Talanta 139 (2015) 167–173
Contents lists available at ScienceDirect
Talanta journal homepage: www.elsevier.com/locate/talanta
Electrochemical genosensor assay using lyophilized gold nanoparticles/latex microsphere label for detection of Vibrio cholerae Liew Pei Shenga, Benchaporn Lertanantawong b,n, Lee Su Yina, Manickam Ravichandrana, Lee Yook Hengc, Werasak Surareungchai b,d a
Department of Biotechnology, Faculty of Applied Sciences, AIMST University, 08100 Semeling, Kedah, Malaysia Pilot Plant Development and Training Institute, King Mongkut's University of Technology Thonburi, Bangkhuntien-chaitalay Road, Thakam, Bangkok 10150, Thailand c School of Chemical Sciences and Food Technology, Faculty of Science and Technology, University Kebangsaan Malaysia, Bangi, Selangor 43600, Malaysia d School of Bioresources and Technology, King Mongkut's University of Technology Thonburi, Bangkhuntien-chaitalay Road, Thakam, Bangkok 10150, Thailand b
art ic l e i nf o
a b s t r a c t
Article history: Received 12 November 2014 Received in revised form 8 February 2015 Accepted 9 February 2015 Available online 6 March 2015
Vibrio cholerae is a Gram-negative bacterium that causes cholera, a diarrheal disease. Cholera is widespread in poor, under-developed or disaster-hit countries that have poor water sanitation. Hence, a rapid detection method for V. cholerae in the field under these resource-limited settings is required. In this paper, we describe the development of an electrochemical genosensor assay using lyophilized gold nanoparticles/latex microsphere (AuNPs–PSA) reporter label. The reporter label mixture was prepared by lyophilization of AuNPs–PSA–avidin conjugate with different types of stabilizers. The best stabilizer was 5% sorbitol, which was able to preserve the dried conjugate for up to 30 days. Three methods of DNA hybridization were compared and the one-step sandwich hybridization method was chosen as it was fastest and highly specific. The performance of the assay using the lyophilized reagents was comparable to the wet form for detection of 1 aM to 1 fM of linear target DNA. The assay was highly specific for V. cholerae, with a detection limit of 1 fM of PCR products. The ability of the sensor is to detect LAMP products as low as 50 ng ml 1. The novel lyophilized AuNPs–PSA–avidin reporter label with electrochemical genosensor detection could facilitate the rapid on-site detection of V. cholerae. & 2015 Elsevier B.V. All rights reserved.
Keywords: Cholera Vibrio cholerae Genosensor Gold nanoparticles Layer-by-layer modified latex Lyophilization PCR products LAMP
1. Introduction Vibrio cholerae is a highly motile Gram-negative bacterium that possess a single polar flagellum attached to its curved rod body [1]. This micro-size bacteria is the causative agent of cholera, which threatens millions of human lives every year [2]. It transmitted to human via contaminated drinking water, food or feces of infected persons. However, only V. cholerae serogroups O1 and O139 are identified as toxigenic species that cause epidemic outbreaks [1]. Affected persons may start to experience watery diarrheal at first. Sickness may become serious once severe dehydration and acidosis Abbreviations: Ag/AgCl, silver–silver chloride; AuNP, gold nanoparticles; PSA, polystyrene co-acrylic acid; BSA, bovine serum albumin; CP, capture probe; DPASV, differential pulse anodic stripping voltammetry; PAA, poly(allylamine) hydrochloride; PB, phosphate buffer; PCR, polymerase chain reaction; PSA, polystyreneco-acrylic acid; PSS, poly(sodium 4-styrene) sulfonate; Pt, platinum; RP, reporter probe; SPE, screen printed electrode; LAMP, loop mediated isothermal amplification n Corresponding author. E-mail address: [email protected] (B. Lertanantawong). http://dx.doi.org/10.1016/j.talanta.2015.02.054 0039-9140/& 2015 Elsevier B.V. All rights reserved.
occur and may cause death if no immediate treatment is given [2]. Other Vibrio species may cause mild diarrheal sickness. In order to effectively reduce morbidity and mortality arising from cholera outbreaks, early detection of this bacterium from contaminated sources is urgently required. Traditionally, laboratory diagnosis of V. cholerae is done based on culturing, raising of specific antibodies, enzyme-linked immunosorbent assay (ELISA), passive hemagglutination test or biochemical tests [1]. Molecular-based detection was discovered to be an improvement to traditional laboratory methods. Examples of molecular-based tests for V. cholerae include polymerase chain reaction (PCR) [3,4], loop mediated isothermal amplification (LAMP) [5,6], nucleic acid sequence-based amplification (NASBA) [7,8] and DNA microarray [9,10]. However, molecular-based tests are usually conducted in a laboratory setting and are often time-consuming. Trained personnel are required to perform and interpret the test results. In order to overcome these present difficulties, electrochemical-based method is found to be highly suitable due to its fast signal transduction, simplicity, portability and high sensitivity and selectivity [11–16].
168
P.S. Liew et al. / Talanta 139 (2015) 167–173
In this study, we describe the development of an electrochemical genosensor test using lyophilized gold nanoparticles/ latex microsphere (AuNPs–PSA) as reporter label for detection of pathogenic V. cholerae. This electrochemical genosensor platform, which uses AuNPs adsorbed on layer-by-layer modified latex, was previously shown to be highly sensitive [17,18]. However, the genosensor reagents, such as AuNPs–PSA–avidin-reporter probe conjugates require cold storage, which makes transportation of the test reagents problematic and unsuitable for prolonged use in the field. With this in mind, we have modified the existing genosensor platform to a novel lyophilized reagent-based test and evaluated its stability at room temperature. The performance of the assay using lyophilized reagent was tested with PCR products, which were amplified from genomic DNA of V. cholerae. Electrochemical measurement was performed using differential pulse anodic stripping voltammetry (DPASV). We also performed preliminary detection of loop mediated isothermal amplification (LAMP) products, with the aim of simplifying the amplification process using LAMP instead of PCR.
2. Materials and methods 2.1. Instruments Electrochemical measurements were carried out using an Autolab PGSTAT 10 computer-controlled potentiostat with GPES version 4.9 software (Eco Chemie, Netherlands). Transmission electron microscopy (TEM) was performed with a JEOL model JM-2100 (JEOL Ltd., Japan). Nucleic acid concentration was measured using a UV–visible spectrophotometer (DU8000 Beckman Coulter, USA). Disposable electrochemical screen-printed carbon electrodes (SPE) were obtained from Quasense Co. Ltd., Thailand, which consisted of two carbon tracks as working electrode, reference electrode and counter electrode in DPASV measurement. PCR was performed using a MyCycler thermal cycler (Bio-Rad, USA). Gel electrophoresis was performed in a Mini-Sub Cell GT System (Bio-Rad, USA) and the gel was viewed by a Gel Doc™ XRþ system (Bio-Rad, USA). Vacuum drying of genosensor reagents was done using CentriVap micro IR Vacuum Concentrators (LabConco, USA). 2.2. Materials Hydrogen tetrachloroaurate (HAuCl4 3H2O), avidin from egg white, poly(allylamine) hydrochloride (PAA, MW 56,000), poly (sodium 4-styrene) sulfonate (PSS, MW 70,000), D( þ)-Trehalose, bovine serum albumin (BSA), MgSO4, and betaine were purchased from Sigma-Aldrich, USA. Styrene and acrylic acid were purchased from Fluka, USA. Ammonium persulfate (APS) was purchased from Riedel-de Haën. D-(Sorbitol), hydrobromic acid (HBr) and bromine water (Br2) were purchased from R&M Chemicals, UK. D( þ)-Sucrose was purchased from QRëC, New Zealand. PCR reagents, DNA ladders, dNTPs and the genomic DNA purification kit were purchased from Fermentas, Lithuania. PCR purification kit was purchased from Promega, USA. Bst DNA polymerase was purchased from New England Biolabs, USA. Oligonucleotides and biotin-modified probes were synthesized by 1st BASE, Malaysia. The primer and probe sequences were designed based on the lolB gene of V. cholerae (GenBank accession number AF227752.1). LAMP primers were designed using primer Explorer version 4 software (http://primerexplorer.jp/elamp4.0.0/index. html). The primers and probes sequences are listed in Table 1.
