle repeated. The subtracted DNA was amplified through 15 cycles as described above, in a 100 1.d reaction. 2.5 jig of the subtracted and amplified scrapie library DNA was subjected to two cycles of hybridization and substraction as described above, and then amplified. The process was repeated for a total of 6 hybridization/subtraction cycles, with amplification of the product after each two of these cycles. In a similar manner, the normal library was subtracted with itself, to generate a subtracted library enriched for low abundance sequences, which would serve as a source of nucleic acid to generate probe for the minus arm in plus/minus screening. Library screening-250 ng of the subtracted scrapie library DNA was amplified through 3 cycles as described, in a 100 141 reaction. This step was included to assure that the final product was fully double-stranded, with blunt ends. The product was cleaved with EcoRl (20 units in a 100 Itl reaction, for 2 hrs) and subjected to phenol extraction and ethanol precipitation. The product was ligated with 1 Atg BstXl-EcoRl adapter (the duplex was composed of dCTGGCGGG and dAATTCCCGCCAGCACA) in a 100 tl reaction, as described above. The product was purified by potassium acetate gradient centrifugation to remove excess adapters, and ethanol precipitated. One-tenth of the tailed cDNA was ligated with 100 ng BstXl-cleaved pH3M (9) in a 100 Al reaction, and used to transform competent FG-2 cells (1), yielding approximately 20,000 colonies. The colonies (2,000/10 cm plate) were transferred to GeneScreen Plus (New England Nuclear, Boston, MA) (10). Probes were generated from the subtracted libraries (100 ng heat denatured DNA in a 100 ,l reaction) using MMLV reverse transcriptase (BRL, Gaithersburg, MD) and the 21-mer component of the oligovector as a primer (1). The colony replicas were hybridized with the normal probe, to which was added probes representing the five recombinants previously isolated (1,6), washed, and autoradiographed for 24 hrs. The filters were then hybridized with the scrapie probe. The resulting autoradiographs were aligned and differentially expressed recombinants were picked and colony purified. These recombinants were characterized by DNA sequencing and their transcripts were identified by RNA blot analysis.
RESULTS We constructed scrapie-infected and normal brain cDNA libraries in vitro by bracketing each double-stranded cDNA sequence with an oligovector, a duplex oligonucleotide that is blunt on one end and is staggered on the other end. The oligovector ligates to each end of a given recombinant through its blunt end, so that both strands of a given recombinant could be amplified using a single
13 5
Figure 1. The strategy for the preparation of subtracted libraries. The steps in the strategy are numbered. The hybridization and subtraction steps were repeated in this study, prior to PCR amplification, following the sequence 1-2-3-2-4. The subtracted, amplified DNA was then subtracted again, e.g. 5-2-3-2-4. This process was repeated once more prior to ligation of the subtracted sequences into plasmid 7rH3M, for transfection and colony hybridization.
oligonucleotide primer (one of the strands of the oligovector) in the polymerase chain reaction. An in vitro subtracted library, enriched for scrapie specific sequences, was generated by repetitive hybridization and subtraction of the scrapie library using biotinylated control library DNA (see Figure 1). The oligovectors bracketing each of the recombinant sequences in the subtracted library were cleaved with EcoRl, and then ligated with a EcoRl-BstXl adapter (see Methods). The in vitro subtracted library sequences were then ligated into the BstXl site of the plasmid vector irH3M (9) for colony hybridization. The probes used for plus/minus screening were generated from the scrapie and control libraries themselves, after removal of abundant sequences by subtractive hybridization. These probes were used directly for colony hybridization, whereas probes generated from inserts derived from in vivo libraries (6) were contaminated by heterodisperse vector sequences which had to be removed prior to colony hybridization to avoid false positive signals. Seven recombinants were isolated which hybridized significantly more strongly with the scrapie library probe than with the control library probe. Two recombinants were sequenced and found to represent glial fibrillary acidic protein and transferrin, genes which had been previously identified (1,6). Although these previously identified recombinants were included in the control probe for colony hybridization, the two new isolates represented regions of these genes not contained in the original isolates, which explained their detection here. Three recombinants were found to share sequence similarity
