[Downloaded free from http://www.ijmm.org on Saturday, July 12, 2014, IP: 220.225.230.107] || Click here to download free Android application for this journal
324
Indian Journal of Medical Microbiology
Discussion C. striatum, which is often considered as a saprophyte of skin and mucous membrane, has been recently reported as a multidrug-resistant pathogen causing long standing open wound infection. Isolation of C. striatum from a clinical specimen should not be ignored in view of its propensity to establish nosocomial infections.[3] Although, the mortality rates were observed to be low, mild skin and soft tissue infections may lead to bacteraemia, hence considered important.[4] C. striatum can establish de novo cutaneous infections through disruption of skin barriers or can invade previous cutaneous lesions,[5,6] Evidence of confluent growth isolated in pure culture on repeated cultures support its role in pathogenesis of lesion. It has been shown that the VITEK identification system is an accurate and useful method to identify Corynebacterium species.[7] Since majority of the strains are sensitive to carbapenems, linezolid and glycopeptides, the initial therapy with vancomycin could be beneficial.[8] Here, favourable outcome of the treatment occurred due to prompt introduction of intravenous vancomycin. Moreover, immediate management of C. striatum also helps in prevention of the spread of the multidrug-resistant pathogen in the hospital environment.
vol. 32, No. 3
Rev 1997;10:125-59. 2. Lee PP, Ferguson DA Jr, Sarubbi FA. Corynebacterium striatum: An underappreciated community and nosocomial pathogen. J Infect 2005;50:338-43. 3. Superti SV, Martin Dde S, Caierão J, Soares F, Prochnow T, Cantarelli VV, et al. Corynebacterium Striatum infecting a Malignant cutaneous lesion: The emergence of an opportunistic pathogen. Rev Inst Med Trop Sau Paulo 2009;51:115-6. 4. Soriano F, Rodriguez-Tudela JL, FernandezRoblas R, Aguado JM, Santamarıa M. Skin colonization by Corynebacterium groups D2 and JK in hospitalized patients. J Clin Microbiol 1998;26:1878-80. 5. Gandham NR, Singh G, Roy I, Vyawahare C, Gooptu S, Jadhav SV, et al. Necrotizing fasciitis of lower limb by Corynebacterium Striatum in a HbsAg positive patient. Int J Med Clin Res 2013;4:242-4. 6. Scholle D. A spontaneous joint infection with Corynebacterium striatum. J Clin Microbiol 2007;45:656-8. 7. Kocazeybek B, Ozder A, Kucukoglu S, Kuckates E, Yuksel H, Olga R. Report of a case with polymicrobial endocarditis related to multiresistant strains. Chemotherapy 2002;48:316-9. 8. Tarr PE, Stock F, Cooke RH, Fedorko DP, Lucey DR. Multidrug-resistant Corynebacterium striatum pneumonia in a heart transplant recipient. Transpl Infect Dis 2003;5:53-8. Access this article online
Conclusion
Quick Response Code:
C. striatum is an established nosocomial pathogen in hospital settings causing pyogenic lesions, meningitis, pneumonia, bacteraemia and endocarditis. This case report highlights the growing importance of C. striatum as a nosocomial pathogen. However, timely diagnosis and prompt treatment with intravenous vancomycin lead to favourable outcome of the patient. References 1. Funke G, von Graevenitz A, Clarridge JE 3rd, Bernard KA. Clinical microbiology of coryneform bacteria. Clin Microbiol
Website: www.ijmm.org PMID: *** DOI: 10.4103/0255-0857.136589
How to cite this article: Biswal I, Mohapatra S, Deb M, Dawar R, Gaind R. Corynebacterium striatum: An emerging nosocomial pathogen in a case of laryngeal carcinoma. Indian J Med Microbiol 2014;32:323-4. Source of Support: Nil, Conflict of Interest: None declared.