Table 1 Sequences of primers and probes used in this study. The primer and probe sequences were designed based on the lolB gene of V. cholerae (GenBank accession number AF227752.1). Reporter probe sequence was modified with 10 adenine bases and a biotin moiety at the 3′ end. Blocking probe consisted of 10 adenine bases and a biotin moiety at the 3′ end. Name
Sequence (5′-3′)
Capture probe VCP_1 TCATCGACCTGTAAG Reporter probe VCRP_1- TTCAGCACGGTTTGAAAAAAAAAAA-Biotin Biotin Complementary linear target VCLT TCAAACCGTGCTGAACTTACAGGTCGATGA Non-complementary linear target NCLT GCCCAAACATCCATAGTACTGACATTTCGT Blocking probe VCBP AAAAAAAAAA-Biotin PCR forward primer VHMF TGGGAGCAGCGTCCATTGTG PCR reverse primer VHA-AS5 CTCACTGAACCACACTAACGG LAMP forward inner primer VC-FIP TGCGCGGGTCGAAACTTATGATAATTGCGGATCAGGCTTTGT LAMP backward inner primer VC-BIP TTGCTTAAACGCAGTGAGAGTCGTTCAACTTTCAATGGC LAMP forward primer VC-F3 TCAAGCTGTTCAACGGGAAT LAMP backward primer VC-B3 TTGCTTAAACGCAGTGAGAG
Length (-mer)
15 25
30 30 10 20 21 42 39 20 20
3. Methods 3.1. Preparation of SPE surface Preparation of the carbon SPE surface was done according to Guan et al. [18]. 1 mM of VCP_1 capture probe (Table 1) was immobilized onto a clean SPE by applying 0.1 V for 300 s. After 3 steps of washing with 0.1 M PB, blocking was performed with 0.2% w/v BSA for 20 min. The SPE was washed again with 0.1 M PB for 3 times and kept at 4 °C until use. 3.2. Preparation of AuNP–PSA–avidin conjugate Colloidal AuNPs were prepared by a Turkevich sodium citrate reduction method [19]. Layer-by-layer modification of latex or polystyrene-co-acrylic acid (PSA) with 500 nm diameter was performed as described by Pinijsuwan et al. [17]. The modified PSA solution was added into colloidal AuNPs at a ratio of 1:20 and allowed to incubate for 30 min. The AuNPs–PSA solution was filtered through 0.2 mm cellulose acetate membrane to remove the excess AuNPs. Next, 3 mg mL 1 of avidin (1:5 ratio) was added into the AuNPs–PSA solution and incubated at room temperature for 15 min under stirring condition followed by incubation at 4 °C for 5 min. The mixture was centrifuged at 6000 g for 15 min and washed with sterile 0.1 M phosphate buffer (pH 7.0) twice. The AuNPs–PSA–avidin conjugate was resuspended in 0.5 mL of 0.1 M phosphate buffer (pH 7.0). 3.3. Preparation of AuNPs–PSA–avidin conjugate in lyophilized form Four types of stabilizers were evaluated for preservation of the AuNPs–PSA–avidin conjugate in lyophilized form. The stabilizers and concentrations that were evaluated are sorbitol (1%, 5%, 10% w/v), sucrose (1%, 5%, 10% w/v), trehalose (1%, 5%, 10% w/v) and BSA (0.25%, 1%, 2% w/v). The AuNPs–PSA–avidin conjugates were mixed with the different concentrations of stabilizers in 0.5 ml tubes and vacuum dried for 4 h. AuNPs–PSA–avidin conjugates without added stabilizer
P.S. Liew et al. / Talanta 139 (2015) 167–173
were used as control. The tubes containing dried conjugate were kept in a sealed container with silica gel at room temperature (25–27 °C) for up to 30 days. 3.4. Rehydration of lyophilized AuNPs–PSA–avidin conjugate and functionalization with reporter probe The lyophilized conjugates were rehydrated with 45 mL of 5 SSPE buffer. Preparation of AuNPs–PSA–avidin-reporter probe conjugate was performed as described by Guan et al. [18]. 1 mM of each biotin-labeled reporter probe (VCRP–Biotin) and blocking probe (VCBP) were added into the AuNPs–PSA–avidin conjugate solution. The mixture was incubated for 2 h at 4 °C. The solution was centrifuged at 6000 g for 15 min, twice. The pellet was resuspended with 500 mL of 0.2% BSA as blocking agent, for 30 min. The solution was centrifuged at 6000 g for 15 min and the pellet was washed with 0.1 M phosphate buffer (PB), pH 7.0 for 3 times. Finally, the AuNPs–PSA–avidin-reporter probe conjugate was resuspended in 500 mL of 5 SSPE buffer [18].
169
surface was dried using N2 gas. For all 3 methods, electrochemical detection using DPASV was performed by applying 50 mL of acid detection medium (1 M HBr/0.1 mM Br2) to cover both working and reference electrodes of the SPE. All measurements were performed at room temperature in 4 replicates. An overview of the DNA hybridization procedures is depicted in Fig. 1.
3.6. Extraction of genomic DNA from isolated bacterial strains Seven V. cholerae and 12 non-V. cholerae isolated strains were used to evaluate the specificity of the assay. Single isolated colonies of bacterial strains were transferred from a pure culture plate into 5 mL Luria Bertani (LB) broth and incubated for 6 h at 37 °C. 1 mL of the broth culture was used for genomic DNA extraction using a NucleoSpins Tissue extraction kit (Macherey-Nagel, Germany), according to the manufacturer's protocol.
3.5. Hybridization with target DNA and electrochemical detection
3.7. PCR
Three DNA hybridization methods were tested: one-step, premix and step-by-step (sequential) sandwich hybridization [18]. Before hybridization, target DNA (synthetic linear target/PCR products/ LAMP products) was denatured by placing in a boiling water bath for 5 min and then immediately snap-cooled. In the premix method, target DNA was mixed with the AuNPs–PSA–avidin-reporter probe conjugate for 30 min before application onto the capture probeimmobilized SPE surface. In the one-step sandwich hybridization method, target DNA was mixed with the AuNPs–PSA–avidin-reporter probe conjugate and the solution was immediately pipetted onto the SPE for hybridization with the immobilized capture probe. For both methods, after application onto the SPE surface, hybridization was carried out for 30 min, followed by 3 washings with 0.1 M PB and finally the SPE surface was dried using N2 gas. In the step-by-step hybridization method, target DNA was applied onto the SPE for hybridization with the immobilized capture probe for 30 min, followed by 3 washings with 0.1 M PB. Then, the AuNPs–PSA–avidinreporter probe conjugate was pipetted onto the SPE and incubated for 30 min, followed by 3 washings with 0.1 M PB and the SPE
PCR amplification was performed as described by Lalitha et al. [20]. PCR was performed in 20 ml reaction volume containing nuclease-free water, 1 PCR buffer, 2.5 mM MgCl2; 0.16 mM dNTPs; 1 pmol ml 1 of forward primer VHMF, 1 pmol ml 1 of reverse primer VHA-AS5, 1.0 U Taq DNA polymerase and 100 ng genomic DNA. The PCR mixture was amplified in a thermal cycler using the following program: 1 cycle of initial denaturation step at 95 °C for 3 min, followed by 30 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s; one cycle at 60 °C for 30 s and finally one cycle at 72 °C for 5 min. PCR products were resolved using 1% w/v agarose gel electrophoresis containing ethidium bromide for 40 min at 100 V. The lolB gene-specific PCR amplicon was 517 bp. The concentration of PCR products was measured using spectrophotometry. Ten-fold serial dilutions of PCR products in 0.1 M PB (100 pM to 1 fM) were prepared to determine the sensitivity of the assay. PCR products containing 208 bp DNA sequence amplified from genomic DNA of Aphanomyces invadans [18] were used as non-complementary (NC) PCR products.
Fig. 1. Schematic diagram showing the rehydration of the lyophilized AuNPs–PSA–avidin conjugate and one-step DNA hybridization method followed by DPASV measurement on SPE.