~ . ,g
Nucleic Acids Research, Vol. 18, No. 9 2791 Murine f-2 Microglobulin 251
I L S T E F T E T M P V M CCUAAAGUAGAGAUGUCAG);AUAUGUCCUUCAGCAAGGACUGGUCUUUCUAUAUCCUGGCUCACACUGAAUUCACCCCCACUGAGACUGAUACAUACGCCU
11111 111 11111111 111111111 1111111111111111111 11 111111111
111ti111ll111
1111
GACAAAGTGGAGCTGTCAGATCTGTCCTTCAACAAGGACTGGTCTTTCTATCTCTTGGCTCACAGGGAGTTTGTACCCACTGCGACTGATAAATACGCCT L L N L L R E F V A K D V Hamster Recombinant
Murine f-2 Microglobulin 351
T K H D S M A Y D * GCAGAGUUAAGCAUGACAGUAUGGCCGAGCCCAAGACCGUCUACUGGGAUCGAGACAUGUGAUCAAGCAUCAUGAUGCUCUGAAGAUUCAUUUGAACCUG
11111111
11
I 11
IlllilllIl
I1II
111111
11
1111111 11111
11111111
GCAGAGTTTCACACATAACTCTGAAGGAGCCCAAGGTGGTCACCTGGGAACGAGACATGTAATCAAGCGTCATG....-GAGATGCTTCATTTGGATCAG S H I T L K T E V * Hamster Recombinant
Figure 2. The nucleic acid sequence of the isolated recombinant. The sequence of murine 3-2 microglobulin (22) is presented (upper sequence), aligned with the recombinant (accession number X17002). The translated amino acids are listed at points of discrepancy between the two nucleic acid sequences. The coding sequence for (3-2 microglobulin extends to residue 409 and the termination codon is indicated by the asterisk.
with 1-2 microglobulin. The partial sequence of one of these recombinants, 478 base pairs in length, is shown in Figure 2, aligned with the sequence for murine 1-2 microglobulin. These sequences share a 77% identity in the coding region; the translated amino acid sequences share a 67 % identity, with one-third of the discrepancies representing conservative substitutions. RNA blot analysis identified transcripts with three different lengths, all of which were considerably more abundant in the scrapie samples than in the controls (see Figure 3, panel A). Two additional differentially expressed recombinants were isolated and sequenced (accession numbers M29894 and M29895). These sequences did not contain an open reading frame and were not identified in either the GenBank (Release 60.0) or EMBL (Release 19.0) databases. RNA blot analysis showed that the transcripts of both of these sequences were significantly modulated in scrapie infected brain, though they are detectable in the control RNAs, indicating that they represent host genes (see Figure 3, panels B and C). The intensity of the signals indicated that the 1-2 microglobulin mRNAs and the 1.5 kb transcript identified in the panel B had abundances similar to the previously identified genes (1,6). The transcript identified in panel C had a significantly lower abundance. The identity of these last two recombinants is under further study.
1 2 34 567
ow
} .
.
DISCUSSION The polymerase chain reaction has brought considerable power to the isolation of specific nucleic acid sequences (11,12,13). Belyavsky et al. have extended the scope of this strategy by using it to generate cDNA libraries from very small amounts of material (14). Kinzler and Vogelstein have used a similar strategy to purify specific genomic DNA sequences recognized by DNA binding proteins (15). We have applied the polymerase chain reaction strategy to subtractive cloning, and have found that it is particularly well suited for use in a library subtraction strategy. This results from the ease with which in vitro libraries can be constructed, manipulated and amplified. Furthermore, a broader representation of sequences can be expected because the inefficient step of bacterial transformation is avoided. The sequences of interest are enriched by exhaustive subtraction of the in vitro libraries. Subsequent amplification of the enriched sequences prior to transformation permits the representation of even very rare sequences in the final in vivo library. A further advantage of the oligovector based system is the ease
Figure 3. Identification of the transcripts of the isolated cDNA recombinants. RNA blot analysis using the recombinant inserts as probe were performed using 5 ,ug total brain RNA from four scrapie infected animals (lanes 1-4) and 3 agematched controls (lanes 5-7). The (3-2 microglobulin probe (panel A) identified transcripts of 1.5 kb, 0.85 kb and 0.6 kb. The lengths of the major transcripts identified by the other two recombinants were 1.5 kb for accession number M29895 (panel B) and 2.6 kb for accession number M29894 (panel C). Molecular weight standards were obtained from BRL (not shown). Several randomly chosen recombinants yielded signals of equal intensity in the scrapie and control RNA preparations, as a control for RNA loading and integrity (not shown).