Legionella pneumophila infection associated with renal failure causing fatality in a known case of sarcoidosis *R Chaudhry, A Valavane, A Mohan, AB Dey
Abstract Legionella pneumophila infection may become fatal in immunocompromised state. We report here the first known fatal case from India due to Legionella pneumophila infection complicated by renal failure in a patient undergoing treatment for Sarcoidosis. Sarcoidosis is an idiopathic systemic inflammatory disease involving multiple organs. Urine antigen detection and polymerase chain reaction targeting 16S rRNA gene could help in rapid diagnosis of the infection and thereby start specific therapy. Clinical awareness along with availability of rapid diagnostic tests and institution of specific therapy may reduce morbidity and mortality associated with this infection especially in immunocompromised state. Key words: India, Legionella pneumophila, Sarcoidosis www.ijmm.org
[Downloaded free from http://www.ijmm.org on Saturday, July 12, 2014, IP: 220.225.230.107] || Click here to download free Android application for this journal
July-September 2014
Case Reports
Introduction Legionella are ubiquitous bacteria whose natural habitats are water bodies and man‑made aquatic environment.[1] Risk factors for infection include increasing age, male sex, smoking, chronic lung disease, end‑stage renal disease, malignancies and immunosuppression.[2] Infection with Legionella species is commonly reported in immunocompromised patients worldwide.[3] Legionella pneumophila is responsible for approximately 90% of infection in the genus.[4] To our knowledge this is the first known fatal case due to Legionella pneumophila infection reported from India. Case Report A 50‑year‑old male patient was admitted to the Pulmonary Medicine Intensive Care Unit of All India Institute of Medical Sciences on September 2011, following a brief history of dry cough, which increased in supine position and high fever for 4 days. No history of similar illness was noted in the patients’ neighbourhood. The patient was a non‑smoker, non‑drinker and had no history of diabetes, hypertension, ischemic heart disease or bronchial asthma. In 2007, the patient was evaluated for persistent fever, dry cough, weight loss and right pleural effusion and was diagnosed with pulmonary tuberculosis. He took anti‑tuberculosis therapy for 9 months with partial improvement. In 2010, he developed generalised maculopapular skin lesions and posterior uveitis. A skin lesion biopsy showed non‑caseating granuloma and a diagnosis of Sarcoidosis was made. The patient was subsequently referred to our hospital. On evaluation, he showed increased serum creatinine (7.0 mg/dl) and serum Angiotensin converting enzyme levels (225.0 mg/l). He was managed as an out‑patient with systemic corticosteroids and was showing symptomatic improvement. On admission during the present episode, the patient was febrile with a temperature of 39.6°C, with cyanosis, pedal oedema, maculopapular rash all over the body and without any organomegaly. His oral cavity showed candidiasis. He was conscious, oriented and no focal neurological deficit was noted. Cardiovascular system examination showed no abnormalities. He had a blood pressure of 104/64 mmHg, a respiratory rate of 44 breaths/min and a pulse rate of 140 beats/min. Respiratory system examination showed bilateral infra‑axillary and infra‑scapular crepitations. Chest X‑ray showed bilateral lower zone infiltrates.
*Corresponding author (email: ) Departments of Microbiology (RC, AV), Pulmonary Medicine and Sleep Disorder (AM), Medicine (ABD), All India Institute of Medical Sciences, New Delhi, India Received: 12‑07‑2013 Accepted: 03‑12‑2013
325
Routine investigations on admission showed haemoglobin of 10.6 g/dl, total leucocyte count of 35,200/µL (88% neutrophils), platelet count of 247 × 103 cells/mm3 and erythrocyte sedimentation rate of 112 mm/1st hour. He had hyponatremia and hyperphosphatemia, with serum sodium and phosphate levels at 123 mEq/l and 9.5 mg/dl, respectively. His renal parameters were deranged with blood urea at 198 mg/dl; serum creatinine at 5.7 mg/dl and serum uric acid at 11 mg/dl. His serum potassium and calcium levels were within normal range. The liver function tests were normal except for an increased alkaline phosphatase levels at 202 IU/l. Blood gas analysis revealed blood pH at 7.39; arterial carbon dioxide partial pressure (PaCO2) at 20.9 mmHg; arterial oxygen partial pressure (PaO2) at 73.4 mmHg; bicarbonate concentration (SBC) at 12.3 mmol/l and saturation of oxygen (SaO2) at 91%. Based on the history and the present condition, a clinical diagnosis of Sarcoidosis, lower respiratory tract infection with type I respiratory failure was made. Tracheal aspirate, throat swabs, blood and urine samples were sent to look for organisms causing respiratory tract infection. The samples were processed for detecting Mycoplasma and Legionella infection in addition to conventional pathogens. Urine sample was heat treated at 50°C for 30 min to rule out cross reactivity. Urine sample turned positive for urinary antigen of Legionella pneumophila with BINAX NOW Legionella urinary antigen kit (The Netherlands). The report was communicated immediately to the clinician. The patient was administered intravenous azithromycin and