318 Endocrine Research
LH, Progesterone, and TSH can Stimulate Aldosterone In Vitro: A Study on Normal Adrenal Cortex and Aldosterone Producing Adenoma
Affiliations
Key words ▶ LH receptor ● ▶ TSH receptor ● ▶ progesterone ● ▶ aldosterone ●
received 08.04.2013 accepted 24.10.2013 Bibliography DOI http://dx.doi.org/ 10.1055/s-0033-1358733 Published online: December 2, 2013 Horm Metab Res 2014; 46: 318–321 © Georg Thieme Verlag KG Stuttgart · New York ISSN 0018-5043 Correspondence E. Fommei Clinical and Experimental Medicine Department Pisa Fondazione Toscana G. Monasterio and University of Pisa via Moruzzi n. 1 56124 Pisa Italy Tel.: + 39/050/3152 216 Fax: + 39/050/3152 166 [email protected]
G. Nicolini1, S. Balzan1, L. Morelli2, P. Iacconi2, L. Sabatino1, A. Ripoli1, E. Fommei3 1
Department of Cardiovascular Endocrinology, CNR Institute of Clinical Physiology, Pisa, Italy Department of General and Transplantation Surgery, University of Pisa, Pisa, Italy 3 Department of Clinical and Experimental Medicine, University of Pisa and Fondazione Toscana G. Monasterio, Pisa, Italy 2
Abstract
▼
Endocrine factors different from ACTH or angiotensin II can stimulate aldosterone secretion and have a role in the pathophysiology of hyperaldosteronism. Aldosterone may increase in luteotropic/progestogenic and in hypothyroid states; LH and, occasionally, TSH receptors have been detected in normal adrenal cortex and aldosterone-producing adenoma. The aim of the study was to compare adrenal contents of LH and TSH receptors between normal cortex and aldosterone-producing adenoma and to evaluate the ability of LH, its product progesterone, and TSH to stimulate aldosterone secretion in vitro from primary adrenocortical cells. Surgical aldosteroneproducing adenoma fragments from 19 patients and adrenal cortex fragments from 10 kidney donors were used for Western blotting and cell cultures. LH (n = 26), TSH (n = 19) and progester-
Introduction
▼
Adrenal cortex may be a target of hormonal stimulation other than adrenocorticotropic hormone (ACTH) or angiotensin II. Different receptors have been identified, particularly of gonadotropins, which may influence the adrenal production of glucocorticoids in the prevailing zona fasciculata, but may be present also in the less represented aldosterone producing zona glomerulosa [1]. Aldosterone may increase in states of elevation of progesterone, luteinizing hormone (LH), or its placental homologous chorionic gonadotropin during the luteal phase of the ovarian cycle, menopause or pregnancy [2–4]. We have previously indicated the aldosterone variability during the ovarian cycle as a possible confounding factor in the screening for primary aldosteronism in women [5] and similar findings were reported by others [6, 7]. To our knowledge no studies on this
Nicolini G et al. LH and TSH Effects on Aldosterone … Horm Metab Res 2014; 46: 318–321
one (n = 8) receptor proteins were investigated; LH receptor-mRNA was also tested in 8 samples. Aldosterone responses in vitro to LH, progesterone, and TSH stimulation were assayed. LH and TSH receptors were more expressed in adenoma than normal cortex (p < 0.01, p < 0.05, respectively); progesterone receptor was observed in 6/8 samples. Aldosterone increased after in vitro stimulation with LH (5/12 adenoma, 1/7 normal cells), progesterone (4/5 adenoma, 5/6 normal cells), and TSH (3/5 adenoma and 3/5 normal cells). LH and TSH receptors were more expressed in aldosterone producing adenoma than normal adrenal cortex. LH, progesterone, and TSH can stimulate aldosterone in vitro. Similar mechanisms could participate in vivo in the aldosterone increase in lutheotropic, progestogenic, or hypothyroid states and may exist in both normal adrenal cortex and adenoma in responsive individuals.
subject have been made in men, whose gonadal hormones are equally under LH control. Receptors for LH (LH-R) and chorionic gonadotropin have been recently observed in human aldosterone producing adenomas (APAs) but no definite statistical difference with normal adrenals (NA) was reported [8–10]. Past observations suggested also a relationship of aldosterone with thyroid stimulating hormone (TSH). TSH receptors (TSH-R) have been detected in the adrenal cortex and an increase in plasma aldosterone was reported after thyrotropic releasing hormone (TRH) stimulation in hyperaldosteronism [9] or following TSH surge during acute hypothyroidism [11], consistently with a possible link between thyroid function and aldosterone production. The above observations prompted us to investigate the presence of LH-R and TSH-R in the adrenal cortex in a comparison between APA and NA
This document was downloaded for personal use only. Unauthorized distribution is strictly prohibited.
Authors
Endocrine Research
Patients and Methods
▼
Adrenal tissues After informed consent, fragments of APA were collected from 19 euthyroid hypertensive patients (9 F/10 M, age 62 ± 12 years; mean ± SD) who underwent laparoscopic adrenalectomy after a clinical diagnosis of primary aldosteronism confirmed by captopril test and lateralization of aldosterone secretion at adrenal vein sampling (except 2 patients who refused the examination) [12]. Blood pressure control significantly improved after intervention up to 6 months in 16 patients and 3 months follow-up in the last 3 patients, respectively. NA tissues were collected from 10 kidney donors (5 F/5 M, age 54 ± 13 years) after approval by the Institutional Administration Board of Surgical and Transplantation Department of the University of Pisa. Two separate samples were collected for Western blotting analysis and adrenocortical cells cultures, respectively.
Western blotting analysis Frozen adrenal capsular cortex fragments (50–100 mg) were homogenized in Ripa lysis buffer (sc-24948, Santa Cruz, USA). Proteins (50 μg) were separated by 8 % sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE) and transferred to 0.2 mm nitrocellulose membrane (Bio-Rad, Hercules, CA, USA). After blocking nonspecific binding sites with 5 % nonfat milk (Roche) in Tween-20/PBS 0.1 % vol/vol, blots were incubated overnight at 4 °C with specific antibody anti-LH-R (rabbit polyclonal sc-25828, Santa Cruz, USA, 1:500 dilution) (16 APA, 10 NA). TSH-R was explored in 12 APA and 7 NA samples (mouse monoclonal ab2812, ABCAM, UK, 1:500 dilution) and progesterone receptor isoform B (PR-B C-20, rabbit polyclonal sc-539, Santa Cruz, USA, 1:500 dilution) in a subgroup of 4 APA and 4 NA samples. Membranes were incubated with horseradish peroxidase-conjugated secondary antibody (anti-rabbit IgG, sc-2357, Santa Cruz, USA, 1:3 000 dilution; anti-mouse IgG, ab6728 ABCAM, USA, 1:3 000 dilution). LH-R, TSH-R and PR were detected by chemiluminescence reagent (Roche kit, USA) and the optical density (OD) of each specific band analyzed with the Scion image software (Scion Corporation USA). Results are expressed as LH-R or TSH-R OD normalized to the reference protein beta-actin OD.