2792 Nucleic Acids Research, Vol. 18, No. 9 with which probe can be generated from a library. The oligonucleotide used for polymerase chain reaction amplification was used to prime the synthesis of high specific activity probe from the in vitro library using reverse transcriptase. In this study we generated probes from scrapie and control libraries that had been subtracted and enriched for low abundance sequences; these probes had a reduced sequence complexity and would be more sensitive in the detection of low abundance recombinants. Indeed, one of the modulated sequences we identified appears to be considerably less abundant than those previously identified using a less powerful detection system (1). There are limitations to this strategy. Not all sequences will be amplified with an equal efficiency and some sequences will be underrepresented in the in vitro library (16), although this is also a problem with both phage and plasmid based libraries. Our experience is similar to that of others (14) who find that short sequences are preferentially represented in the amplified product. Further, the fidelity of replication using the polymerase chain reaction has been shown to be less than the fidelity of replication in vivo (13). However, these potential problems can be circumvented; a recombinant isolated using in vitro libraries can be used to identify its full-length cognate from a conventional library. The utility of the system was demonstrated by the identification of three genes whose transcripts were significantly increased in scrapie infected brain, but which were not detected in previous studies (1,6). One of the sequences we identified, 3-2 microglobulin, is associated with the major histocompatibility complex Class I antigen, and its concentration is increased in the cerebrospinal fluid in many malignant and infectious processes (17,18,19). In particular, ,B-2 microglobulin expression is increased in conventional viral encephalitides, accompanying the inflammatory response in these conditions (20,2 1). It is of interest that scrapie infection causes increased ,B-2 microglobulin expression. Although a pathological hallmark of this condition is the absence of signs of inflammation or immune response (2), the finding of increased (3-2 microglobulin expression suggests that there is an active response to scrapie infection that is not apparent histopathologically.
ACKNOWLEDGEMENTS We would like to thank Brian Seed and Stuart Orkin for helpful comments, and Maryanne Lemaire for technical assistance. This work was supported by grants from the Veterans Administration and the Whitaker Health Sciences Fund.
REFERENCES 1. Duguid,J.R., Rohwer,R.G. and Seed,B. (1988) Proc. Natl. Acad. Sci. USA 85, 5738-5742. 2. Gajdusek,D.C. (1977) Science 197, 943-960. 3. Carp,R.I., Merz,P.A., Kascsak,R.J., Merz,G.S. and Wisniewski,H.M. (1985) J. Gen. Virol. 66, 1357-1368. 4. Prusiner,S.B. (1987) Annu. Rev. Med. 38, 381-398. 5. Prusiner,S.B. (1982) Science 216, 136-144. 6. Duguid,J.R., Bohmont,C., Liu,N. and Tourtellotte, W.W. (1989) Proc. Natl. Acad. Sci. USA 86, 7260-7264. 7. Maniatis,T., Fritsch,E.F. and Sambrook,J. (1982) Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory, Cold Spring Harbor,
NY). 8. Sive,H.L. and St. John,T. (1988) Nucl. Acids Res. 16, 10937. 9. Aruffo,A. and Seed,B. (1987) Proc. Natl. Acad. Sci. USA 84, 5937-5941. 10. Grunstein,M. and Hogness,D. (1975) Proc. Natl. Acad. Sci. USA 72, 3961 -3965.
11. 12. 13. 14.
15. 16. 17.
18. 19. 20. 21. 22.