cefaperazone–sulbactam combination. Blood culture was sterile and the patient was negative for hepatitis B surface antigen, anti‑hepatitis C antibodies and anti‑HIV antibodies. Rheumatoid factor, anti‑nuclear antibodies and anti‑neutrophil cytoplasmic antibodies were not detected. Gram stain of tracheal aspirate showed Gram‑negative bacilli in filamentous form. Routine culture of tracheal aspirate showed no growth. Part of the tracheal aspirate was used for culture on Buffered charcoal Yeast extract agar supplemented with L-cysteine (BCYE) agar and another part for direct DNA extraction since culture would be time consuming. ELISA using commercial kits (EUROIMMUN, Medizinisch Labordiagnostika AG, Netherland) showed the presence of IgG and IgM antibodies for Legionella pneumophila. The isolated DNA was used for detection of Legionella pneumophila. Previously standardised and published polymerase chain reaction (PCR) and restriction enzyme analysis[5] were used for further analysis [Figure 1]. PCR and restriction digestion confirmed the presence of Legionella pneumophila DNA in the tracheal aspirate of the patient [Figure 2]. Briefly, DNA was isolated from tracheal aspirate using QIAmp kit (Qiagen, Germany) and was applied for identification of 16S rRNA gene of Legionella species using published forward primer
www.ijmm.org
[Downloaded free from http://www.ijmm.org on Saturday, July 12, 2014, IP: 220.225.230.107] || Click here to download free Android application for this journal
326
Indian Journal of Medical Microbiology
‑5′‑AGGGTTGATAGGTTAAGAGC‑3′ and reverse primer 5′‑ATTCCACTACCCTCTCCCATACTCGAGTCAACC‑3′. The amplified product (226 bp) was purified using QIAGEN Gel extraction kit (Qiagen, Germany). Restriction digestion was done on the 226 bp product of 16S rRNA gene using TaaI (HpyCH4III) endonuclease (Fermentas) for confirmation of Legionella pneumophila. Briefly, 15.0 µl of purified PCR product was digested with TaaI enzyme, buffer Tango and sterile water to make a final volume of 60 µl. The enzymatic digestion was carried at 65°C for 1 hour followed by examination of 20 µl digested product by 2.5% agarose gel electrophoresis. Legionella pneumophila infection was confirmed on the third day of admission using the rapid molecular technique; however, culture of tracheal aspirate on BCYE agar supplemented with L‑cysteine showed no growth even after 14 days of incubation. The ELISA and PCR for Mycoplasma pneumoniae were negative and no other bacterial respiratory pathogens were detected. In view of inadequate clinical response, fluconazole and levofloxacin were added from the third day of admission. However, he developed acute respiratory distress syndrome and he had to be put on mechanical ventilation the same day. Subsequently, his overall condition kept deteriorating in the form of progressive anaemia, thrombocytopenia, sepsis and renal failure and he passed away on the ninth day of the hospital stay. Discussion The first report on Legionella pneumophila from India showed the presence of the organism in 9% of patients'
Figure 1: Standardised PCR and restriction enzyme analysis. Band corresponding to 226 bp sequence of 16S rRNA gene and its restriction digestion pattern in the species L. pneumophila (180 and 46 bp). Lane 1, Negative control; lanes 2 and 6, ATCC 33152 L. pneumophila strain Philadelphia and ATCC 33153 L. pneumophila strain Knoxville- 226 bp 16S rRNA fragment, respectively; lanes 3 and 5, ATCC 33152 and ATCC 33153-16S rRNA product – TaaI (HpyCH4III) enzyme digestion at 65°C for 1 hour, respectively; Lane 4, Low Range Marker (25-700 bp)
vol. 32, No. 3
suffering from pneumonia.[6] A retrospective study detected 15% of IgG antibodies against Legionella penumophila by ELISA.[7] Another study detected presence of 7.9%, 15.9%, 11.5% and 17.6% of IgG, IgM, IgA anti‑Legionella pneumophila antibodies (EUROIMMUN Medizinisch Labordiagnostika AG, Netherland) and urine antigen using Microwell ELISA (IVD Research, USA) method against this infection in patients’ with community acquired pneumonia.[8] The use of molecular techniques for detecting this pathogen is not well studied in Indian population. We report here the first known fatal case due to Legionella pneumophila infection diagnosed by urine antigen detection and a rapid molecular technique from India. To our knowledge this is the first report of a patient with Sarcoidosis acquiring Legionella pneumophila infection. Sarcoidosis is an idiopathic systemic inflammatory disease involving multiple organs and its aetiology has been associated with bacterial agents like Mycobacterium and Propionibacterium species.[9] Clinical suspicion of Legionnaire’s disease is a major factor in diagnosing the infection. Fiumefreddo et al.,[10] has given a brief account on clinical predictors for Legionella in patients’ with community‑acquired pneumonia. In this case, dry cough, high fever, hyponatremia and elevated serum creatinine was observed on the day of admission and the clinicians sent the samples for testing of Legionella. The clinicians’ were made aware of the presence of urinary Legionella pneumophila antigen on the same day of admission. We used urine antigen screening along with two‑step rapid method described by Zhan et al.,[5] and confirmed Legionella pneumophila infection by the third day of admission.