170
P.S. Liew et al. / Talanta 139 (2015) 167–173
3.8. LAMP LAMP reaction was performed according to Okada et al. [21] with some modifications. Each LAMP reaction contains 1x of ThermoPol buffer, 0.5 mM dNTPs, 1.6 pmol ml 1 of each FIP and BIP primers, 0.2 pmol ml 1 of each F3 and B3 primers, 0.5 ml of 8 U Bst DNA polymerase, 2 mM MgSO4, 1 mM betaine and 100 ng genomic DNA. The LAMP reaction was incubated in a heated block maintained at 65 °C for 90 min. LAMP products were resolved using 1% w/v agarose gel electrophoresis containing ethidium bromide for 40 min at 100 V. Presence of ladder-like bands indicates positive LAMP reaction. The concentration of LAMP products was measured using spectrophotometry and subsequently was diluted with 0.1 M PB to final concentrations of 500, 100 and 50 ng ml 1 for hybridization and electrochemical detection.
at 30 min (Fig. S1). Hence, hybridization time of 30 min was used for the evaluation of the 3 hybridization methods. One-step, premix and step-by-step (sequential) sandwich hybridization methods were tested using 1 pM of complementary (VCLT) and 1 pM of non-complementary (NCLT) synthetic linear targets. For all 3 methods, the current signals from VCLT were at least 5 times higher than NCLT, indicating that the hybridization reaction was specific (Fig. S2). Previous works have reported the use of step-by-step [17] and pre-mix [18] hybridization methods for gold-nanoparticle based electrochemical DNA detection. By comparing the total time for each assay, one-step method took 30 min, step-by-step and premix methods both took 60 min to perform. Since one-step hybridization method was faster and the current response was specific, this method was chosen for subsequent experiments. 4.3. Optimization of electrochemical detection
4. Results and discussion 4.1. Synthesis of colloidal AuNPs and adsorption onto modified PSA During the synthesis of AuNPs, the color of the solution started changing once trisodium citrate dihydrate (Na3C6H5O7 2H2O) was added to the boiled hydrogen tetrachloroaurate (HAuCl4 3H2O). Trisodium citrate dihydrate acted as reducing agent to reduce gold ions (Au3 þ ) into gold atoms (Au0). Reduction of Au3 þ by excess citrate ions resulted in the formation of negatively charged colloidal AuNPs [22]. The color of the solution changed from colorless to blue, purple, purplish-red and lastly wine red. Characterization of the newly synthesized colloidal AuNPs was performed according to Guan et al. [18]. The absorbance of colloidal AuNPs solution at 520 nm indicated that the size of AuNPs was 13 nm in diameter [19,23]. Based on the density of Au at 19.3 g cm 3 [24] and the concentration of synthesized AuNPs at 0.25 mM, the amount of synthesized AuNPs in 1 mL of colloidal AuNPs solution was estimated as 4.92 10 5 g mL 1, or 2.22 1012 particles mL 1. Approximately 1460 AuNPs were adsorbed onto the layer-by-layer polyelectrolytes-coated latex [18,24]. 4.2. Comparison of DNA hybridization methods Optimization of the hybridization time between the SPE-immobilized capture probes with the target DNA–AuNPs–PSA–avidinreporter probe complex showed that the highest signal was obtained
For electrochemical detection using DPASV, the optimum deposition time and potential of AuNPs after hybridization of the target DNA–AuNPs–PSA–avidin-reporter probe complex to the SPE-immobilized capture probes were determined. A range of potential from 0.9 to 0.5 V was applied, and it was found that the optimal potential was 0.75 V (Fig. S3). The deposition time was varied from 10–270 s, and 25 s was found to give the highest signal (Fig. S4). Overall, total detection time of the assay is approximately 35–40 min (immobilization of capture probe: 300 s; one-step DNA hybridization: 30 min; DPASV: 25 s). Other conventional detection methods such as agarose gel electrophoresis may take approximately 35–40 min also. However, the method exposes users to carcinogenic chemicals, has lower sensitivity and specificity levels, and is not suitable for field-use, compared to electrochemical methods. 4.4. Evaluation of different stabilizers for preservation of AuNPs– PSA–avidin conjugate in lyophilized form The AuNPs–PSA–avidin conjugates are usually prepared in solution form (wet) and stored at 4 °C until use. However, to develop tests that are suitable for field use, it is desirable to have the reagents in lyophilized (dry) form, which would simplify its preparation, storage and usage in the field. Four different types of stabilizers, i.e. sorbitol, sucrose, trehalose and BSA, were evaluated for their effectiveness in preserving the lyophilized conjugate. The four highest signals were obtained with 5% trehalose and 1%, 5%, 10% sorbitol (Fig. 2). For further
Fig. 2. Evaluation of different stabilizers for preservation of lyophilized AuNPs–PSA–avidin conjugate. After storage at room temperature for 15 days, the lyophilized conjugate was rehydrated, tagged with the reporter probe and hybridized with 1 pM of linear target. The peak currents of the assay performed using wet AuNPs–PSA–avidin conjugate are shown in the first (hybridization with 1 pM non-complementary linear target, NCLT) and second bars (hybridization with 1 pM complementary linear target, VCLT). Dried AuNPs–PSA–avidin conjugate without stabilizer (0%) was used as control.
P.S. Liew et al. / Talanta 139 (2015) 167–173
stability study, 5% sorbitol was chosen as all three concentrations of sorbitol consistently gave high peak currents that were comparable to the result using wet AuNPs–PSA–avidin conjugate. The AuNPs–PSA–avidin conjugate was lyophilized with 5% sorbitol and stored up to 30 days at room temperature (Fig. 3). The peak current signals of the assay performed with lyophilized reagents stored for 15 (Day 15) and 30 (Day 30) days were almost similar to those at 0 day (at the start of the storage duration). This shows the lyophilized conjugate was stable for at least 30 days at room temperature.
171
The performance of lyophilized AuNPs–PSA–avidin conjugates with 5% sorbitol was also compared to those using non-lyophilized (wet preparation) AuNPs–PSA–avidin conjugates for detecting varying concentrations of linear target DNA from 1 aM to 1 pM (Fig. 4). For both lyophilized and wet reagent assays, the current responses were linear over the range of 1 aM to 1 pM target DNA, and similar values were obtained at the lower concentrations of target DNA for both assays. The correlation coefficient (r2) values for the lyophilized and wet reagent assays were 0.9553 and 0.9690, respectively. The relative standard deviation (RSD) of the assay performed with 1 pM target DNA is 7.36% (12 replicates). The limit of detection (LOD) of the lyophilized and wet reagent assays was 1 fM and 10 fM, respectively. These values were determined based on the threshold value of 3x the background signal of the non-complementary linear target DNA. In comparison, Pinijsuwan et al. [17] and Guan et al. [18] reported LOD of 0.5 fM linear target using wet reagent gold nanoparticle-based electrochemical detection, which was only slightly higher than this study's LOD using lyophilized AuNPs–PSA–avidin conjugates. Sugars, such as trehalose, sucrose and sorbitol, are commonly used as cryoprotectants for lyophilization of biomolecules [25,26] and nanoparticles [27–29]. The protective mechanism of these sugars is still not fully understood and several hypotheses had been proposed, i.e. the water replacement hypothesis, glass formation hypothesis and kosmotropic effect [25]. 4.5. Hybridization and electrochemical detection of PCR products
Fig. 3. Stability study of AuNPs–PSA–avidin conjugate lyophilized with 5% sorbitol and stored up to 30 days at room temperature. Immediately after lyophilisation (Day 0), after storage for 15 days (Day 15) and after 30 days (Day 30), the dried AuNPs–PSA–avidin conjugates were rehydrated, tagged with the reporter probe and hybridized with 1 pM of complementary (VCLT) / non-complementary (NCLT) linear targets.
PCR products of 5 V. cholerae and 12 non-V. cholerae strains were detected using agarose gel electrophoresis and electrochemical genosensor. The electrochemical genosensor method was based on the one-step DNA hybridization using the lyophilized reagents. All 5 V. cholerae strains showed DNA bands at the expected 519 bp on the agarose gel while no bands were observed with the non-V. cholerae strains. The result of electrochemical detection was concordant with agarose gel electrophoresis. Samples giving peak currents above 3x the signal of non-complementary linear target DNA were considered
Fig. 4. Comparison of the performance of AuNPs–PSA–avidin conjugates in lyophilized and wet reagent forms for detection of varying concentrations of linear target DNA, VCLT (1 aM to 1 pM). The voltammograms for dry (inset A) and wet (inset B) reagent forms are also shown.