(Bio-Rad). Each reaction was carried out in a total volume of 10 μl and included 4 μl of template cDNA (1:5 diluted), 0.5 μM of each primer, and 2X iTaq Universal Sybr Green Supermix (BioRad). Amplification protocol started with 95 °C for 30 s followed by 39 cycles at 95 °C for 5 s and 60 °C for 15 s. To assess product specificity, amplicons were checked by melting curve analysis generated from 65 to 95 °C with increments of 0.5 °C/cycle. The mRNA expression of the 3 candidate reference genes was measured in duplicate in all samples and the average Ct value converted to a relative quantity and analyzed with CFX384 Manager algorithm as previously described [13].
Isolation and treatments of adrenocortical cells Fifteen cell cultures from APA and 7 from NA were obtained. Cell isolation was performed according to the method of Chu et al. [14]. After removal of surrounding fat, fragments of adrenal capsular tissue were separated by dissection and incubated in a digestion mixture (1 mg/ml collagenase in Leibovitz medium L-15) at 37 °C for 45 min. After filtering and centrifugation (900 rpm for 5 min), cells were seeded on 6-well plates (Corning, NY) in DMEM/F12 medium supplemented with 2 % fetal bovin serum (FBS), 100 U/ml penicillin, 100 μg/ml streptomycin, 250 ng/ml amphotericin, 1 % L-glutamine and maintained at 37 °C in humidified atmosphere of 95 % air/5 % CO2.
Hormonal stimulations Equal volumes of cell suspensions were kept both in the absence and presence of LH 0.3 μg/ml (10 nM, 33 mUI/ml) (12 APA and 7 NA), progesterone 31 ng/ml (100 nM) (5 APA and 6 NA), or TSH 1 mU/ml (5 APA and 5 NA) in serum free-DMEM/F12 medium for 6 h. The supernatant was then collected and stored at − 20 °C until used for aldosterone assays (ALDOCTK-2RIA kit, DIASORINs.r.l., Saluggia, Italy). In Aldo RIA the lower limit of sensitivity was 0.20 pg/ml; the ratio of cross link to other steroids was: cortisone 2.5 × 10 − 3 %, testosterone 8.0 × 10 − 4 %, cortisol 1.0 × 10 − 4 %, progesterone 8.0 × 10 − 5 %, pregnenolone 5 × 10 − 5 %, estradiol 1.0 × 10 − 5 %. No cross link to LH and TSH was observed at our experimental conditions.
Statistical analysis Groups comparison was made by Mann-Whitney test or independent samples t-test after log-transformation and Levene’s test for equality of variances in case of small samples; p < 0.05 was considered as statistically significant.
Results
▼
Real Time-PCR quantification of LHR One μg of total RNA obtained from 8 samples (4 NA and 4 APA) was reverse-transcribed with iScript cDNA Synthesis Kit (BioRad, Milan, Italy) according to the manufacturer’s instructions. Three candidate reference genes (HPRT, EEFIA, and TPT1) were selected from the most commonly cited in the literature to normalize mRNA expression data obtained by Real Time PCR (RTPCR). PCR primer sequences were as follows: HPRT F: 5′ TGCTGACCTGCTGGATTACAT 3′, R: 5′ TTGCGACCTTGACCATCTTT 3′; EEFIA1 F: 5′ CTTTGGGTCGCTTTGCTGTT 3′, R: 5′ CCGTTCTTCCACCACTGATT 3′; TPT1: F: 5′ AAATGTTAACAAATGTGGCAATTAT 3′, R: 5′ AACAATGCCTCCACTCCAAA 3′; LHR: F: 5′ GCCATCAAGAGAAACATTTGTCAA 3′, R: 5′ TTTCTAAAAGCACAGCAGTGGCT 3′. RT-PCR reactions were performed in a CFX384 RT-PCR System
Presence of LH-R and TSH-R in the adrenal cortex LH-R and TSH-R proteins were found in all samples of adrenal ▶ Fig. 1). Receptor expression was significantly higher in cortex (● APA than NA both for LH-R (16 APA, 10 NA; 1.7 ± 0.6 vs. 0.7 ± 0.3 beta-actin levels, respectively, mean ± SD, p < 0.001) and TSH-R (12 APA, 7 NA; 1.03 ± 0.4 vs. 0.53 ± 0.13 beta-actin levels, p < 0.05). ▶ Fig. 1c, PR-B receptor was detected in 4/4 NA and As shown in ● 2/4 APA. The higher level of LH-R protein as observed in APA compared to NA was confirmed by RT-PCR in a group of 4 APA against 4 NA (1.0 ± 0.4 vs. 0.04 ± 0.02 arbitrary units, mean ± SD, p < 0.01).
Nicolini G et al. LH and TSH Effects on Aldosterone … Horm Metab Res 2014; 46: 318–321
This document was downloaded for personal use only. Unauthorized distribution is strictly prohibited.
and to test the ability of LH, its main product progesterone, and TSH to stimulate aldosterone secretion by primary adrenocortical cells in vitro.
319
Fig. 2 Aldosterone response to LH, progesterone (P), and TSH stimulation in primary cultured adrenocortical cells from APA and NA. Results are expressed as fold changes of aldosterone levels over baseline. See text for stimulation details.
Discussion
▼
Fig. 1 Western blot for LH-R, TSH-R, and progesterone (isoform B) receptor (PR-B) in NA and APA cortex. a (above) LH-R and reference beta-actin expression in 3 representative NA (lanes 1–3) and 4 APA (lanes 4–7). b (above) TSH-R in 3 NA (lanes 1–3) and 4 APA (lanes 4–7). c PR-B in 4 NA (lanes 1–4) and 4 APA (lanes 5–8). Comparison of LH-R (a, below) and TSH-R (b, below) between NA and APA (***p < 0.001 for LH-R and *p < 0.05 for TSH-R).