Figure 2: PCR and restriction enzyme analysis of the tracheal aspirate DNA from the patient. Lane 1, Negative control; lanes 2 and 6, ATCC 33152 L. pneumophila strain Philadelphia-226 bp fragment of 16S rRNA gene amplified product and its restriction enzyme digestion pattern, respectively; lane 3, low range marker (25-700 bp); lanes 4 and 5, patient’s tracheal aspirate DNA showing amplified 226 bp fragment and its restriction digestion pattern, respectively
www.ijmm.org
[Downloaded free from http://www.ijmm.org on Saturday, July 12, 2014, IP: 220.225.230.107] || Click here to download free Android application for this journal
July-September 2014
327
Case Reports
Sporadic cases like the one reported here keep occurring but goes unnoticed because of lack of clinical awareness. It can be done with a simple screening of the patients' urine can be done for Legionella antigen and the characterisation of the bacteria can be done in a reference laboratory. Lower respiratory tract infection with Legionella pneumophila played a critical role in the death of the patient who was apparently healthy a week back before admission. In immunocompromised state this infection could play a crucial role in causing mortality. Conclusion
5.
6. 7. 8.
Infection due to Legionella species should be considered in the management of immunocompromised patients with respiratory tract infection. Rapid tests like urine antigen detection and molecular tests targeting specific gene could help in diagnosing the infection.
9. 10.
Acknowledgements We would like to acknowledge Indian Council of Medical Research for funding the project.
Access this article online Quick Response Code:
References 1. Amemura‑Maekawa J, Kura F, Chang B, Watanabe H. Legionella pneumophila serogroup 1 isolates from cooling towers in Japan form a distinct genetic cluster. Microbiol Immunol 2005;49:1027‑33. 2. Fields BS, Benson RF, Besser RE. Legionella and Legionnaires’ disease: 25 years of investigation. Clin Microbiol Rev 2002;15:506‑26. 3. Kumpers P, Tiede A, Kirschner P, Girke G, Ganser A, Peest D. Legionnaires’ disease in immunocompromised patients: A case report of Legionella longbeachae pneumonia and review of the literature. J Med Microbiol 2008;57:384‑7. 4. Yu VL, Plouffe JF, Pastoris MC, Stout JE, Schousboe M, Widmer A, et al. Distribution of Legionella species and
serogroups isolated by culture in patients with sporadic community‑acquired legionellosis: An international collaborative survey. J Infect Dis 2002;186:127‑8. Zhan XY, Li LQ, Hu CH, Zhu QY. Two‑step scheme for rapid identification and differentiation of Legionella pneumophila and non‑Legionella pneumophila species. J Clin Microbiol 2010;48:433‑9. Agrawal L, Dhunjibhoy KR, Nair KG. Isolation of Legionella pneumophila from patients of respiratory tract disease and environmental samples. Indian J Med Res 1991;93:364‑5. Chaudhry R, Dhawan B, Dey AB. The incidence of Legionella pneumophila: A retrospective study in a tertiary care hospital in India. Trop Doct 2000;30:197‑200. Javed S, Chaudhry R, Passi K, Sharma S, K P, Dhawan B, et al. Sero diagnosis of Legionella infection in community acquired pneumonia. Indian J Med Res 2010;131:92‑6. Saidha S, Sotirchos ES, Eckstein C. Etiology of sarcoidosis: Does infection play a role? Yale J Biol Med 2012;85:133‑41. Fiumefreddo R, Zaborsky R, Haeuptle J, Crain MC, Trampuz A, Steffen I, et al. Clinical predictors for Legionella in patients presenting with community‑acquired pneumonia to the emergency department. BMC Pulm Med 2009;9:4.
Website: www.ijmm.org PMID: *** DOI: 10.4103/0255-0857.136590
How to cite this article: Chaudhry R, Valavane A, Mohan A, Dey AB. Legionella pneumophila infection associated with renal failure causing fatality in a known case of sarcoidosis. Indian J Med Microbiol 2014;32:324-7. Source of Support: Indian Council of Medical Research, Conflict of Interest: None declared.