172
P.S. Liew et al. / Talanta 139 (2015) 167–173
positive. The signals from all 5 V. cholerae strains were higher than the threshold value, while all of the non-V. cholerae strains yielded signals that were lower than the threshold value (Fig. 5). The results show the assay was highly specific. Different concentrations of PCR products ranging from 100 pM to 1 fM were also tested (Fig. S5). The LOD of the assay was 1 fM, based on the threshold value set at 3x the signal of 1 pM non-complementary PCR products. This LOD is an improvement over previously reported electrochemical detection of V. cholerae with detection limits of 61 pM of PCR products [30] and 3.9 nM of 200-mer synthetic target DNA [31]. It is also good to note that the LOD is comparable to our previous work using an electrochemical genosensor technique (but with wet reagents) to detect the fish pathogen, A. invadans [18]. This shows that the electrochemical genosensor assay could be used as a common platform for detection of various organisms of interest. In this line, the lyophilized AuNPs–PSA–avidin conjugate could be used as a universal reporter label for detection of various organisms by just changing the sequences of the reporter probe. This will greatly facilitate the preparation, storage and usage of the assay. A table of comparison of the different electrochemical DNA hybridization methods using DPV in the literature is presented as Table 2. 4.6. Hybridization and electrochemical detection of LAMP products Three concentrations of LAMP products (500, 100 and 50 ng ml 1) were tested using the lyophilized AuNPs–PSA–avidin conjugates (Fig. 5). This preliminary result showed that LAMP amplification
could be used to replace PCR, as LAMP has several advantages. Amplification of target DNA using LAMP could be performed using a single temperature at 65 °C, which is an advantage over PCR that requires thermal cycling. The LAMP reaction can be performed using a simple water bath or heating block. Detection of the LAMP products using the lyophilized reagent electrochemical genosensor would make the test suitable for field use. This, however, would require further optimization and evaluation of a LAMP-based electrochemical detection method, which is our future aim. Similar electrochemical detection using differential pulse voltammetry (DPV) have been reported with other microorganisms [32,33]. Recently, a multiplex detection of LAMP products of rtxA and toxR genes of V. cholerae using a microfluidic chip-based fluorescence assay was successfully performed [34]. In this study, the gene target of both PCR and LAMP assays was the lolB gene of V. cholerae, which is a non-virulence gene. The lolB gene, which encodes for outer membrane lipoprotein of V. cholerae, is highly conserved in all serogroups and biotypes of V. cholerae, including the non-O1, non-O139 serogroup [20]. This study focused on the use of a non-virulence gene such as lolB as it is able to detect certain non-toxigenic V. cholerae strains of the serogroup non-O1, non-O139 that is often found in environmental samples, and were reported to cause sporadic and localized diarrheal outbreaks [35–38]. Current PCR assays based on non-virulence genes were not very specific as the target gene sequence varied among certain V. cholerae strains [39] or had not been tested on clinical samples [4].
Fig. 5. Electrochemical detection of PCR and LAMP products from V. cholerae and non-V. cholerae strains. Samples giving peak currents above 3x the signal of non-complementary linear target (1 pM NC) were considered positive.
Table 2 Comparison of the different electrochemical DNA hybridization methods using DPV in the literature. Label/sensing signal
Target/gene/organism
Detection products
Detection limit
Reference
DNA/methylene blue Methylene Blue anti-fluorescein-alkaline phosphatase (anti-FITC–ALP) MNP–DNA–AuNP/α-FITC DNA–AuNP/latex DNA–AuNP/latex DNA–AuNP/latex
Ochratoxin A Y. enterocoliticia V. cholerae lolB gene, V. cholerae Aphanomyces invadans lolB gene, V. cholerae lolB gene, V. cholerae
LAMP LAMP LATE-PCR 200-mer Synthetic target PCR 519 bp PCR LAMP
0.3 pM 5 mM 8–61 pM 3.9 nM 1 fM 1 fM 50 ng mL 1
[32] [33] [30] [31] [18] This work This work
MNP, magnetic nanoparticle; FITC, Fluorescein isothiocyanate; ALP, Alkaline Phosphatase.
P.S. Liew et al. / Talanta 139 (2015) 167–173
5. Conclusion In summary, we have developed a lyophilized reagent-based electrochemical genosensor assay for the detection of V. cholerae. The AuNPs–PSA–avidin conjugate, which was lyophilized with 5% sorbitol, was stable for up to 30 days at room temperature. The LOD of the assay is 1 fM of PCR products. The genosensor was also able to detect LAMP products as low as 50 ng ml 1. The novel lyophilized AuNPs–PSA–avidin reporter label in combination with electrochemical genosensor detection could be used for rapid detection of V. cholerae on site, either from real samples in the environment or clinical settings. In addition, this assay platform that is based on lyophilized universal reporter label, could also be used to develop electrochemical genosensor assays for other organisms.
Acknowledgement The authors are thankful to the Ministry of Science, Technology and Innovation, Malaysia for the E-Science Fund Grant (02-01-02SF0821) and Thailand's Office of Higher Education Commission for the National Research University Project (grant number: NRU55000667), which supported this study.
Appendix A. Supplementary material Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.talanta.2015.02. 054.
References [1] R.A. Finkelstein, in: S. Baron (Ed.), Medical Microbiology, 4th ed.,University of Texas Medical Branch at Galveston, Galveston (TX), 1996. [2] WHO | Cholera, in: WHO, 〈http://www.who.int/mediacentre/factsheets/fs107/ en/〉, (accessed 13.02.14). [3] S. Preeprem, P. Mittraparp-Arthorn, P. Bhoopong, V. Vuddhakul, Foodborne Pathog. Dis. 11 (2014) 881. [4] A. Di Pinto, G. Ciccarese, G. Tantillo, D. Catalano, V.T. Forte, J. Food Prot. 68 (2005) 150. [5] K.W. Soli, M. Kas, T. Maure, M. Umezaki, A. Morita, P.M. Siba, A.R. Greenhill, P.F. Horwood, Diagn. Microbiol. Infect. Dis. 77 (2013) 321. [6] C. Srisuk, P. Chaivisuthangkura, S. Rukpratanporn, S. Longyant, P. Sridulyakul, P. Sithigorngul, Lett. Appl. Microbiol. 50 (2010) 36.
173
[7] E.M. Fykse, T. Nilsen, A.D. Nielsen, I. Tryland, S. Delacroix, J.M. Blatny, Mar. Pollut. Bull. 64 (2012) 200. [8] E.M. Fykse, G. Skogan, W. Davies, J.S. Olsen, J.M. Blatny, Appl. Environ. Microbiol. 73 (2007) 1457. [9] C.M. Soto, A.S. Blum, G.J. Vora, N. Lebedev, C.E. Meador, A.P. Won, A. Chatterji, J.E. Johnson, B.R. Ratna, J. Am. Chem. Soc. 128 (2006) 5184. [10] D.-Z. Jin, X.-J. Xu, S.-H. Chen, S.-Y. Wen, X.-E. Ma, Z. Zhang, F. Lin, S.-Q. Wang, Infect. Agent. Cancer 2 (2007) 23. [11] M.J. Schöning, A. Poghossian, Analyst 127 (2002) 1137. [12] T.G. Drummond, M.G. Hill, J.K. Barton, Nat. Biotechnol. 21 (2003) 1192. [13] D. Grieshaber, R. MacKenzie, J. Vörös, E. Reimhult, Sensors 8 (2008) 1400. [14] N.J. Ronkainen, H.B. Halsall, W.R. Heineman, Chem. Soc. Rev. 39 (2010) 1747. [15] E.G. Hvastkovs, D.A. Buttry, Analyst 135 (2010) 1817. [16] A.P.F. Turner, Chem. Soc. Rev. 42 (2013) 3184. [17] S. Pinijsuwan, P. Rijiravanich, M. Somasundrum, W. Surareungchai, Anal. Chem. 80 (2008) 6779. [18] Guan Chin Kuan, Liew Pei Sheng, Patsamon Rijiravanich, Kasi Marimuthu, Manickam Ravichandran, Lee Su Yin, Benchaporn Lertanantawong, Werasak Surareungchai, Talanta 117 (2013) 312. [19] J. Turkevich, P.C. Stevenson, J. Hillier, Discuss. Faraday Soc. 11 (1951) 55. [20] P. Lalitha, M.N. Siti Suraiya, K.L. Lim, S.Y. Lee, A.R. Nur Haslindawaty, Y.Y. Chan, A. Ismail, Z.F. Zainuddin, M. Ravichandran, J. Microbiol. Methods 75 (2008) 142. [21] K. Okada, S. Chantaroj, T. Taniguchi, Y. Suzuki, A. Roobthaisong, O. Puiprom, T. Honda, P. Sawanpanyalert, Diagn. Microbiol. Infect. Dis. 66 (2010) 135. [22] D.A. Weitz, M.Y. Lin, C.J. Sandroff, Surf. Sci. 158 (1985) 147. [23] K.C. Grabar, R.G. Freeman, M.B. Hommer, M.J. Natan, Anal. Chem. 67 (1995) 735. [24] F. Tang, H. Tanhnoto, S. Okuda, Nanostruct. Mater. 6 (1995) 563. [25] D. Christensen, D. Kirby, C. Foged, E.M. Agger, P. Andersen, Y. Perrie, H.M. Nielsen, Biochim. Biophys. Acta 1778 (2008) 1365. [26] N. Jovanović, A. Bouchard, G.W. Hofland, G.-J. Witkamp, D.J.A. Crommelin, W. Jiskoot, Eur. J. Pharm. Sci. 27 (2006) 336. [27] S. Doktorovova, R. Shegokar, L. Fernandes, P. Martins-Lopes, A.M. Silva, R.H. Müller, E.B. Souto, Pharm. Dev. Technol. 19 (2014) 922. [28] P. Fonte, S. Soares, F. Sousa, A. Costa, V. Seabra, S. Reis, B. Sarmento, Biomacromolecules 15 (2014) 3753. [29] R.K. Barman, Y. Iwao, Y. Funakoshi, A.-H. Ranneh, S. Noguchi, M.I.I. Wahed, S. Itai, Chem. Pharm. Bull. 62 (2014) 399. [30] C.Y. Yu, G.Y. Ang, C.Y. Yean, Chem. Commun. 49 (2013) 2019. [31] K.-F. Low, A. Karimah, C.Y. Yean, Biosens. Bioelectron. 47 (2013) 38. [32] S. Xie, Y. Chai, Y. Yuan, L. Bai, R. Yuan, Biosens. Bioelectron. 55 (2014) 324. [33] W. Sun, P. Qin, H. Gao, G. Li, K. Jiao, Biosens. Bioelectron. 25 (2010) 1264. [34] D.M. Tourlousse, F. Ahmad, R.D. Stedtfeld, G. Seyrig, J.M. Tiedje, S.A. Hashsham, Biomed. Microdevices 14 (2012) 769. [35] A. Garrido-Maestu, M.-J. Chapela, J.M. Vieites, A.G. Cabado, Food Microbiol. 46 (2015) 535. [36] M.S. Cho, J. Microbiol. Biotechnol. 23 (2013) 555. [37] J.M. Vital Brazil, R.M. Alves, I.N.G. Rivera, D.P. Rodrigues, D.K.R. Karaolis, L.C. Campos, FEMS Microbiol. Lett. 215 (2002) 15. [38] A. Fasano, J.В Kaper, M. Trucksis, in: I.K. Wachsmuth, Ø. Olsvik, P.A. Blake (Eds.), Vibrio Cholerae Cholera, American Society of Microbiology, Washington DC, 1994, pp. 145–176. [39] B. Nandi, R.K. Nandy, S. Mukhopadhyay, G.B. Nair, T. Shimada, A.C. Ghose, J. Clin. Microbiol. 38 (2000) 4145.