Saiki,R.K., Scharf,S., Faloona,F. et al. (1985) Science 230, 1350-1354. Scharf,S., Horn,G.T. and Erlich,H.A. (1986) Science 233, 1076-1078. Saiki,R.K., Gelfand,D.H., Stoffel,S. et al. (1988) Science 239, 487-491. Belyavsky,A., Vinogradova,T. and Rajewsky,K. (1989) Nucl. Acids Res. 17, 2919-2932. Kinzler,K.W. and Vogelstein,B. (1989) Nucl. Acids Res. 17, 3645 -3654. McConlogue,L., Brown,M.A.D. and Innis,M.A. (1988) Nucl. Acids Res. 16, 9869. Mavligit,G.M., Stuckey,S.E., Cabanillas, F.F. et al. (1980) New Engl. J. Med. 303, 718-722. Koch,T.R., Lichtenfeld,K.M. and Wiemik,P.H. (1983) Cancer 52, 101-104. Starmans,J.J.P., Vos,J. and van der Helm,H.J. (1977) J. Neurol. Sci. 33 45-49. Sobel,R.A., Collins,A.B., Colvin,R.B. and Bhan,A.K. (1986) Am. J. Pathol. 125, 332-338. Brew,B.J., Bhalla,R.B., Fleisher,M. etal. (1989) Neurology 39, 830-834. Daniel,F., Morello,D., Le Bail,O., Chambon,P., Cayre,Y. and Kourilsky,P. (1983) EMBO J. 2, 1061-1065.
Library subtraction of in vitro cDNA libraries to identify differentially expressed genes in scrapie infection John R.Duguid1 2'3 and Mary C.Dinauer4'5 'Geriatric Research, Education and Clinical Center, Edith N.Rogers Memorial Veterans Hospital, Bedford, MA 01730, 2 Departments of Biochemistry and 3Neurology, Boston University School of Medicine, Boston, MA 02118, 4Division of Hematology-Oncology, Children's Hospital, Boston, MA 02115 and 5Dana-Farber Cancer Institute, Boston, MA 02115, USA Received September 25, 1989; Revised and Accepted December 4, 1989
ABSTRACT We have developed a system where double-stranded cDNA can be amplified using a synthetic oligonucleotide primer and the polymerase chain reaction, generating cDNA libraries in vitro. Using a library subtraction strategy (1), scrapie and control brain in vitro cDNA libraries were used to identify sequences whose expression is modulated in scrapie infection. One of these sequences represents ,B-2 microglobulin, while the other two have not been previously described. The use of in vitro libraries offers increased speed and efficiency of construction, and their subtraction is more efficient and powerful, compared with the previous system (1). INTRODUCTION Scrapie is a transmissible neurodegenerative disease of sheep and goats, and has become the experimental prototype of the spongiform encephalopathies, manifest in humans as kuru and Creutzfeld-Jakob disease (2,3,4). While the nature of the scrapie agent is controversial (2,3,4), one possibility is that the agent lacks a nucleic acid genome, as suggested by Prusiner in the prion hypothesis (5). Identifying the changes in brain gene expression that occur in scrapie might contribute to the understanding of the pathogenesis of this condition. A library subtraction strategy has recently been used to isolate several genes whose transcription products are increased in scrapie infected hamster brain (1,6). This strategy was based on the generation of single-stranded cDNA libraries from scrapie and control brains, and the subtractive hybridization of these cDNA libraries to generate a subtracted library enriched for scrapie-specific sequences. In this study we ligated a duplex oligonucleotide, referred to as an oligovector, to double-stranded cDNA and used the polymerase chain reaction to amplify the sequences, generating cDNA libraries in vitro. These libraries are well suited to the library subtraction strategy described previously (1), and were used to identify three additional genes whose expression is significantly increased in scrapie infected brain. These may reflect the gene expression of a cell type with increased prevalence in the scrapie infected brain (e.g. fibrous
EMBL accession nos. X17002, M29894, M29895
astrocytes) or a change in gene expression in cells present in the normal brain caused by the disease process.