LH, progesterone, and TSH stimulations in vitro Baseline aldosterone levels in the culture medium did not differ significantly between APA and NA (134 ± 125 vs. 169 ± 117 pg/ml, respectively) nor after normalizing for cell protein content in a subgroup of 6 APA and 6 NA (0.5 ± 0.1 vs. 1.1 ± 0.8 pg/ml/μg, respectively). ▶ Fig. 2, different aldosterone responses were As shown in ● obtained with the different stimuli. LH stimulated aldosterone secretion in 5/12 cultures from APA (from × 1.4 to × 5 over baseline) and 1/7 cultures from NA ( × 1.9). Progesterone stimulated aldosterone release in 4/5 cultures from APA (from × 1.7 to × 2.6) and in 5/6 cultures from NA (from × 1.2 to × 5.3). TSH stimulation increased aldosterone levels in 3/5 cultures from APA (from × 2.0 to × 2.5) and in 3/5 from NA (from × 3.0 to × 5.1). The level of receptor proteins and aldosterone response to hormonal stimulations appeared unrelated to each other or to age or gender of the studied subjects.
Different receptors in the adrenal cortex have been related to the adrenal responsiveness to various hormonal stimulations [1, 9, 10, 15]. Gonadotropin receptors may be present in all layers of the cortex, which is known to have a common embryonic origin with the gonads [16]. Adrenal cortex tumors may express gonadotropin and TSH receptors, both belonging to the same G-protein coupled receptor family [9, 17]. LH-R has been described in APA, though no definite comparison with normal adrenal tissues was reported [8–10]. In our study, LH-R was significantly more represented in APA (of known glomerulosa origin) than in NA cortex, a difference that would conceivably be enhanced if strict glomerulosa content had to be compared, due to the known prevailing expression of LHR in zona fasciculata [1]. This fact may be consistent with an association of LH-R with proliferative states, in keeping with the observed capability of the transferred LHR gene to induce adrenal hyperplasia or adenomas in experimental animals [18]. Within the short time length of cell culture experiments, baseline aldosterone levels did not differ between normal and APA adrenocortical cell medium. However, in stimulated conditions, LH could induce aldosterone secretion in subgroups of both NA and APA, indicating a direct activation, which could have a role in vivo in the increase of plasma aldosterone as observed in some luteotropic states. As a comparison, progesterone increased aldosterone secretion in the majority of cell cultures. This effect might be expected from an aldosterone precursor [19] even if an action through specific receptors cannot be excluded, as observed by others [20] and supported by our finding on the ▶ Fig. 1c). presence of PR-B in both normal and APA cortex (● Besides the reactive increase of aldosterone after mineralcorticoid receptor occupancy in progestogenic states, little attention has been given in our opinion to the direct effect of circulating progesterone on aldosterone secretion, though occasionally reported [4]. Thus, both LH and its main product progesterone could directly stimulate aldosterone secretion from normal glands and APA in luteotropic or progestogenic states. We found the presence of TSH-R also in both NA and APA and observed preliminarily both a higher TSH-R content in APA and a capability of TSH to stimulate aldosterone secretion in vitro. To our knowledge, no study in the literature reported similar
Nicolini G et al. LH and TSH Effects on Aldosterone … Horm Metab Res 2014; 46: 318–321
This document was downloaded for personal use only. Unauthorized distribution is strictly prohibited.
320 Endocrine Research
findings. TSH-R mRNA had been described in extrathyroid tissues including adrenals [21]. Zwermann et al. reported on the presence of TSH-R in one APA and an increase of plasma aldosterone after TRH stimulation in one subject with idiopathic primary aldosteronism [9]. Though thyroid function is well known to influence arterial blood pressure and cardiovascular function, very little attention has been given to its possible relationships with aldosterone. However, sparse observations in the literature indicated a high prevalence of thyroid nodules in primary aldosteronism as well as the presence of aldo-synthase mRNA in thyroid cysts fluid [22, 23]. In a model of acute human hypothyroidism we observed an increase in plasma aldosterone after TSH surge, which was dissociated from renin activity and positively related with TSH itself [11]. Similar findings were reported in low-T3 syndrome where T3 substitutive treatment induced a decrease in plasma aldosterone dissociated from plasma renin activity [24]. However, our present experimental data are too limited to support a definite conclusion on this pathophysiological aspect and further studies are needed to clarify the relationships between thyroid and mineralocorticoid function. Hormonal stimulations in vitro elicited variable responses in aldosterone secretion from adrenocortical cells, possibly due to individual genetic or epigenetic factors that could have a permissive role for full receptor activation and the completion of the synthetic pathway of aldosterone under different hormonal stimulations. In this regard, recent literature has added evidence on the role of different gene mutations in the activation of the aldosterone synthase pathway [25]. Several signaling pathways such as ERK/1,2/p38 or cAMP have been indicated in mediating the aldosterone release by the most important aldosterone modulators such as Ang II, K + and ACTH [26]. Since cAMP signaling is typical of G protein coupled receptors to which LH-R and TSH-R belong, we could hypothesize this mechanism for the aldosterone stimulation by LH and TSH at the adrenal level.
Conclusions
▼
LH-R, TSH-R, and PR-B proteins were observed in adenomas from patients with primary aldosteronism and in normal cortex. LH-R and TSH-R were increased in adenoma compared to normal adrenal cortex. Either LH, progesterone, or TSH was able to directly stimulate aldosterone secretion by adrenocortical cells of both types. Similar mechanisms could participate in vivo in the aldosterone increase during lutheotropic, progestogenic, or hypothyroid states and have a role in both adrenal physiology and pathophysiology in responsive individuals.