Contents lists available at ScienceDirect
Talanta journal homepage: www.elsevier.com/locate/talanta
Electrochemical genosensor assay using lyophilized gold nanoparticles/latex microsphere label for detection of Vibrio cholerae Liew Pei Shenga, Benchaporn Lertanantawong b,n, Lee Su Yina, Manickam Ravichandrana, Lee Yook Hengc, Werasak Surareungchai b,d a
Department of Biotechnology, Faculty of Applied Sciences, AIMST University, 08100 Semeling, Kedah, Malaysia Pilot Plant Development and Training Institute, King Mongkut's University of Technology Thonburi, Bangkhuntien-chaitalay Road, Thakam, Bangkok 10150, Thailand c School of Chemical Sciences and Food Technology, Faculty of Science and Technology, University Kebangsaan Malaysia, Bangi, Selangor 43600, Malaysia d School of Bioresources and Technology, King Mongkut's University of Technology Thonburi, Bangkhuntien-chaitalay Road, Thakam, Bangkok 10150, Thailand b
art ic l e i nf o
a b s t r a c t
Article history: Received 12 November 2014 Received in revised form 8 February 2015 Accepted 9 February 2015 Available online 6 March 2015
Vibrio cholerae is a Gram-negative bacterium that causes cholera, a diarrheal disease. Cholera is widespread in poor, under-developed or disaster-hit countries that have poor water sanitation. Hence, a rapid detection method for V. cholerae in the field under these resource-limited settings is required. In this paper, we describe the development of an electrochemical genosensor assay using lyophilized gold nanoparticles/latex microsphere (AuNPs–PSA) reporter label. The reporter label mixture was prepared by lyophilization of AuNPs–PSA–avidin conjugate with different types of stabilizers. The best stabilizer was 5% sorbitol, which was able to preserve the dried conjugate for up to 30 days. Three methods of DNA hybridization were compared and the one-step sandwich hybridization method was chosen as it was fastest and highly specific. The performance of the assay using the lyophilized reagents was comparable to the wet form for detection of 1 aM to 1 fM of linear target DNA. The assay was highly specific for V. cholerae, with a detection limit of 1 fM of PCR products. The ability of the sensor is to detect LAMP products as low as 50 ng ml 1. The novel lyophilized AuNPs–PSA–avidin reporter label with electrochemical genosensor detection could facilitate the rapid on-site detection of V. cholerae. & 2015 Elsevier B.V. All rights reserved.
Keywords: Cholera Vibrio cholerae Genosensor Gold nanoparticles Layer-by-layer modified latex Lyophilization PCR products LAMP
1. Introduction Vibrio cholerae is a highly motile Gram-negative bacterium that possess a single polar flagellum attached to its curved rod body [1]. This micro-size bacteria is the causative agent of cholera, which threatens millions of human lives every year [2]. It transmitted to human via contaminated drinking water, food or feces of infected persons. However, only V. cholerae serogroups O1 and O139 are identified as toxigenic species that cause epidemic outbreaks [1]. Affected persons may start to experience watery diarrheal at first. Sickness may become serious once severe dehydration and acidosis Abbreviations: Ag/AgCl, silver–silver chloride; AuNP, gold nanoparticles; PSA, polystyrene co-acrylic acid; BSA, bovine serum albumin; CP, capture probe; DPASV, differential pulse anodic stripping voltammetry; PAA, poly(allylamine) hydrochloride; PB, phosphate buffer; PCR, polymerase chain reaction; PSA, polystyreneco-acrylic acid; PSS, poly(sodium 4-styrene) sulfonate; Pt, platinum; RP, reporter probe; SPE, screen printed electrode; LAMP, loop mediated isothermal amplification n Corresponding author. E-mail address: [email protected] (B. Lertanantawong). http://dx.doi.org/10.1016/j.talanta.2015.02.054 0039-9140/& 2015 Elsevier B.V. All rights reserved.
occur and may cause death if no immediate treatment is given [2]. Other Vibrio species may cause mild diarrheal sickness. In order to effectively reduce morbidity and mortality arising from cholera outbreaks, early detection of this bacterium from contaminated sources is urgently required. Traditionally, laboratory diagnosis of V. cholerae is done based on culturing, raising of specific antibodies, enzyme-linked immunosorbent assay (ELISA), passive hemagglutination test or biochemical tests [1]. Molecular-based detection was discovered to be an improvement to traditional laboratory methods. Examples of molecular-based tests for V. cholerae include polymerase chain reaction (PCR) [3,4], loop mediated isothermal amplification (LAMP) [5,6], nucleic acid sequence-based amplification (NASBA) [7,8] and DNA microarray [9,10]. However, molecular-based tests are usually conducted in a laboratory setting and are often time-consuming. Trained personnel are required to perform and interpret the test results. In order to overcome these present difficulties, electrochemical-based method is found to be highly suitable due to its fast signal transduction, simplicity, portability and high sensitivity and selectivity [11–16].
168
P.S. Liew et al. / Talanta 139 (2015) 167–173
In this study, we describe the development of an electrochemical genosensor test using lyophilized gold nanoparticles/ latex microsphere (AuNPs–PSA) as reporter label for detection of pathogenic V. cholerae. This electrochemical genosensor platform, which uses AuNPs adsorbed on layer-by-layer modified latex, was previously shown to be highly sensitive [17,18]. However, the genosensor reagents, such as AuNPs–PSA–avidin-reporter probe conjugates require cold storage, which makes transportation of the test reagents problematic and unsuitable for prolonged use in the field. With this in mind, we have modified the existing genosensor platform to a novel lyophilized reagent-based test and evaluated its stability at room temperature. The performance of the assay using lyophilized reagent was tested with PCR products, which were amplified from genomic DNA of V. cholerae. Electrochemical measurement was performed using differential pulse anodic stripping voltammetry (DPASV). We also performed preliminary detection of loop mediated isothermal amplification (LAMP) products, with the aim of simplifying the amplification process using LAMP instead of PCR.