MATERIALS AND METHODS Library construction-The hamster brain tissue, RNA preparation and cDNA synthesis have been previously described (1). Two oligonucleotides, dCTCTTGCTTGAATTCGGACTA and dTAGTCCGAATTCAAGCAAGAGCACA were synthesized using an Applied Biosystems apparatus. After phosphorylation using T4 polynucleotide kinase (New England Biolabs, Beverly, MA), the two oligonucleotides (1 mg/ml) were hybridized in the kinase buffer at 450 for 10 min (7). This yielded the duplex oligovector, which was blunt on one end, had a four nucleotide 3' overhang on the other end, and had an EcoRI restriction site 7 nucleotides from the blunt end. The ds-cDNA from 1.5 /Ag mRNA was phenol extracted and precipitated with ethanol, then mixed with 5 Ag of the oligovector and incubated with 5 units of T4 ligase (New England Biolabs) as described (7) in a 100 ul reaction for 8 hrs at 200. The reaction product was fractionated to remove excess oligovector by centrifugation through a 5-20% potassium acetate gradient containing 1 itg/ml ethidium bromide (7) for 4 hrs at 60,000 rpm using a Sorval TST 60.4 rotor. The cDNA was removed from the bottom of the tube using a hypodermic needle, leaving the oligovectors, visualized with UV light, behind. The cDNA was precipitated with ethanol. Onehalf of the product was amplified with Taq polymerase through 20 cycles in a 100 ,ul reaction containing 1 jig of the 21-mer
oligonucleotide specified above, using a Perkin-Elmer/Cetus (Norwalk, CT) thermal cycler as described by the manufacturer,
using the following parameters: denaturation-30 sec, 940; annealing-30 sec, 500; elongation-120 sec, 720. cDNA libraries from both control and scrapie-infected brain were constructed and amplified in this manner and represent the starting material used in the steps below.
Library subtraction-The strategy used in the preparation of subtracted libraries is presented in Figure 1. 60 ng of the normal hamster brain library DNA was amplified in 600 ,tl reaction mix as described above, yielding approximately 30 ,ug of DNA. The DNA was digested with 400 units of EcoRl (New England
2790 Nucleic Acids Research, Vol. 18, No. 9 Biolabs) for 2 hrs to cleave the oligovector and reduce the amplification potential of the normal library DNA. After phenol extraction and ethanol precipitation, the DNA was dissolved in 50 Al 5 mM HEPES, 1 mM EDTA, pH 7.5, and boiled for 5 min. The DNA was cooled and mixed with 50 itl photo-probe biotin (Vector Labs, Burlingame, CA), irradiated with a sunlamp, and processed as described (1). 15 /tg of the biotinylated normal library DNA was mixed with 2.5 ,tg of scrapie-infected brain library DNA, denatured and hybridized, after which the mixture was subjected to a stringency incubation and applied to a biocytin affinity resin (1). Alternatively, biotinylated molecules were removed with streptavidin and phenol extraction (8), with similar efficiency (95%). The resulting subtracted DNA was ethanol precipitated and hybridized with another 15 yl biotinylated normal library DNA and the cycle repeated. The subtracted DNA was amplified through 15 cycles as described above, in a 100 1.d reaction. 2.5 jig of the subtracted and amplified scrapie library DNA was subjected to two cycles of hybridization and substraction as described above, and then amplified. The process was repeated for a total of 6 hybridization/subtraction cycles, with amplification of the product after each two of these cycles. In a similar manner, the normal library was subtracted with itself, to generate a subtracted library enriched for low abundance sequences, which would serve as a source of nucleic acid to generate probe for the minus arm in plus/minus screening. Library screening-250 ng of the subtracted scrapie library DNA was amplified through 3 cycles as described, in a 100 141 reaction. This step was included to assure that the final product was fully double-stranded, with blunt ends. The product was cleaved with EcoRl (20 units in a 100 Itl reaction, for 2 hrs) and subjected to phenol extraction and ethanol precipitation. The product was ligated with 1 Atg BstXl-EcoRl adapter (the duplex was composed of dCTGGCGGG and dAATTCCCGCCAGCACA) in a 100 tl reaction, as described above. The product was purified by potassium acetate gradient centrifugation to remove excess adapters, and ethanol precipitated. One-tenth of the tailed cDNA was ligated with 100 ng BstXl-cleaved pH3M (9) in a 100 Al reaction, and used to transform competent FG-2 cells (1), yielding approximately 20,000 colonies. The colonies (2,000/10 cm plate) were transferred to GeneScreen Plus (New England Nuclear, Boston, MA) (10). Probes were generated from the subtracted libraries (100 ng heat denatured DNA in a 100 ,l reaction) using MMLV reverse transcriptase (BRL, Gaithersburg, MD) and the 21-mer component of the oligovector as a primer (1). The colony replicas were hybridized with the normal probe, to which was added probes representing the five recombinants previously isolated (1,6), washed, and autoradiographed for 24 hrs. The filters were then hybridized with the scrapie probe. The resulting autoradiographs were aligned and differentially expressed recombinants were picked and colony purified. These recombinants were characterized by DNA sequencing and their transcripts were identified by RNA blot analysis.