References 1 Lacroix A, Bourdeau I, Lampron A, Mazzuco TL, Tremblay J, Hamet P. Aberrant G-protein coupled receptor expression in relation to adrenocortical overfunction. Clin Endocrinol 2010; 73: 1–15 2 Chidambaram M, Duncan JA, Lai VS, Cattran DC, Floras JS, Scholey JW, Miller JA. Variation in the Renin Angiotensin System throughout the Normal Menstrual Cycle. J Am Soc Nephrol 2002; 13: 446–452 3 Sealey JE, Itskovitz-Eldor J, Rubattu S, James GD, August P, Thaler I, Levron J, Laragh JH. Estradiol- and progesterone-related increases in the renin-aldosterone system: studies during ovarian stimulation and early pregnancy. J Clin Endocrinol Metab 1994; 79: 258–264 4 Szmuilowicz ED, Adler GK, Williams JS, Green DE, Yso TM, Hopkins PN, Seely EW. Relationships between aldosterone and progesterone in the human menstrual cycle. J Clin Endocrinol Metab 2006; 91: 3981–3987
5 Fommei E, Ghione S, Ripoli A, Maffei S, Di Cecco P, Iervasi A, Turchi S. The ovarian cycle as a factor of variability in the laboratory screening for primary aldosteronism in women. J Human Hypertens 2009; 23: 130–135 6 Pizzolo F, Raffaelli R, Memmo A, Chiecchi L, Pavan C, Guarini P, Guidi GC, Franchi M, Corrocher R, Olivieri O. Effects of female sex hormones and contraceptive pill on the diagnostic work-up for primary aldosteronism. J Hypertens 2010; 28: 135–142 7 Ahmed AH, Gordon RD, Taylor PJ, Ward G, Pimenta E, Stowasser M. Are Women More at Risk of False-Positive Primary Aldosteronism Screening and Unnecessary Suppression Testing than Men? J Clin Endocrinol Metab 2011; 96: E340–E346 8 Saner-Amigh K, Mayhew B, Mantero F, Schiavi F, White P, Rao C, Rainey W. Elevated expression of luteinizing hormone receptor in aldosterone-producing adenomas. J Clin Endocrinol Metab 2006; 91: 1136–1142 9 Zwermann O, Suttmann Y, Bidlingmaier M, Beuschelein F, Reincke M. Screening for membrane hormone receptor expression in primary aldosteronism. Eur J Endocrinol 2009; 160: 443–451 10 Albiger NM, Sartorato P, Mariniello B, Iacobone M, Finco I, Fassina A, Mantero F. A case of primary aldosteronism in pregnancy: do LH and GNRH receptors have a potential role in regulating aldosterone secretion? Eur J Endocrinol 2011; 164: 405–412 11 Fommei E, Iervasi G. The role of thyroid hormone in blood pressure homeostasis: evidence from short-term hypothyroidism in humans. J Clin Endocrinol Metab 2002; 87: 1996–2000 12 Funder JW, Carey RM, Fardella C, Gomez-Sanchez CE, Mantero F, Stowasser M, Young WF Jr, Montori WM. Endocrine Society. Case detection, diagnosis, and treatment of patients with primary aldosteronism: an endocrine society clinical practice guideline. J Clin Endocrinol Metab 2008; 93: 3266–3281 13 Sabatino L, Cabiati M, Caselli C, Del Ry S. Adenosine receptor expression and gene reference evaluation in human leukocytes. Clin Lab 2013; 59: 571–577 14 Chu Y, Wu BM, McCabe ER, Dunn JC. Serum-Free cultures of murine adrenal cortical cells. J Pediatr Surg 2006; 41: 2008–2012 15 Lampron A, Bourdeau I, Oble S, Godbout A, Schoerch W, Arjane P, Hamet P, Lacroix A. Regulation of Aldosterone Secretion by Several Aberrant Receptors Including for Glucose-Dependent Insulinotropic Peptide in a Patient with an Aldosteronoma. J Clin Endocrinol Metab 2009; 94: 750–756 16 Keegan CE, Hammer GD. Recent insights into organogenesis of the adrenal cortex. Trends Endocrinol Metab 2002; 13: 200–208 17 Costagliola S, Urizar E, Mendive F, Vassart G. Specificity and promiscuity of gonadotropin receptors. Reproduction 2005; 130: 275–281 18 Mazzuco TL, Chabre O, Feige JJ, Thomas M. Aberrant Expression of Human Luteinizing Hormone Receptor by Adrenocortical Cells Is Sufficient to Provoke Both Hyperplasia and Cushing’s Syndrome Features. J Clin Endocrinol Metab 2006; 91: 196–203 19 Lucis OJ, Lucis R. Comparison of steroidogenesis in adrenal tissue and adrenal adenoma from a case of primary aldosteronism. J of Steroid Biochem 1971; 2: 19–31 20 De Cremoux P, Rosemberg D, Goussard J, Brémont-Weil C, Tissier F, Tran-Perennou C, Bertagna X, Bertherat J, Raffin-Sanson ML. Expression of progesterone and extradiol receptor in normal adrenal cortex, adrenocortical tumors and primary pigmented nodular adrenocortical disease. Endocr Relat Cancer 2008; 15: 465–474 21 Dutton CM, Joba W, Spitzweg C, Heufelder AE, Bahn RS. Thyrotropin receptor expression in adrenal, kidney, and thymus. Thyroid 1997; 7: 879–884 22 Armanini D, Nacamulli D, Scaroni C, Lumachi F, Selice R, Fiore C, Favia G, Mantero F. High prevalence of thyroid ultrasonographic abnormalities in primary aldosteronism. Endocrine 2003; 22: 155–160 23 Greenman Y, Trostanetsky Y, Ben-Shemen S, Grazas N, Limor R, Osher E, Lewicka S, Vecsei P, Stern N. Thyroid cysts: a new extra-adrenal site of aldosterone synthase expression and increased aldosterone content. Clin Endocrinol 2007; 66: 886–889 24 Pingitore A, Galli E, Barison A, Iervasi A, Scarlattini M, Nucci D, L’Abbate A, Mariotti R, Iervasi G. Acute effect of triiodothyronine (T3) replacement therapy in patients with chronic heart failure and low-T3 syndrome: a randomized, placebo-controlled study. J Clin Endocrinol Metab 2008; 93: 1351–1358 25 Funder JW. The genetic basis of primary aldosteronism. Curr Hypertens Rep 2012; 14: 120–124 26 Gallo-Payet N, Payet MD. Mechanism of action of ACTH: beyond cAMP. Microsc Res Tech 2003; 61: 275–287
Nicolini G et al. LH and TSH Effects on Aldosterone … Horm Metab Res 2014; 46: 318–321
321
This document was downloaded for personal use only. Unauthorized distribution is strictly prohibited.