Myroides odoratus and Chryseobacterium indologenes: Two rare isolates in the immunocompromised *R Deepa, KG Venkatesh, J Durdana Parveen, S Thasneem Banu, G Jayalakshmi
Abstract Myroides spp and Chryseobacterium spp are uncommon clinical isolates, though more frequently reported to cause infections than other pigmented non‑fermentors. Two cases of Myroides odoratus and Chryseobacterium indologenes infection in a diabetic with pulmonary tuberculosis and a patient with de‑compensated alcoholic liver disease, respectively, are reported here. Anti‑microbial susceptibility testing of the isolates was performed by determining the minimum inhibitory concentration. The clinical picture, characteristic features of the isolates and the antibiotic susceptibility pattern are discussed briefly. Key words: Chryseobacterium indologenes, myroides odoratus, minimum inhibitory concentration
www.ijmm.org
Copyright of Indian Journal of Medical Microbiology is the property of Medknow Publications & Media Pvt. Ltd. and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
324
Indian Journal of Medical Microbiology
Discussion C. striatum, which is often considered as a saprophyte of skin and mucous membrane, has been recently reported as a multidrug-resistant pathogen causing long standing open wound infection. Isolation of C. striatum from a clinical specimen should not be ignored in view of its propensity to establish nosocomial infections.[3] Although, the mortality rates were observed to be low, mild skin and soft tissue infections may lead to bacteraemia, hence considered important.[4] C. striatum can establish de novo cutaneous infections through disruption of skin barriers or can invade previous cutaneous lesions,[5,6] Evidence of confluent growth isolated in pure culture on repeated cultures support its role in pathogenesis of lesion. It has been shown that the VITEK identification system is an accurate and useful method to identify Corynebacterium species.[7] Since majority of the strains are sensitive to carbapenems, linezolid and glycopeptides, the initial therapy with vancomycin could be beneficial.[8] Here, favourable outcome of the treatment occurred due to prompt introduction of intravenous vancomycin. Moreover, immediate management of C. striatum also helps in prevention of the spread of the multidrug-resistant pathogen in the hospital environment.
vol. 32, No. 3
Rev 1997;10:125-59. 2. Lee PP, Ferguson DA Jr, Sarubbi FA. Corynebacterium striatum: An underappreciated community and nosocomial pathogen. J Infect 2005;50:338-43. 3. Superti SV, Martin Dde S, Caierão J, Soares F, Prochnow T, Cantarelli VV, et al. Corynebacterium Striatum infecting a Malignant cutaneous lesion: The emergence of an opportunistic pathogen. Rev Inst Med Trop Sau Paulo 2009;51:115-6. 4. Soriano F, Rodriguez-Tudela JL, FernandezRoblas R, Aguado JM, Santamarıa M. Skin colonization by Corynebacterium groups D2 and JK in hospitalized patients. J Clin Microbiol 1998;26:1878-80. 5. Gandham NR, Singh G, Roy I, Vyawahare C, Gooptu S, Jadhav SV, et al. Necrotizing fasciitis of lower limb by Corynebacterium Striatum in a HbsAg positive patient. Int J Med Clin Res 2013;4:242-4. 6. Scholle D. A spontaneous joint infection with Corynebacterium striatum. J Clin Microbiol 2007;45:656-8. 7. Kocazeybek B, Ozder A, Kucukoglu S, Kuckates E, Yuksel H, Olga R. Report of a case with polymicrobial endocarditis related to multiresistant strains. Chemotherapy 2002;48:316-9. 8. Tarr PE, Stock F, Cooke RH, Fedorko DP, Lucey DR. Multidrug-resistant Corynebacterium striatum pneumonia in a heart transplant recipient. Transpl Infect Dis 2003;5:53-8. Access this article online
Conclusion
Quick Response Code:
C. striatum is an established nosocomial pathogen in hospital settings causing pyogenic lesions, meningitis, pneumonia, bacteraemia and endocarditis. This case report highlights the growing importance of C. striatum as a nosocomial pathogen. However, timely diagnosis and prompt treatment with intravenous vancomycin lead to favourable outcome of the patient. References 1. Funke G, von Graevenitz A, Clarridge JE 3rd, Bernard KA. Clinical microbiology of coryneform bacteria. Clin Microbiol
Website: www.ijmm.org PMID: *** DOI: 10.4103/0255-0857.136589
How to cite this article: Biswal I, Mohapatra S, Deb M, Dawar R, Gaind R. Corynebacterium striatum: An emerging nosocomial pathogen in a case of laryngeal carcinoma. Indian J Med Microbiol 2014;32:323-4. Source of Support: Nil, Conflict of Interest: None declared.