RESULTS We constructed scrapie-infected and normal brain cDNA libraries in vitro by bracketing each double-stranded cDNA sequence with an oligovector, a duplex oligonucleotide that is blunt on one end and is staggered on the other end. The oligovector ligates to each end of a given recombinant through its blunt end, so that both strands of a given recombinant could be amplified using a single
13 5
Figure 1. The strategy for the preparation of subtracted libraries. The steps in the strategy are numbered. The hybridization and subtraction steps were repeated in this study, prior to PCR amplification, following the sequence 1-2-3-2-4. The subtracted, amplified DNA was then subtracted again, e.g. 5-2-3-2-4. This process was repeated once more prior to ligation of the subtracted sequences into plasmid 7rH3M, for transfection and colony hybridization.
oligonucleotide primer (one of the strands of the oligovector) in the polymerase chain reaction. An in vitro subtracted library, enriched for scrapie specific sequences, was generated by repetitive hybridization and subtraction of the scrapie library using biotinylated control library DNA (see Figure 1). The oligovectors bracketing each of the recombinant sequences in the subtracted library were cleaved with EcoRl, and then ligated with a EcoRl-BstXl adapter (see Methods). The in vitro subtracted library sequences were then ligated into the BstXl site of the plasmid vector irH3M (9) for colony hybridization. The probes used for plus/minus screening were generated from the scrapie and control libraries themselves, after removal of abundant sequences by subtractive hybridization. These probes were used directly for colony hybridization, whereas probes generated from inserts derived from in vivo libraries (6) were contaminated by heterodisperse vector sequences which had to be removed prior to colony hybridization to avoid false positive signals. Seven recombinants were isolated which hybridized significantly more strongly with the scrapie library probe than with the control library probe. Two recombinants were sequenced and found to represent glial fibrillary acidic protein and transferrin, genes which had been previously identified (1,6). Although these previously identified recombinants were included in the control probe for colony hybridization, the two new isolates represented regions of these genes not contained in the original isolates, which explained their detection here. Three recombinants were found to share sequence similarity
~ . ,g
Nucleic Acids Research, Vol. 18, No. 9 2791 Murine f-2 Microglobulin 251
I L S T E F T E T M P V M CCUAAAGUAGAGAUGUCAG);AUAUGUCCUUCAGCAAGGACUGGUCUUUCUAUAUCCUGGCUCACACUGAAUUCACCCCCACUGAGACUGAUACAUACGCCU
11111 111 11111111 111111111 1111111111111111111 11 111111111
111ti111ll111
1111
GACAAAGTGGAGCTGTCAGATCTGTCCTTCAACAAGGACTGGTCTTTCTATCTCTTGGCTCACAGGGAGTTTGTACCCACTGCGACTGATAAATACGCCT L L N L L R E F V A K D V Hamster Recombinant
Murine f-2 Microglobulin 351
T K H D S M A Y D * GCAGAGUUAAGCAUGACAGUAUGGCCGAGCCCAAGACCGUCUACUGGGAUCGAGACAUGUGAUCAAGCAUCAUGAUGCUCUGAAGAUUCAUUUGAACCUG
11111111
11
I 11
IlllilllIl
I1II
111111
11
1111111 11111
11111111
GCAGAGTTTCACACATAACTCTGAAGGAGCCCAAGGTGGTCACCTGGGAACGAGACATGTAATCAAGCGTCATG....-GAGATGCTTCATTTGGATCAG S H I T L K T E V * Hamster Recombinant
Figure 2. The nucleic acid sequence of the isolated recombinant. The sequence of murine 3-2 microglobulin (22) is presented (upper sequence), aligned with the recombinant (accession number X17002). The translated amino acids are listed at points of discrepancy between the two nucleic acid sequences. The coding sequence for (3-2 microglobulin extends to residue 409 and the termination codon is indicated by the asterisk.