Endocrine Research
Copyright of Hormone & Metabolic Research is the property of Georg Thieme Verlag Stuttgart and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
LH, Progesterone, and TSH can Stimulate Aldosterone In Vitro: A Study on Normal Adrenal Cortex and Aldosterone Producing Adenoma
Affiliations
Key words ▶ LH receptor ● ▶ TSH receptor ● ▶ progesterone ● ▶ aldosterone ●
received 08.04.2013 accepted 24.10.2013 Bibliography DOI http://dx.doi.org/ 10.1055/s-0033-1358733 Published online: December 2, 2013 Horm Metab Res 2014; 46: 318–321 © Georg Thieme Verlag KG Stuttgart · New York ISSN 0018-5043 Correspondence E. Fommei Clinical and Experimental Medicine Department Pisa Fondazione Toscana G. Monasterio and University of Pisa via Moruzzi n. 1 56124 Pisa Italy Tel.: + 39/050/3152 216 Fax: + 39/050/3152 166 [email protected]
G. Nicolini1, S. Balzan1, L. Morelli2, P. Iacconi2, L. Sabatino1, A. Ripoli1, E. Fommei3 1
Department of Cardiovascular Endocrinology, CNR Institute of Clinical Physiology, Pisa, Italy Department of General and Transplantation Surgery, University of Pisa, Pisa, Italy 3 Department of Clinical and Experimental Medicine, University of Pisa and Fondazione Toscana G. Monasterio, Pisa, Italy 2
Abstract
▼
Endocrine factors different from ACTH or angiotensin II can stimulate aldosterone secretion and have a role in the pathophysiology of hyperaldosteronism. Aldosterone may increase in luteotropic/progestogenic and in hypothyroid states; LH and, occasionally, TSH receptors have been detected in normal adrenal cortex and aldosterone-producing adenoma. The aim of the study was to compare adrenal contents of LH and TSH receptors between normal cortex and aldosterone-producing adenoma and to evaluate the ability of LH, its product progesterone, and TSH to stimulate aldosterone secretion in vitro from primary adrenocortical cells. Surgical aldosteroneproducing adenoma fragments from 19 patients and adrenal cortex fragments from 10 kidney donors were used for Western blotting and cell cultures. LH (n = 26), TSH (n = 19) and progester-
Introduction
▼
Adrenal cortex may be a target of hormonal stimulation other than adrenocorticotropic hormone (ACTH) or angiotensin II. Different receptors have been identified, particularly of gonadotropins, which may influence the adrenal production of glucocorticoids in the prevailing zona fasciculata, but may be present also in the less represented aldosterone producing zona glomerulosa [1]. Aldosterone may increase in states of elevation of progesterone, luteinizing hormone (LH), or its placental homologous chorionic gonadotropin during the luteal phase of the ovarian cycle, menopause or pregnancy [2–4]. We have previously indicated the aldosterone variability during the ovarian cycle as a possible confounding factor in the screening for primary aldosteronism in women [5] and similar findings were reported by others [6, 7]. To our knowledge no studies on this
Nicolini G et al. LH and TSH Effects on Aldosterone … Horm Metab Res 2014; 46: 318–321
one (n = 8) receptor proteins were investigated; LH receptor-mRNA was also tested in 8 samples. Aldosterone responses in vitro to LH, progesterone, and TSH stimulation were assayed. LH and TSH receptors were more expressed in adenoma than normal cortex (p < 0.01, p < 0.05, respectively); progesterone receptor was observed in 6/8 samples. Aldosterone increased after in vitro stimulation with LH (5/12 adenoma, 1/7 normal cells), progesterone (4/5 adenoma, 5/6 normal cells), and TSH (3/5 adenoma and 3/5 normal cells). LH and TSH receptors were more expressed in aldosterone producing adenoma than normal adrenal cortex. LH, progesterone, and TSH can stimulate aldosterone in vitro. Similar mechanisms could participate in vivo in the aldosterone increase in lutheotropic, progestogenic, or hypothyroid states and may exist in both normal adrenal cortex and adenoma in responsive individuals.
subject have been made in men, whose gonadal hormones are equally under LH control. Receptors for LH (LH-R) and chorionic gonadotropin have been recently observed in human aldosterone producing adenomas (APAs) but no definite statistical difference with normal adrenals (NA) was reported [8–10]. Past observations suggested also a relationship of aldosterone with thyroid stimulating hormone (TSH). TSH receptors (TSH-R) have been detected in the adrenal cortex and an increase in plasma aldosterone was reported after thyrotropic releasing hormone (TRH) stimulation in hyperaldosteronism [9] or following TSH surge during acute hypothyroidism [11], consistently with a possible link between thyroid function and aldosterone production. The above observations prompted us to investigate the presence of LH-R and TSH-R in the adrenal cortex in a comparison between APA and NA
This document was downloaded for personal use only. Unauthorized distribution is strictly prohibited.
Authors
Endocrine Research
Patients and Methods
▼
Adrenal tissues After informed consent, fragments of APA were collected from 19 euthyroid hypertensive patients (9 F/10 M, age 62 ± 12 years; mean ± SD) who underwent laparoscopic adrenalectomy after a clinical diagnosis of primary aldosteronism confirmed by captopril test and lateralization of aldosterone secretion at adrenal vein sampling (except 2 patients who refused the examination) [12]. Blood pressure control significantly improved after intervention up to 6 months in 16 patients and 3 months follow-up in the last 3 patients, respectively. NA tissues were collected from 10 kidney donors (5 F/5 M, age 54 ± 13 years) after approval by the Institutional Administration Board of Surgical and Transplantation Department of the University of Pisa. Two separate samples were collected for Western blotting analysis and adrenocortical cells cultures, respectively.
Western blotting analysis Frozen adrenal capsular cortex fragments (50–100 mg) were homogenized in Ripa lysis buffer (sc-24948, Santa Cruz, USA). Proteins (50 μg) were separated by 8 % sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE) and transferred to 0.2 mm nitrocellulose membrane (Bio-Rad, Hercules, CA, USA). After blocking nonspecific binding sites with 5 % nonfat milk (Roche) in Tween-20/PBS 0.1 % vol/vol, blots were incubated overnight at 4 °C with specific antibody anti-LH-R (rabbit polyclonal sc-25828, Santa Cruz, USA, 1:500 dilution) (16 APA, 10 NA). TSH-R was explored in 12 APA and 7 NA samples (mouse monoclonal ab2812, ABCAM, UK, 1:500 dilution) and progesterone receptor isoform B (PR-B C-20, rabbit polyclonal sc-539, Santa Cruz, USA, 1:500 dilution) in a subgroup of 4 APA and 4 NA samples. Membranes were incubated with horseradish peroxidase-conjugated secondary antibody (anti-rabbit IgG, sc-2357, Santa Cruz, USA, 1:3 000 dilution; anti-mouse IgG, ab6728 ABCAM, USA, 1:3 000 dilution). LH-R, TSH-R and PR were detected by chemiluminescence reagent (Roche kit, USA) and the optical density (OD) of each specific band analyzed with the Scion image software (Scion Corporation USA). Results are expressed as LH-R or TSH-R OD normalized to the reference protein beta-actin OD.