2. Materials and methods 2.1. Instruments Electrochemical measurements were carried out using an Autolab PGSTAT 10 computer-controlled potentiostat with GPES version 4.9 software (Eco Chemie, Netherlands). Transmission electron microscopy (TEM) was performed with a JEOL model JM-2100 (JEOL Ltd., Japan). Nucleic acid concentration was measured using a UV–visible spectrophotometer (DU8000 Beckman Coulter, USA). Disposable electrochemical screen-printed carbon electrodes (SPE) were obtained from Quasense Co. Ltd., Thailand, which consisted of two carbon tracks as working electrode, reference electrode and counter electrode in DPASV measurement. PCR was performed using a MyCycler thermal cycler (Bio-Rad, USA). Gel electrophoresis was performed in a Mini-Sub Cell GT System (Bio-Rad, USA) and the gel was viewed by a Gel Doc™ XRþ system (Bio-Rad, USA). Vacuum drying of genosensor reagents was done using CentriVap micro IR Vacuum Concentrators (LabConco, USA). 2.2. Materials Hydrogen tetrachloroaurate (HAuCl4 3H2O), avidin from egg white, poly(allylamine) hydrochloride (PAA, MW 56,000), poly (sodium 4-styrene) sulfonate (PSS, MW 70,000), D( þ)-Trehalose, bovine serum albumin (BSA), MgSO4, and betaine were purchased from Sigma-Aldrich, USA. Styrene and acrylic acid were purchased from Fluka, USA. Ammonium persulfate (APS) was purchased from Riedel-de Haën. D-(Sorbitol), hydrobromic acid (HBr) and bromine water (Br2) were purchased from R&M Chemicals, UK. D( þ)-Sucrose was purchased from QRëC, New Zealand. PCR reagents, DNA ladders, dNTPs and the genomic DNA purification kit were purchased from Fermentas, Lithuania. PCR purification kit was purchased from Promega, USA. Bst DNA polymerase was purchased from New England Biolabs, USA. Oligonucleotides and biotin-modified probes were synthesized by 1st BASE, Malaysia. The primer and probe sequences were designed based on the lolB gene of V. cholerae (GenBank accession number AF227752.1). LAMP primers were designed using primer Explorer version 4 software (http://primerexplorer.jp/elamp4.0.0/index. html). The primers and probes sequences are listed in Table 1.
Table 1 Sequences of primers and probes used in this study. The primer and probe sequences were designed based on the lolB gene of V. cholerae (GenBank accession number AF227752.1). Reporter probe sequence was modified with 10 adenine bases and a biotin moiety at the 3′ end. Blocking probe consisted of 10 adenine bases and a biotin moiety at the 3′ end. Name
Sequence (5′-3′)
Capture probe VCP_1 TCATCGACCTGTAAG Reporter probe VCRP_1- TTCAGCACGGTTTGAAAAAAAAAAA-Biotin Biotin Complementary linear target VCLT TCAAACCGTGCTGAACTTACAGGTCGATGA Non-complementary linear target NCLT GCCCAAACATCCATAGTACTGACATTTCGT Blocking probe VCBP AAAAAAAAAA-Biotin PCR forward primer VHMF TGGGAGCAGCGTCCATTGTG PCR reverse primer VHA-AS5 CTCACTGAACCACACTAACGG LAMP forward inner primer VC-FIP TGCGCGGGTCGAAACTTATGATAATTGCGGATCAGGCTTTGT LAMP backward inner primer VC-BIP TTGCTTAAACGCAGTGAGAGTCGTTCAACTTTCAATGGC LAMP forward primer VC-F3 TCAAGCTGTTCAACGGGAAT LAMP backward primer VC-B3 TTGCTTAAACGCAGTGAGAG
Length (-mer)
15 25
30 30 10 20 21 42 39 20 20
3. Methods 3.1. Preparation of SPE surface Preparation of the carbon SPE surface was done according to Guan et al. [18]. 1 mM of VCP_1 capture probe (Table 1) was immobilized onto a clean SPE by applying 0.1 V for 300 s. After 3 steps of washing with 0.1 M PB, blocking was performed with 0.2% w/v BSA for 20 min. The SPE was washed again with 0.1 M PB for 3 times and kept at 4 °C until use. 3.2. Preparation of AuNP–PSA–avidin conjugate Colloidal AuNPs were prepared by a Turkevich sodium citrate reduction method [19]. Layer-by-layer modification of latex or polystyrene-co-acrylic acid (PSA) with 500 nm diameter was performed as described by Pinijsuwan et al. [17]. The modified PSA solution was added into colloidal AuNPs at a ratio of 1:20 and allowed to incubate for 30 min. The AuNPs–PSA solution was filtered through 0.2 mm cellulose acetate membrane to remove the excess AuNPs. Next, 3 mg mL 1 of avidin (1:5 ratio) was added into the AuNPs–PSA solution and incubated at room temperature for 15 min under stirring condition followed by incubation at 4 °C for 5 min. The mixture was centrifuged at 6000 g for 15 min and washed with sterile 0.1 M phosphate buffer (pH 7.0) twice. The AuNPs–PSA–avidin conjugate was resuspended in 0.5 mL of 0.1 M phosphate buffer (pH 7.0). 3.3. Preparation of AuNPs–PSA–avidin conjugate in lyophilized form Four types of stabilizers were evaluated for preservation of the AuNPs–PSA–avidin conjugate in lyophilized form. The stabilizers and concentrations that were evaluated are sorbitol (1%, 5%, 10% w/v), sucrose (1%, 5%, 10% w/v), trehalose (1%, 5%, 10% w/v) and BSA (0.25%, 1%, 2% w/v). The AuNPs–PSA–avidin conjugates were mixed with the different concentrations of stabilizers in 0.5 ml tubes and vacuum dried for 4 h. AuNPs–PSA–avidin conjugates without added stabilizer
P.S. Liew et al. / Talanta 139 (2015) 167–173
were used as control. The tubes containing dried conjugate were kept in a sealed container with silica gel at room temperature (25–27 °C) for up to 30 days. 3.4. Rehydration of lyophilized AuNPs–PSA–avidin conjugate and functionalization with reporter probe The lyophilized conjugates were rehydrated with 45 mL of 5 SSPE buffer. Preparation of AuNPs–PSA–avidin-reporter probe conjugate was performed as described by Guan et al. [18]. 1 mM of each biotin-labeled reporter probe (VCRP–Biotin) and blocking probe (VCBP) were added into the AuNPs–PSA–avidin conjugate solution. The mixture was incubated for 2 h at 4 °C. The solution was centrifuged at 6000 g for 15 min, twice. The pellet was resuspended with 500 mL of 0.2% BSA as blocking agent, for 30 min. The solution was centrifuged at 6000 g for 15 min and the pellet was washed with 0.1 M phosphate buffer (PB), pH 7.0 for 3 times. Finally, the AuNPs–PSA–avidin-reporter probe conjugate was resuspended in 500 mL of 5 SSPE buffer [18].
169
surface was dried using N2 gas. For all 3 methods, electrochemical detection using DPASV was performed by applying 50 mL of acid detection medium (1 M HBr/0.1 mM Br2) to cover both working and reference electrodes of the SPE. All measurements were performed at room temperature in 4 replicates. An overview of the DNA hybridization procedures is depicted in Fig. 1.
3.6. Extraction of genomic DNA from isolated bacterial strains Seven V. cholerae and 12 non-V. cholerae isolated strains were used to evaluate the specificity of the assay. Single isolated colonies of bacterial strains were transferred from a pure culture plate into 5 mL Luria Bertani (LB) broth and incubated for 6 h at 37 °C. 1 mL of the broth culture was used for genomic DNA extraction using a NucleoSpins Tissue extraction kit (Macherey-Nagel, Germany), according to the manufacturer's protocol.
3.5. Hybridization with target DNA and electrochemical detection
3.7. PCR
Three DNA hybridization methods were tested: one-step, premix and step-by-step (sequential) sandwich hybridization [18]. Before hybridization, target DNA (synthetic linear target/PCR products/ LAMP products) was denatured by placing in a boiling water bath for 5 min and then immediately snap-cooled. In the premix method, target DNA was mixed with the AuNPs–PSA–avidin-reporter probe conjugate for 30 min before application onto the capture probeimmobilized SPE surface. In the one-step sandwich hybridization method, target DNA was mixed with the AuNPs–PSA–avidin-reporter probe conjugate and the solution was immediately pipetted onto the SPE for hybridization with the immobilized capture probe. For both methods, after application onto the SPE surface, hybridization was carried out for 30 min, followed by 3 washings with 0.1 M PB and finally the SPE surface was dried using N2 gas. In the step-by-step hybridization method, target DNA was applied onto the SPE for hybridization with the immobilized capture probe for 30 min, followed by 3 washings with 0.1 M PB. Then, the AuNPs–PSA–avidinreporter probe conjugate was pipetted onto the SPE and incubated for 30 min, followed by 3 washings with 0.1 M PB and the SPE
PCR amplification was performed as described by Lalitha et al. [20]. PCR was performed in 20 ml reaction volume containing nuclease-free water, 1 PCR buffer, 2.5 mM MgCl2; 0.16 mM dNTPs; 1 pmol ml 1 of forward primer VHMF, 1 pmol ml 1 of reverse primer VHA-AS5, 1.0 U Taq DNA polymerase and 100 ng genomic DNA. The PCR mixture was amplified in a thermal cycler using the following program: 1 cycle of initial denaturation step at 95 °C for 3 min, followed by 30 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s; one cycle at 60 °C for 30 s and finally one cycle at 72 °C for 5 min. PCR products were resolved using 1% w/v agarose gel electrophoresis containing ethidium bromide for 40 min at 100 V. The lolB gene-specific PCR amplicon was 517 bp. The concentration of PCR products was measured using spectrophotometry. Ten-fold serial dilutions of PCR products in 0.1 M PB (100 pM to 1 fM) were prepared to determine the sensitivity of the assay. PCR products containing 208 bp DNA sequence amplified from genomic DNA of Aphanomyces invadans [18] were used as non-complementary (NC) PCR products.