with 1-2 microglobulin. The partial sequence of one of these recombinants, 478 base pairs in length, is shown in Figure 2, aligned with the sequence for murine 1-2 microglobulin. These sequences share a 77% identity in the coding region; the translated amino acid sequences share a 67 % identity, with one-third of the discrepancies representing conservative substitutions. RNA blot analysis identified transcripts with three different lengths, all of which were considerably more abundant in the scrapie samples than in the controls (see Figure 3, panel A). Two additional differentially expressed recombinants were isolated and sequenced (accession numbers M29894 and M29895). These sequences did not contain an open reading frame and were not identified in either the GenBank (Release 60.0) or EMBL (Release 19.0) databases. RNA blot analysis showed that the transcripts of both of these sequences were significantly modulated in scrapie infected brain, though they are detectable in the control RNAs, indicating that they represent host genes (see Figure 3, panels B and C). The intensity of the signals indicated that the 1-2 microglobulin mRNAs and the 1.5 kb transcript identified in the panel B had abundances similar to the previously identified genes (1,6). The transcript identified in panel C had a significantly lower abundance. The identity of these last two recombinants is under further study.
1 2 34 567
ow
} .
.
DISCUSSION The polymerase chain reaction has brought considerable power to the isolation of specific nucleic acid sequences (11,12,13). Belyavsky et al. have extended the scope of this strategy by using it to generate cDNA libraries from very small amounts of material (14). Kinzler and Vogelstein have used a similar strategy to purify specific genomic DNA sequences recognized by DNA binding proteins (15). We have applied the polymerase chain reaction strategy to subtractive cloning, and have found that it is particularly well suited for use in a library subtraction strategy. This results from the ease with which in vitro libraries can be constructed, manipulated and amplified. Furthermore, a broader representation of sequences can be expected because the inefficient step of bacterial transformation is avoided. The sequences of interest are enriched by exhaustive subtraction of the in vitro libraries. Subsequent amplification of the enriched sequences prior to transformation permits the representation of even very rare sequences in the final in vivo library. A further advantage of the oligovector based system is the ease
Figure 3. Identification of the transcripts of the isolated cDNA recombinants. RNA blot analysis using the recombinant inserts as probe were performed using 5 ,ug total brain RNA from four scrapie infected animals (lanes 1-4) and 3 agematched controls (lanes 5-7). The (3-2 microglobulin probe (panel A) identified transcripts of 1.5 kb, 0.85 kb and 0.6 kb. The lengths of the major transcripts identified by the other two recombinants were 1.5 kb for accession number M29895 (panel B) and 2.6 kb for accession number M29894 (panel C). Molecular weight standards were obtained from BRL (not shown). Several randomly chosen recombinants yielded signals of equal intensity in the scrapie and control RNA preparations, as a control for RNA loading and integrity (not shown).