(Bio-Rad). Each reaction was carried out in a total volume of 10 μl and included 4 μl of template cDNA (1:5 diluted), 0.5 μM of each primer, and 2X iTaq Universal Sybr Green Supermix (BioRad). Amplification protocol started with 95 °C for 30 s followed by 39 cycles at 95 °C for 5 s and 60 °C for 15 s. To assess product specificity, amplicons were checked by melting curve analysis generated from 65 to 95 °C with increments of 0.5 °C/cycle. The mRNA expression of the 3 candidate reference genes was measured in duplicate in all samples and the average Ct value converted to a relative quantity and analyzed with CFX384 Manager algorithm as previously described [13].
Isolation and treatments of adrenocortical cells Fifteen cell cultures from APA and 7 from NA were obtained. Cell isolation was performed according to the method of Chu et al. [14]. After removal of surrounding fat, fragments of adrenal capsular tissue were separated by dissection and incubated in a digestion mixture (1 mg/ml collagenase in Leibovitz medium L-15) at 37 °C for 45 min. After filtering and centrifugation (900 rpm for 5 min), cells were seeded on 6-well plates (Corning, NY) in DMEM/F12 medium supplemented with 2 % fetal bovin serum (FBS), 100 U/ml penicillin, 100 μg/ml streptomycin, 250 ng/ml amphotericin, 1 % L-glutamine and maintained at 37 °C in humidified atmosphere of 95 % air/5 % CO2.
Hormonal stimulations Equal volumes of cell suspensions were kept both in the absence and presence of LH 0.3 μg/ml (10 nM, 33 mUI/ml) (12 APA and 7 NA), progesterone 31 ng/ml (100 nM) (5 APA and 6 NA), or TSH 1 mU/ml (5 APA and 5 NA) in serum free-DMEM/F12 medium for 6 h. The supernatant was then collected and stored at − 20 °C until used for aldosterone assays (ALDOCTK-2RIA kit, DIASORINs.r.l., Saluggia, Italy). In Aldo RIA the lower limit of sensitivity was 0.20 pg/ml; the ratio of cross link to other steroids was: cortisone 2.5 × 10 − 3 %, testosterone 8.0 × 10 − 4 %, cortisol 1.0 × 10 − 4 %, progesterone 8.0 × 10 − 5 %, pregnenolone 5 × 10 − 5 %, estradiol 1.0 × 10 − 5 %. No cross link to LH and TSH was observed at our experimental conditions.
Statistical analysis Groups comparison was made by Mann-Whitney test or independent samples t-test after log-transformation and Levene’s test for equality of variances in case of small samples; p < 0.05 was considered as statistically significant.
Results
▼
Real Time-PCR quantification of LHR One μg of total RNA obtained from 8 samples (4 NA and 4 APA) was reverse-transcribed with iScript cDNA Synthesis Kit (BioRad, Milan, Italy) according to the manufacturer’s instructions. Three candidate reference genes (HPRT, EEFIA, and TPT1) were selected from the most commonly cited in the literature to normalize mRNA expression data obtained by Real Time PCR (RTPCR). PCR primer sequences were as follows: HPRT F: 5′ TGCTGACCTGCTGGATTACAT 3′, R: 5′ TTGCGACCTTGACCATCTTT 3′; EEFIA1 F: 5′ CTTTGGGTCGCTTTGCTGTT 3′, R: 5′ CCGTTCTTCCACCACTGATT 3′; TPT1: F: 5′ AAATGTTAACAAATGTGGCAATTAT 3′, R: 5′ AACAATGCCTCCACTCCAAA 3′; LHR: F: 5′ GCCATCAAGAGAAACATTTGTCAA 3′, R: 5′ TTTCTAAAAGCACAGCAGTGGCT 3′. RT-PCR reactions were performed in a CFX384 RT-PCR System
Presence of LH-R and TSH-R in the adrenal cortex LH-R and TSH-R proteins were found in all samples of adrenal ▶ Fig. 1). Receptor expression was significantly higher in cortex (● APA than NA both for LH-R (16 APA, 10 NA; 1.7 ± 0.6 vs. 0.7 ± 0.3 beta-actin levels, respectively, mean ± SD, p < 0.001) and TSH-R (12 APA, 7 NA; 1.03 ± 0.4 vs. 0.53 ± 0.13 beta-actin levels, p < 0.05). ▶ Fig. 1c, PR-B receptor was detected in 4/4 NA and As shown in ● 2/4 APA. The higher level of LH-R protein as observed in APA compared to NA was confirmed by RT-PCR in a group of 4 APA against 4 NA (1.0 ± 0.4 vs. 0.04 ± 0.02 arbitrary units, mean ± SD, p < 0.01).
Nicolini G et al. LH and TSH Effects on Aldosterone … Horm Metab Res 2014; 46: 318–321
This document was downloaded for personal use only. Unauthorized distribution is strictly prohibited.
and to test the ability of LH, its main product progesterone, and TSH to stimulate aldosterone secretion by primary adrenocortical cells in vitro.
319
Fig. 2 Aldosterone response to LH, progesterone (P), and TSH stimulation in primary cultured adrenocortical cells from APA and NA. Results are expressed as fold changes of aldosterone levels over baseline. See text for stimulation details.
Discussion
▼
Fig. 1 Western blot for LH-R, TSH-R, and progesterone (isoform B) receptor (PR-B) in NA and APA cortex. a (above) LH-R and reference beta-actin expression in 3 representative NA (lanes 1–3) and 4 APA (lanes 4–7). b (above) TSH-R in 3 NA (lanes 1–3) and 4 APA (lanes 4–7). c PR-B in 4 NA (lanes 1–4) and 4 APA (lanes 5–8). Comparison of LH-R (a, below) and TSH-R (b, below) between NA and APA (***p < 0.001 for LH-R and *p < 0.05 for TSH-R).