Legionella pneumophila infection associated with renal failure causing fatality in a known case of sarcoidosis *R Chaudhry, A Valavane, A Mohan, AB Dey
Abstract Legionella pneumophila infection may become fatal in immunocompromised state. We report here the first known fatal case from India due to Legionella pneumophila infection complicated by renal failure in a patient undergoing treatment for Sarcoidosis. Sarcoidosis is an idiopathic systemic inflammatory disease involving multiple organs. Urine antigen detection and polymerase chain reaction targeting 16S rRNA gene could help in rapid diagnosis of the infection and thereby start specific therapy. Clinical awareness along with availability of rapid diagnostic tests and institution of specific therapy may reduce morbidity and mortality associated with this infection especially in immunocompromised state. Key words: India, Legionella pneumophila, Sarcoidosis www.ijmm.org
[Downloaded free from http://www.ijmm.org on Saturday, July 12, 2014, IP: 220.225.230.107] || Click here to download free Android application for this journal
July-September 2014
Case Reports
Introduction Legionella are ubiquitous bacteria whose natural habitats are water bodies and man‑made aquatic environment.[1] Risk factors for infection include increasing age, male sex, smoking, chronic lung disease, end‑stage renal disease, malignancies and immunosuppression.[2] Infection with Legionella species is commonly reported in immunocompromised patients worldwide.[3] Legionella pneumophila is responsible for approximately 90% of infection in the genus.[4] To our knowledge this is the first known fatal case due to Legionella pneumophila infection reported from India. Case Report A 50‑year‑old male patient was admitted to the Pulmonary Medicine Intensive Care Unit of All India Institute of Medical Sciences on September 2011, following a brief history of dry cough, which increased in supine position and high fever for 4 days. No history of similar illness was noted in the patients’ neighbourhood. The patient was a non‑smoker, non‑drinker and had no history of diabetes, hypertension, ischemic heart disease or bronchial asthma. In 2007, the patient was evaluated for persistent fever, dry cough, weight loss and right pleural effusion and was diagnosed with pulmonary tuberculosis. He took anti‑tuberculosis therapy for 9 months with partial improvement. In 2010, he developed generalised maculopapular skin lesions and posterior uveitis. A skin lesion biopsy showed non‑caseating granuloma and a diagnosis of Sarcoidosis was made. The patient was subsequently referred to our hospital. On evaluation, he showed increased serum creatinine (7.0 mg/dl) and serum Angiotensin converting enzyme levels (225.0 mg/l). He was managed as an out‑patient with systemic corticosteroids and was showing symptomatic improvement. On admission during the present episode, the patient was febrile with a temperature of 39.6°C, with cyanosis, pedal oedema, maculopapular rash all over the body and without any organomegaly. His oral cavity showed candidiasis. He was conscious, oriented and no focal neurological deficit was noted. Cardiovascular system examination showed no abnormalities. He had a blood pressure of 104/64 mmHg, a respiratory rate of 44 breaths/min and a pulse rate of 140 beats/min. Respiratory system examination showed bilateral infra‑axillary and infra‑scapular crepitations. Chest X‑ray showed bilateral lower zone infiltrates.
*Corresponding author (email: ) Departments of Microbiology (RC, AV), Pulmonary Medicine and Sleep Disorder (AM), Medicine (ABD), All India Institute of Medical Sciences, New Delhi, India Received: 12‑07‑2013 Accepted: 03‑12‑2013
325
Routine investigations on admission showed haemoglobin of 10.6 g/dl, total leucocyte count of 35,200/µL (88% neutrophils), platelet count of 247 × 103 cells/mm3 and erythrocyte sedimentation rate of 112 mm/1st hour. He had hyponatremia and hyperphosphatemia, with serum sodium and phosphate levels at 123 mEq/l and 9.5 mg/dl, respectively. His renal parameters were deranged with blood urea at 198 mg/dl; serum creatinine at 5.7 mg/dl and serum uric acid at 11 mg/dl. His serum potassium and calcium levels were within normal range. The liver function tests were normal except for an increased alkaline phosphatase levels at 202 IU/l. Blood gas analysis revealed blood pH at 7.39; arterial carbon dioxide partial pressure (PaCO2) at 20.9 mmHg; arterial oxygen partial pressure (PaO2) at 73.4 mmHg; bicarbonate concentration (SBC) at 12.3 mmol/l and saturation of oxygen (SaO2) at 91%. Based on the history and the present condition, a clinical diagnosis of Sarcoidosis, lower respiratory tract infection with type I respiratory failure was made. Tracheal aspirate, throat swabs, blood and urine samples were sent to look for organisms causing respiratory tract infection. The samples were processed for detecting Mycoplasma and Legionella infection in addition to conventional pathogens. Urine sample was heat treated at 50°C for 30 min to rule out cross reactivity. Urine sample turned positive for urinary antigen of Legionella pneumophila with BINAX NOW Legionella urinary antigen kit (The Netherlands). The report was communicated immediately to the clinician. The patient was administered intravenous azithromycin and