2792 Nucleic Acids Research, Vol. 18, No. 9 with which probe can be generated from a library. The oligonucleotide used for polymerase chain reaction amplification was used to prime the synthesis of high specific activity probe from the in vitro library using reverse transcriptase. In this study we generated probes from scrapie and control libraries that had been subtracted and enriched for low abundance sequences; these probes had a reduced sequence complexity and would be more sensitive in the detection of low abundance recombinants. Indeed, one of the modulated sequences we identified appears to be considerably less abundant than those previously identified using a less powerful detection system (1). There are limitations to this strategy. Not all sequences will be amplified with an equal efficiency and some sequences will be underrepresented in the in vitro library (16), although this is also a problem with both phage and plasmid based libraries. Our experience is similar to that of others (14) who find that short sequences are preferentially represented in the amplified product. Further, the fidelity of replication using the polymerase chain reaction has been shown to be less than the fidelity of replication in vivo (13). However, these potential problems can be circumvented; a recombinant isolated using in vitro libraries can be used to identify its full-length cognate from a conventional library. The utility of the system was demonstrated by the identification of three genes whose transcripts were significantly increased in scrapie infected brain, but which were not detected in previous studies (1,6). One of the sequences we identified, 3-2 microglobulin, is associated with the major histocompatibility complex Class I antigen, and its concentration is increased in the cerebrospinal fluid in many malignant and infectious processes (17,18,19). In particular, ,B-2 microglobulin expression is increased in conventional viral encephalitides, accompanying the inflammatory response in these conditions (20,2 1). It is of interest that scrapie infection causes increased ,B-2 microglobulin expression. Although a pathological hallmark of this condition is the absence of signs of inflammation or immune response (2), the finding of increased (3-2 microglobulin expression suggests that there is an active response to scrapie infection that is not apparent histopathologically.
ACKNOWLEDGEMENTS We would like to thank Brian Seed and Stuart Orkin for helpful comments, and Maryanne Lemaire for technical assistance. This work was supported by grants from the Veterans Administration and the Whitaker Health Sciences Fund.
REFERENCES 1. Duguid,J.R., Rohwer,R.G. and Seed,B. (1988) Proc. Natl. Acad. Sci. USA 85, 5738-5742. 2. Gajdusek,D.C. (1977) Science 197, 943-960. 3. Carp,R.I., Merz,P.A., Kascsak,R.J., Merz,G.S. and Wisniewski,H.M. (1985) J. Gen. Virol. 66, 1357-1368. 4. Prusiner,S.B. (1987) Annu. Rev. Med. 38, 381-398. 5. Prusiner,S.B. (1982) Science 216, 136-144. 6. Duguid,J.R., Bohmont,C., Liu,N. and Tourtellotte, W.W. (1989) Proc. Natl. Acad. Sci. USA 86, 7260-7264. 7. Maniatis,T., Fritsch,E.F. and Sambrook,J. (1982) Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory, Cold Spring Harbor,
NY). 8. Sive,H.L. and St. John,T. (1988) Nucl. Acids Res. 16, 10937. 9. Aruffo,A. and Seed,B. (1987) Proc. Natl. Acad. Sci. USA 84, 5937-5941. 10. Grunstein,M. and Hogness,D. (1975) Proc. Natl. Acad. Sci. USA 72, 3961 -3965.
11. 12. 13. 14.
15. 16. 17.
18. 19. 20. 21. 22.
Saiki,R.K., Scharf,S., Faloona,F. et al. (1985) Science 230, 1350-1354. Scharf,S., Horn,G.T. and Erlich,H.A. (1986) Science 233, 1076-1078. Saiki,R.K., Gelfand,D.H., Stoffel,S. et al. (1988) Science 239, 487-491. Belyavsky,A., Vinogradova,T. and Rajewsky,K. (1989) Nucl. Acids Res. 17, 2919-2932. Kinzler,K.W. and Vogelstein,B. (1989) Nucl. Acids Res. 17, 3645 -3654. McConlogue,L., Brown,M.A.D. and Innis,M.A. (1988) Nucl. Acids Res. 16, 9869. Mavligit,G.M., Stuckey,S.E., Cabanillas, F.F. et al. (1980) New Engl. J. Med. 303, 718-722. Koch,T.R., Lichtenfeld,K.M. and Wiemik,P.H. (1983) Cancer 52, 101-104. Starmans,J.J.P., Vos,J. and van der Helm,H.J. (1977) J. Neurol. Sci. 33 45-49. Sobel,R.A., Collins,A.B., Colvin,R.B. and Bhan,A.K. (1986) Am. J. Pathol. 125, 332-338. Brew,B.J., Bhalla,R.B., Fleisher,M. etal. (1989) Neurology 39, 830-834. Daniel,F., Morello,D., Le Bail,O., Chambon,P., Cayre,Y. and Kourilsky,P. (1983) EMBO J. 2, 1061-1065.