LH, progesterone, and TSH stimulations in vitro Baseline aldosterone levels in the culture medium did not differ significantly between APA and NA (134 ± 125 vs. 169 ± 117 pg/ml, respectively) nor after normalizing for cell protein content in a subgroup of 6 APA and 6 NA (0.5 ± 0.1 vs. 1.1 ± 0.8 pg/ml/μg, respectively). ▶ Fig. 2, different aldosterone responses were As shown in ● obtained with the different stimuli. LH stimulated aldosterone secretion in 5/12 cultures from APA (from × 1.4 to × 5 over baseline) and 1/7 cultures from NA ( × 1.9). Progesterone stimulated aldosterone release in 4/5 cultures from APA (from × 1.7 to × 2.6) and in 5/6 cultures from NA (from × 1.2 to × 5.3). TSH stimulation increased aldosterone levels in 3/5 cultures from APA (from × 2.0 to × 2.5) and in 3/5 from NA (from × 3.0 to × 5.1). The level of receptor proteins and aldosterone response to hormonal stimulations appeared unrelated to each other or to age or gender of the studied subjects.
Different receptors in the adrenal cortex have been related to the adrenal responsiveness to various hormonal stimulations [1, 9, 10, 15]. Gonadotropin receptors may be present in all layers of the cortex, which is known to have a common embryonic origin with the gonads [16]. Adrenal cortex tumors may express gonadotropin and TSH receptors, both belonging to the same G-protein coupled receptor family [9, 17]. LH-R has been described in APA, though no definite comparison with normal adrenal tissues was reported [8–10]. In our study, LH-R was significantly more represented in APA (of known glomerulosa origin) than in NA cortex, a difference that would conceivably be enhanced if strict glomerulosa content had to be compared, due to the known prevailing expression of LHR in zona fasciculata [1]. This fact may be consistent with an association of LH-R with proliferative states, in keeping with the observed capability of the transferred LHR gene to induce adrenal hyperplasia or adenomas in experimental animals [18]. Within the short time length of cell culture experiments, baseline aldosterone levels did not differ between normal and APA adrenocortical cell medium. However, in stimulated conditions, LH could induce aldosterone secretion in subgroups of both NA and APA, indicating a direct activation, which could have a role in vivo in the increase of plasma aldosterone as observed in some luteotropic states. As a comparison, progesterone increased aldosterone secretion in the majority of cell cultures. This effect might be expected from an aldosterone precursor [19] even if an action through specific receptors cannot be excluded, as observed by others [20] and supported by our finding on the ▶ Fig. 1c). presence of PR-B in both normal and APA cortex (● Besides the reactive increase of aldosterone after mineralcorticoid receptor occupancy in progestogenic states, little attention has been given in our opinion to the direct effect of circulating progesterone on aldosterone secretion, though occasionally reported [4]. Thus, both LH and its main product progesterone could directly stimulate aldosterone secretion from normal glands and APA in luteotropic or progestogenic states. We found the presence of TSH-R also in both NA and APA and observed preliminarily both a higher TSH-R content in APA and a capability of TSH to stimulate aldosterone secretion in vitro. To our knowledge, no study in the literature reported similar
Nicolini G et al. LH and TSH Effects on Aldosterone … Horm Metab Res 2014; 46: 318–321
This document was downloaded for personal use only. Unauthorized distribution is strictly prohibited.
320 Endocrine Research
findings. TSH-R mRNA had been described in extrathyroid tissues including adrenals [21]. Zwermann et al. reported on the presence of TSH-R in one APA and an increase of plasma aldosterone after TRH stimulation in one subject with idiopathic primary aldosteronism [9]. Though thyroid function is well known to influence arterial blood pressure and cardiovascular function, very little attention has been given to its possible relationships with aldosterone. However, sparse observations in the literature indicated a high prevalence of thyroid nodules in primary aldosteronism as well as the presence of aldo-synthase mRNA in thyroid cysts fluid [22, 23]. In a model of acute human hypothyroidism we observed an increase in plasma aldosterone after TSH surge, which was dissociated from renin activity and positively related with TSH itself [11]. Similar findings were reported in low-T3 syndrome where T3 substitutive treatment induced a decrease in plasma aldosterone dissociated from plasma renin activity [24]. However, our present experimental data are too limited to support a definite conclusion on this pathophysiological aspect and further studies are needed to clarify the relationships between thyroid and mineralocorticoid function. Hormonal stimulations in vitro elicited variable responses in aldosterone secretion from adrenocortical cells, possibly due to individual genetic or epigenetic factors that could have a permissive role for full receptor activation and the completion of the synthetic pathway of aldosterone under different hormonal stimulations. In this regard, recent literature has added evidence on the role of different gene mutations in the activation of the aldosterone synthase pathway [25]. Several signaling pathways such as ERK/1,2/p38 or cAMP have been indicated in mediating the aldosterone release by the most important aldosterone modulators such as Ang II, K + and ACTH [26]. Since cAMP signaling is typical of G protein coupled receptors to which LH-R and TSH-R belong, we could hypothesize this mechanism for the aldosterone stimulation by LH and TSH at the adrenal level.
Conclusions
▼
LH-R, TSH-R, and PR-B proteins were observed in adenomas from patients with primary aldosteronism and in normal cortex. LH-R and TSH-R were increased in adenoma compared to normal adrenal cortex. Either LH, progesterone, or TSH was able to directly stimulate aldosterone secretion by adrenocortical cells of both types. Similar mechanisms could participate in vivo in the aldosterone increase during lutheotropic, progestogenic, or hypothyroid states and have a role in both adrenal physiology and pathophysiology in responsive individuals.