cefaperazone–sulbactam combination. Blood culture was sterile and the patient was negative for hepatitis B surface antigen, anti‑hepatitis C antibodies and anti‑HIV antibodies. Rheumatoid factor, anti‑nuclear antibodies and anti‑neutrophil cytoplasmic antibodies were not detected. Gram stain of tracheal aspirate showed Gram‑negative bacilli in filamentous form. Routine culture of tracheal aspirate showed no growth. Part of the tracheal aspirate was used for culture on Buffered charcoal Yeast extract agar supplemented with L-cysteine (BCYE) agar and another part for direct DNA extraction since culture would be time consuming. ELISA using commercial kits (EUROIMMUN, Medizinisch Labordiagnostika AG, Netherland) showed the presence of IgG and IgM antibodies for Legionella pneumophila. The isolated DNA was used for detection of Legionella pneumophila. Previously standardised and published polymerase chain reaction (PCR) and restriction enzyme analysis[5] were used for further analysis [Figure 1]. PCR and restriction digestion confirmed the presence of Legionella pneumophila DNA in the tracheal aspirate of the patient [Figure 2]. Briefly, DNA was isolated from tracheal aspirate using QIAmp kit (Qiagen, Germany) and was applied for identification of 16S rRNA gene of Legionella species using published forward primer
www.ijmm.org
[Downloaded free from http://www.ijmm.org on Saturday, July 12, 2014, IP: 220.225.230.107] || Click here to download free Android application for this journal
326
Indian Journal of Medical Microbiology
‑5′‑AGGGTTGATAGGTTAAGAGC‑3′ and reverse primer 5′‑ATTCCACTACCCTCTCCCATACTCGAGTCAACC‑3′. The amplified product (226 bp) was purified using QIAGEN Gel extraction kit (Qiagen, Germany). Restriction digestion was done on the 226 bp product of 16S rRNA gene using TaaI (HpyCH4III) endonuclease (Fermentas) for confirmation of Legionella pneumophila. Briefly, 15.0 µl of purified PCR product was digested with TaaI enzyme, buffer Tango and sterile water to make a final volume of 60 µl. The enzymatic digestion was carried at 65°C for 1 hour followed by examination of 20 µl digested product by 2.5% agarose gel electrophoresis. Legionella pneumophila infection was confirmed on the third day of admission using the rapid molecular technique; however, culture of tracheal aspirate on BCYE agar supplemented with L‑cysteine showed no growth even after 14 days of incubation. The ELISA and PCR for Mycoplasma pneumoniae were negative and no other bacterial respiratory pathogens were detected. In view of inadequate clinical response, fluconazole and levofloxacin were added from the third day of admission. However, he developed acute respiratory distress syndrome and he had to be put on mechanical ventilation the same day. Subsequently, his overall condition kept deteriorating in the form of progressive anaemia, thrombocytopenia, sepsis and renal failure and he passed away on the ninth day of the hospital stay. Discussion The first report on Legionella pneumophila from India showed the presence of the organism in 9% of patients'
Figure 1: Standardised PCR and restriction enzyme analysis. Band corresponding to 226 bp sequence of 16S rRNA gene and its restriction digestion pattern in the species L. pneumophila (180 and 46 bp). Lane 1, Negative control; lanes 2 and 6, ATCC 33152 L. pneumophila strain Philadelphia and ATCC 33153 L. pneumophila strain Knoxville- 226 bp 16S rRNA fragment, respectively; lanes 3 and 5, ATCC 33152 and ATCC 33153-16S rRNA product – TaaI (HpyCH4III) enzyme digestion at 65°C for 1 hour, respectively; Lane 4, Low Range Marker (25-700 bp)
vol. 32, No. 3
suffering from pneumonia.[6] A retrospective study detected 15% of IgG antibodies against Legionella penumophila by ELISA.[7] Another study detected presence of 7.9%, 15.9%, 11.5% and 17.6% of IgG, IgM, IgA anti‑Legionella pneumophila antibodies (EUROIMMUN Medizinisch Labordiagnostika AG, Netherland) and urine antigen using Microwell ELISA (IVD Research, USA) method against this infection in patients’ with community acquired pneumonia.[8] The use of molecular techniques for detecting this pathogen is not well studied in Indian population. We report here the first known fatal case due to Legionella pneumophila infection diagnosed by urine antigen detection and a rapid molecular technique from India. To our knowledge this is the first report of a patient with Sarcoidosis acquiring Legionella pneumophila infection. Sarcoidosis is an idiopathic systemic inflammatory disease involving multiple organs and its aetiology has been associated with bacterial agents like Mycobacterium and Propionibacterium species.[9] Clinical suspicion of Legionnaire’s disease is a major factor in diagnosing the infection. Fiumefreddo et al.,[10] has given a brief account on clinical predictors for Legionella in patients’ with community‑acquired pneumonia. In this case, dry cough, high fever, hyponatremia and elevated serum creatinine was observed on the day of admission and the clinicians sent the samples for testing of Legionella. The clinicians’ were made aware of the presence of urinary Legionella pneumophila antigen on the same day of admission. We used urine antigen screening along with two‑step rapid method described by Zhan et al.,[5] and confirmed Legionella pneumophila infection by the third day of admission.