Fig. 1. Schematic diagram showing the rehydration of the lyophilized AuNPs–PSA–avidin conjugate and one-step DNA hybridization method followed by DPASV measurement on SPE.
170
P.S. Liew et al. / Talanta 139 (2015) 167–173
3.8. LAMP LAMP reaction was performed according to Okada et al. [21] with some modifications. Each LAMP reaction contains 1x of ThermoPol buffer, 0.5 mM dNTPs, 1.6 pmol ml 1 of each FIP and BIP primers, 0.2 pmol ml 1 of each F3 and B3 primers, 0.5 ml of 8 U Bst DNA polymerase, 2 mM MgSO4, 1 mM betaine and 100 ng genomic DNA. The LAMP reaction was incubated in a heated block maintained at 65 °C for 90 min. LAMP products were resolved using 1% w/v agarose gel electrophoresis containing ethidium bromide for 40 min at 100 V. Presence of ladder-like bands indicates positive LAMP reaction. The concentration of LAMP products was measured using spectrophotometry and subsequently was diluted with 0.1 M PB to final concentrations of 500, 100 and 50 ng ml 1 for hybridization and electrochemical detection.
at 30 min (Fig. S1). Hence, hybridization time of 30 min was used for the evaluation of the 3 hybridization methods. One-step, premix and step-by-step (sequential) sandwich hybridization methods were tested using 1 pM of complementary (VCLT) and 1 pM of non-complementary (NCLT) synthetic linear targets. For all 3 methods, the current signals from VCLT were at least 5 times higher than NCLT, indicating that the hybridization reaction was specific (Fig. S2). Previous works have reported the use of step-by-step [17] and pre-mix [18] hybridization methods for gold-nanoparticle based electrochemical DNA detection. By comparing the total time for each assay, one-step method took 30 min, step-by-step and premix methods both took 60 min to perform. Since one-step hybridization method was faster and the current response was specific, this method was chosen for subsequent experiments. 4.3. Optimization of electrochemical detection
4. Results and discussion 4.1. Synthesis of colloidal AuNPs and adsorption onto modified PSA During the synthesis of AuNPs, the color of the solution started changing once trisodium citrate dihydrate (Na3C6H5O7 2H2O) was added to the boiled hydrogen tetrachloroaurate (HAuCl4 3H2O). Trisodium citrate dihydrate acted as reducing agent to reduce gold ions (Au3 þ ) into gold atoms (Au0). Reduction of Au3 þ by excess citrate ions resulted in the formation of negatively charged colloidal AuNPs [22]. The color of the solution changed from colorless to blue, purple, purplish-red and lastly wine red. Characterization of the newly synthesized colloidal AuNPs was performed according to Guan et al. [18]. The absorbance of colloidal AuNPs solution at 520 nm indicated that the size of AuNPs was 13 nm in diameter [19,23]. Based on the density of Au at 19.3 g cm 3 [24] and the concentration of synthesized AuNPs at 0.25 mM, the amount of synthesized AuNPs in 1 mL of colloidal AuNPs solution was estimated as 4.92 10 5 g mL 1, or 2.22 1012 particles mL 1. Approximately 1460 AuNPs were adsorbed onto the layer-by-layer polyelectrolytes-coated latex [18,24]. 4.2. Comparison of DNA hybridization methods Optimization of the hybridization time between the SPE-immobilized capture probes with the target DNA–AuNPs–PSA–avidinreporter probe complex showed that the highest signal was obtained
For electrochemical detection using DPASV, the optimum deposition time and potential of AuNPs after hybridization of the target DNA–AuNPs–PSA–avidin-reporter probe complex to the SPE-immobilized capture probes were determined. A range of potential from 0.9 to 0.5 V was applied, and it was found that the optimal potential was 0.75 V (Fig. S3). The deposition time was varied from 10–270 s, and 25 s was found to give the highest signal (Fig. S4). Overall, total detection time of the assay is approximately 35–40 min (immobilization of capture probe: 300 s; one-step DNA hybridization: 30 min; DPASV: 25 s). Other conventional detection methods such as agarose gel electrophoresis may take approximately 35–40 min also. However, the method exposes users to carcinogenic chemicals, has lower sensitivity and specificity levels, and is not suitable for field-use, compared to electrochemical methods. 4.4. Evaluation of different stabilizers for preservation of AuNPs– PSA–avidin conjugate in lyophilized form The AuNPs–PSA–avidin conjugates are usually prepared in solution form (wet) and stored at 4 °C until use. However, to develop tests that are suitable for field use, it is desirable to have the reagents in lyophilized (dry) form, which would simplify its preparation, storage and usage in the field. Four different types of stabilizers, i.e. sorbitol, sucrose, trehalose and BSA, were evaluated for their effectiveness in preserving the lyophilized conjugate. The four highest signals were obtained with 5% trehalose and 1%, 5%, 10% sorbitol (Fig. 2). For further
Fig. 2. Evaluation of different stabilizers for preservation of lyophilized AuNPs–PSA–avidin conjugate. After storage at room temperature for 15 days, the lyophilized conjugate was rehydrated, tagged with the reporter probe and hybridized with 1 pM of linear target. The peak currents of the assay performed using wet AuNPs–PSA–avidin conjugate are shown in the first (hybridization with 1 pM non-complementary linear target, NCLT) and second bars (hybridization with 1 pM complementary linear target, VCLT). Dried AuNPs–PSA–avidin conjugate without stabilizer (0%) was used as control.
P.S. Liew et al. / Talanta 139 (2015) 167–173
stability study, 5% sorbitol was chosen as all three concentrations of sorbitol consistently gave high peak currents that were comparable to the result using wet AuNPs–PSA–avidin conjugate. The AuNPs–PSA–avidin conjugate was lyophilized with 5% sorbitol and stored up to 30 days at room temperature (Fig. 3). The peak current signals of the assay performed with lyophilized reagents stored for 15 (Day 15) and 30 (Day 30) days were almost similar to those at 0 day (at the start of the storage duration). This shows the lyophilized conjugate was stable for at least 30 days at room temperature.
171
The performance of lyophilized AuNPs–PSA–avidin conjugates with 5% sorbitol was also compared to those using non-lyophilized (wet preparation) AuNPs–PSA–avidin conjugates for detecting varying concentrations of linear target DNA from 1 aM to 1 pM (Fig. 4). For both lyophilized and wet reagent assays, the current responses were linear over the range of 1 aM to 1 pM target DNA, and similar values were obtained at the lower concentrations of target DNA for both assays. The correlation coefficient (r2) values for the lyophilized and wet reagent assays were 0.9553 and 0.9690, respectively. The relative standard deviation (RSD) of the assay performed with 1 pM target DNA is 7.36% (12 replicates). The limit of detection (LOD) of the lyophilized and wet reagent assays was 1 fM and 10 fM, respectively. These values were determined based on the threshold value of 3x the background signal of the non-complementary linear target DNA. In comparison, Pinijsuwan et al. [17] and Guan et al. [18] reported LOD of 0.5 fM linear target using wet reagent gold nanoparticle-based electrochemical detection, which was only slightly higher than this study's LOD using lyophilized AuNPs–PSA–avidin conjugates. Sugars, such as trehalose, sucrose and sorbitol, are commonly used as cryoprotectants for lyophilization of biomolecules [25,26] and nanoparticles [27–29]. The protective mechanism of these sugars is still not fully understood and several hypotheses had been proposed, i.e. the water replacement hypothesis, glass formation hypothesis and kosmotropic effect [25]. 4.5. Hybridization and electrochemical detection of PCR products
Fig. 3. Stability study of AuNPs–PSA–avidin conjugate lyophilized with 5% sorbitol and stored up to 30 days at room temperature. Immediately after lyophilisation (Day 0), after storage for 15 days (Day 15) and after 30 days (Day 30), the dried AuNPs–PSA–avidin conjugates were rehydrated, tagged with the reporter probe and hybridized with 1 pM of complementary (VCLT) / non-complementary (NCLT) linear targets.