References 1 Lacroix A, Bourdeau I, Lampron A, Mazzuco TL, Tremblay J, Hamet P. Aberrant G-protein coupled receptor expression in relation to adrenocortical overfunction. Clin Endocrinol 2010; 73: 1–15 2 Chidambaram M, Duncan JA, Lai VS, Cattran DC, Floras JS, Scholey JW, Miller JA. Variation in the Renin Angiotensin System throughout the Normal Menstrual Cycle. J Am Soc Nephrol 2002; 13: 446–452 3 Sealey JE, Itskovitz-Eldor J, Rubattu S, James GD, August P, Thaler I, Levron J, Laragh JH. Estradiol- and progesterone-related increases in the renin-aldosterone system: studies during ovarian stimulation and early pregnancy. J Clin Endocrinol Metab 1994; 79: 258–264 4 Szmuilowicz ED, Adler GK, Williams JS, Green DE, Yso TM, Hopkins PN, Seely EW. Relationships between aldosterone and progesterone in the human menstrual cycle. J Clin Endocrinol Metab 2006; 91: 3981–3987
5 Fommei E, Ghione S, Ripoli A, Maffei S, Di Cecco P, Iervasi A, Turchi S. The ovarian cycle as a factor of variability in the laboratory screening for primary aldosteronism in women. J Human Hypertens 2009; 23: 130–135 6 Pizzolo F, Raffaelli R, Memmo A, Chiecchi L, Pavan C, Guarini P, Guidi GC, Franchi M, Corrocher R, Olivieri O. Effects of female sex hormones and contraceptive pill on the diagnostic work-up for primary aldosteronism. J Hypertens 2010; 28: 135–142 7 Ahmed AH, Gordon RD, Taylor PJ, Ward G, Pimenta E, Stowasser M. Are Women More at Risk of False-Positive Primary Aldosteronism Screening and Unnecessary Suppression Testing than Men? J Clin Endocrinol Metab 2011; 96: E340–E346 8 Saner-Amigh K, Mayhew B, Mantero F, Schiavi F, White P, Rao C, Rainey W. Elevated expression of luteinizing hormone receptor in aldosterone-producing adenomas. J Clin Endocrinol Metab 2006; 91: 1136–1142 9 Zwermann O, Suttmann Y, Bidlingmaier M, Beuschelein F, Reincke M. Screening for membrane hormone receptor expression in primary aldosteronism. Eur J Endocrinol 2009; 160: 443–451 10 Albiger NM, Sartorato P, Mariniello B, Iacobone M, Finco I, Fassina A, Mantero F. A case of primary aldosteronism in pregnancy: do LH and GNRH receptors have a potential role in regulating aldosterone secretion? Eur J Endocrinol 2011; 164: 405–412 11 Fommei E, Iervasi G. The role of thyroid hormone in blood pressure homeostasis: evidence from short-term hypothyroidism in humans. J Clin Endocrinol Metab 2002; 87: 1996–2000 12 Funder JW, Carey RM, Fardella C, Gomez-Sanchez CE, Mantero F, Stowasser M, Young WF Jr, Montori WM. Endocrine Society. Case detection, diagnosis, and treatment of patients with primary aldosteronism: an endocrine society clinical practice guideline. J Clin Endocrinol Metab 2008; 93: 3266–3281 13 Sabatino L, Cabiati M, Caselli C, Del Ry S. Adenosine receptor expression and gene reference evaluation in human leukocytes. Clin Lab 2013; 59: 571–577 14 Chu Y, Wu BM, McCabe ER, Dunn JC. Serum-Free cultures of murine adrenal cortical cells. J Pediatr Surg 2006; 41: 2008–2012 15 Lampron A, Bourdeau I, Oble S, Godbout A, Schoerch W, Arjane P, Hamet P, Lacroix A. Regulation of Aldosterone Secretion by Several Aberrant Receptors Including for Glucose-Dependent Insulinotropic Peptide in a Patient with an Aldosteronoma. J Clin Endocrinol Metab 2009; 94: 750–756 16 Keegan CE, Hammer GD. Recent insights into organogenesis of the adrenal cortex. Trends Endocrinol Metab 2002; 13: 200–208 17 Costagliola S, Urizar E, Mendive F, Vassart G. Specificity and promiscuity of gonadotropin receptors. Reproduction 2005; 130: 275–281 18 Mazzuco TL, Chabre O, Feige JJ, Thomas M. Aberrant Expression of Human Luteinizing Hormone Receptor by Adrenocortical Cells Is Sufficient to Provoke Both Hyperplasia and Cushing’s Syndrome Features. J Clin Endocrinol Metab 2006; 91: 196–203 19 Lucis OJ, Lucis R. Comparison of steroidogenesis in adrenal tissue and adrenal adenoma from a case of primary aldosteronism. J of Steroid Biochem 1971; 2: 19–31 20 De Cremoux P, Rosemberg D, Goussard J, Brémont-Weil C, Tissier F, Tran-Perennou C, Bertagna X, Bertherat J, Raffin-Sanson ML. Expression of progesterone and extradiol receptor in normal adrenal cortex, adrenocortical tumors and primary pigmented nodular adrenocortical disease. Endocr Relat Cancer 2008; 15: 465–474 21 Dutton CM, Joba W, Spitzweg C, Heufelder AE, Bahn RS. Thyrotropin receptor expression in adrenal, kidney, and thymus. Thyroid 1997; 7: 879–884 22 Armanini D, Nacamulli D, Scaroni C, Lumachi F, Selice R, Fiore C, Favia G, Mantero F. High prevalence of thyroid ultrasonographic abnormalities in primary aldosteronism. Endocrine 2003; 22: 155–160 23 Greenman Y, Trostanetsky Y, Ben-Shemen S, Grazas N, Limor R, Osher E, Lewicka S, Vecsei P, Stern N. Thyroid cysts: a new extra-adrenal site of aldosterone synthase expression and increased aldosterone content. Clin Endocrinol 2007; 66: 886–889 24 Pingitore A, Galli E, Barison A, Iervasi A, Scarlattini M, Nucci D, L’Abbate A, Mariotti R, Iervasi G. Acute effect of triiodothyronine (T3) replacement therapy in patients with chronic heart failure and low-T3 syndrome: a randomized, placebo-controlled study. J Clin Endocrinol Metab 2008; 93: 1351–1358 25 Funder JW. The genetic basis of primary aldosteronism. Curr Hypertens Rep 2012; 14: 120–124 26 Gallo-Payet N, Payet MD. Mechanism of action of ACTH: beyond cAMP. Microsc Res Tech 2003; 61: 275–287
Nicolini G et al. LH and TSH Effects on Aldosterone … Horm Metab Res 2014; 46: 318–321
321
This document was downloaded for personal use only. Unauthorized distribution is strictly prohibited.
Endocrine Research
Copyright of Hormone & Metabolic Research is the property of Georg Thieme Verlag Stuttgart and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