Figure 2: PCR and restriction enzyme analysis of the tracheal aspirate DNA from the patient. Lane 1, Negative control; lanes 2 and 6, ATCC 33152 L. pneumophila strain Philadelphia-226 bp fragment of 16S rRNA gene amplified product and its restriction enzyme digestion pattern, respectively; lane 3, low range marker (25-700 bp); lanes 4 and 5, patient’s tracheal aspirate DNA showing amplified 226 bp fragment and its restriction digestion pattern, respectively
www.ijmm.org
[Downloaded free from http://www.ijmm.org on Saturday, July 12, 2014, IP: 220.225.230.107] || Click here to download free Android application for this journal
July-September 2014
327
Case Reports
Sporadic cases like the one reported here keep occurring but goes unnoticed because of lack of clinical awareness. It can be done with a simple screening of the patients' urine can be done for Legionella antigen and the characterisation of the bacteria can be done in a reference laboratory. Lower respiratory tract infection with Legionella pneumophila played a critical role in the death of the patient who was apparently healthy a week back before admission. In immunocompromised state this infection could play a crucial role in causing mortality. Conclusion
5.
6. 7. 8.
Infection due to Legionella species should be considered in the management of immunocompromised patients with respiratory tract infection. Rapid tests like urine antigen detection and molecular tests targeting specific gene could help in diagnosing the infection.
9. 10.
Acknowledgements We would like to acknowledge Indian Council of Medical Research for funding the project.
Access this article online Quick Response Code:
References 1. Amemura‑Maekawa J, Kura F, Chang B, Watanabe H. Legionella pneumophila serogroup 1 isolates from cooling towers in Japan form a distinct genetic cluster. Microbiol Immunol 2005;49:1027‑33. 2. Fields BS, Benson RF, Besser RE. Legionella and Legionnaires’ disease: 25 years of investigation. Clin Microbiol Rev 2002;15:506‑26. 3. Kumpers P, Tiede A, Kirschner P, Girke G, Ganser A, Peest D. Legionnaires’ disease in immunocompromised patients: A case report of Legionella longbeachae pneumonia and review of the literature. J Med Microbiol 2008;57:384‑7. 4. Yu VL, Plouffe JF, Pastoris MC, Stout JE, Schousboe M, Widmer A, et al. Distribution of Legionella species and
serogroups isolated by culture in patients with sporadic community‑acquired legionellosis: An international collaborative survey. J Infect Dis 2002;186:127‑8. Zhan XY, Li LQ, Hu CH, Zhu QY. Two‑step scheme for rapid identification and differentiation of Legionella pneumophila and non‑Legionella pneumophila species. J Clin Microbiol 2010;48:433‑9. Agrawal L, Dhunjibhoy KR, Nair KG. Isolation of Legionella pneumophila from patients of respiratory tract disease and environmental samples. Indian J Med Res 1991;93:364‑5. Chaudhry R, Dhawan B, Dey AB. The incidence of Legionella pneumophila: A retrospective study in a tertiary care hospital in India. Trop Doct 2000;30:197‑200. Javed S, Chaudhry R, Passi K, Sharma S, K P, Dhawan B, et al. Sero diagnosis of Legionella infection in community acquired pneumonia. Indian J Med Res 2010;131:92‑6. Saidha S, Sotirchos ES, Eckstein C. Etiology of sarcoidosis: Does infection play a role? Yale J Biol Med 2012;85:133‑41. Fiumefreddo R, Zaborsky R, Haeuptle J, Crain MC, Trampuz A, Steffen I, et al. Clinical predictors for Legionella in patients presenting with community‑acquired pneumonia to the emergency department. BMC Pulm Med 2009;9:4.
Website: www.ijmm.org PMID: *** DOI: 10.4103/0255-0857.136590
How to cite this article: Chaudhry R, Valavane A, Mohan A, Dey AB. Legionella pneumophila infection associated with renal failure causing fatality in a known case of sarcoidosis. Indian J Med Microbiol 2014;32:324-7. Source of Support: Indian Council of Medical Research, Conflict of Interest: None declared.
Myroides odoratus and Chryseobacterium indologenes: Two rare isolates in the immunocompromised *R Deepa, KG Venkatesh, J Durdana Parveen, S Thasneem Banu, G Jayalakshmi
Abstract Myroides spp and Chryseobacterium spp are uncommon clinical isolates, though more frequently reported to cause infections than other pigmented non‑fermentors. Two cases of Myroides odoratus and Chryseobacterium indologenes infection in a diabetic with pulmonary tuberculosis and a patient with de‑compensated alcoholic liver disease, respectively, are reported here. Anti‑microbial susceptibility testing of the isolates was performed by determining the minimum inhibitory concentration. The clinical picture, characteristic features of the isolates and the antibiotic susceptibility pattern are discussed briefly. Key words: Chryseobacterium indologenes, myroides odoratus, minimum inhibitory concentration
www.ijmm.org
Copyright of Indian Journal of Medical Microbiology is the property of Medknow Publications & Media Pvt. Ltd. and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