PCR products of 5 V. cholerae and 12 non-V. cholerae strains were detected using agarose gel electrophoresis and electrochemical genosensor. The electrochemical genosensor method was based on the one-step DNA hybridization using the lyophilized reagents. All 5 V. cholerae strains showed DNA bands at the expected 519 bp on the agarose gel while no bands were observed with the non-V. cholerae strains. The result of electrochemical detection was concordant with agarose gel electrophoresis. Samples giving peak currents above 3x the signal of non-complementary linear target DNA were considered
Fig. 4. Comparison of the performance of AuNPs–PSA–avidin conjugates in lyophilized and wet reagent forms for detection of varying concentrations of linear target DNA, VCLT (1 aM to 1 pM). The voltammograms for dry (inset A) and wet (inset B) reagent forms are also shown.
172
P.S. Liew et al. / Talanta 139 (2015) 167–173
positive. The signals from all 5 V. cholerae strains were higher than the threshold value, while all of the non-V. cholerae strains yielded signals that were lower than the threshold value (Fig. 5). The results show the assay was highly specific. Different concentrations of PCR products ranging from 100 pM to 1 fM were also tested (Fig. S5). The LOD of the assay was 1 fM, based on the threshold value set at 3x the signal of 1 pM non-complementary PCR products. This LOD is an improvement over previously reported electrochemical detection of V. cholerae with detection limits of 61 pM of PCR products [30] and 3.9 nM of 200-mer synthetic target DNA [31]. It is also good to note that the LOD is comparable to our previous work using an electrochemical genosensor technique (but with wet reagents) to detect the fish pathogen, A. invadans [18]. This shows that the electrochemical genosensor assay could be used as a common platform for detection of various organisms of interest. In this line, the lyophilized AuNPs–PSA–avidin conjugate could be used as a universal reporter label for detection of various organisms by just changing the sequences of the reporter probe. This will greatly facilitate the preparation, storage and usage of the assay. A table of comparison of the different electrochemical DNA hybridization methods using DPV in the literature is presented as Table 2. 4.6. Hybridization and electrochemical detection of LAMP products Three concentrations of LAMP products (500, 100 and 50 ng ml 1) were tested using the lyophilized AuNPs–PSA–avidin conjugates (Fig. 5). This preliminary result showed that LAMP amplification
could be used to replace PCR, as LAMP has several advantages. Amplification of target DNA using LAMP could be performed using a single temperature at 65 °C, which is an advantage over PCR that requires thermal cycling. The LAMP reaction can be performed using a simple water bath or heating block. Detection of the LAMP products using the lyophilized reagent electrochemical genosensor would make the test suitable for field use. This, however, would require further optimization and evaluation of a LAMP-based electrochemical detection method, which is our future aim. Similar electrochemical detection using differential pulse voltammetry (DPV) have been reported with other microorganisms [32,33]. Recently, a multiplex detection of LAMP products of rtxA and toxR genes of V. cholerae using a microfluidic chip-based fluorescence assay was successfully performed [34]. In this study, the gene target of both PCR and LAMP assays was the lolB gene of V. cholerae, which is a non-virulence gene. The lolB gene, which encodes for outer membrane lipoprotein of V. cholerae, is highly conserved in all serogroups and biotypes of V. cholerae, including the non-O1, non-O139 serogroup [20]. This study focused on the use of a non-virulence gene such as lolB as it is able to detect certain non-toxigenic V. cholerae strains of the serogroup non-O1, non-O139 that is often found in environmental samples, and were reported to cause sporadic and localized diarrheal outbreaks [35–38]. Current PCR assays based on non-virulence genes were not very specific as the target gene sequence varied among certain V. cholerae strains [39] or had not been tested on clinical samples [4].
Fig. 5. Electrochemical detection of PCR and LAMP products from V. cholerae and non-V. cholerae strains. Samples giving peak currents above 3x the signal of non-complementary linear target (1 pM NC) were considered positive.
Table 2 Comparison of the different electrochemical DNA hybridization methods using DPV in the literature. Label/sensing signal
Target/gene/organism
Detection products
Detection limit
Reference
DNA/methylene blue Methylene Blue anti-fluorescein-alkaline phosphatase (anti-FITC–ALP) MNP–DNA–AuNP/α-FITC DNA–AuNP/latex DNA–AuNP/latex DNA–AuNP/latex
Ochratoxin A Y. enterocoliticia V. cholerae lolB gene, V. cholerae Aphanomyces invadans lolB gene, V. cholerae lolB gene, V. cholerae
LAMP LAMP LATE-PCR 200-mer Synthetic target PCR 519 bp PCR LAMP
0.3 pM 5 mM 8–61 pM 3.9 nM 1 fM 1 fM 50 ng mL 1
[32] [33] [30] [31] [18] This work This work
MNP, magnetic nanoparticle; FITC, Fluorescein isothiocyanate; ALP, Alkaline Phosphatase.
P.S. Liew et al. / Talanta 139 (2015) 167–173
5. Conclusion In summary, we have developed a lyophilized reagent-based electrochemical genosensor assay for the detection of V. cholerae. The AuNPs–PSA–avidin conjugate, which was lyophilized with 5% sorbitol, was stable for up to 30 days at room temperature. The LOD of the assay is 1 fM of PCR products. The genosensor was also able to detect LAMP products as low as 50 ng ml 1. The novel lyophilized AuNPs–PSA–avidin reporter label in combination with electrochemical genosensor detection could be used for rapid detection of V. cholerae on site, either from real samples in the environment or clinical settings. In addition, this assay platform that is based on lyophilized universal reporter label, could also be used to develop electrochemical genosensor assays for other organisms.
Acknowledgement The authors are thankful to the Ministry of Science, Technology and Innovation, Malaysia for the E-Science Fund Grant (02-01-02SF0821) and Thailand's Office of Higher Education Commission for the National Research University Project (grant number: NRU55000667), which supported this study.
Appendix A. Supplementary material Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.talanta.2015.02. 054.
References [1] R.A. Finkelstein, in: S. Baron (Ed.), Medical Microbiology, 4th ed.,University of Texas Medical Branch at Galveston, Galveston (TX), 1996. [2] WHO | Cholera, in: WHO, 〈http://www.who.int/mediacentre/factsheets/fs107/ en/〉, (accessed 13.02.14). [3] S. Preeprem, P. Mittraparp-Arthorn, P. Bhoopong, V. Vuddhakul, Foodborne Pathog. Dis. 11 (2014) 881. [4] A. Di Pinto, G. Ciccarese, G. Tantillo, D. Catalano, V.T. Forte, J. Food Prot. 68 (2005) 150. [5] K.W. Soli, M. Kas, T. Maure, M. Umezaki, A. Morita, P.M. Siba, A.R. Greenhill, P.F. Horwood, Diagn. Microbiol. Infect. Dis. 77 (2013) 321. [6] C. Srisuk, P. Chaivisuthangkura, S. Rukpratanporn, S. Longyant, P. Sridulyakul, P. Sithigorngul, Lett. Appl. Microbiol. 50 (2010) 36.
173
[7] E.M. Fykse, T. Nilsen, A.D. Nielsen, I. Tryland, S. Delacroix, J.M. Blatny, Mar. Pollut. Bull. 64 (2012) 200. [8] E.M. Fykse, G. Skogan, W. Davies, J.S. Olsen, J.M. Blatny, Appl. Environ. Microbiol. 73 (2007) 1457. [9] C.M. Soto, A.S. Blum, G.J. Vora, N. Lebedev, C.E. Meador, A.P. Won, A. Chatterji, J.E. Johnson, B.R. Ratna, J. Am. Chem. Soc. 128 (2006) 5184. [10] D.-Z. Jin, X.-J. Xu, S.-H. Chen, S.-Y. Wen, X.-E. Ma, Z. Zhang, F. Lin, S.-Q. Wang, Infect. Agent. Cancer 2 (2007) 23. [11] M.J. Schöning, A. Poghossian, Analyst 127 (2002) 1137. [12] T.G. Drummond, M.G. Hill, J.K. Barton, Nat. Biotechnol. 21 (2003) 1192. [13] D. Grieshaber, R. MacKenzie, J. Vörös, E. Reimhult, Sensors 8 (2008) 1400. [14] N.J. Ronkainen, H.B. Halsall, W.R. Heineman, Chem. Soc. Rev. 39 (2010) 1747. [15] E.G. Hvastkovs, D.A. Buttry, Analyst 135 (2010) 1817. [16] A.P.F. Turner, Chem. Soc. Rev. 42 (2013) 3184. [17] S. Pinijsuwan, P. Rijiravanich, M. Somasundrum, W. Surareungchai, Anal. Chem. 80 (2008) 6779. [18] Guan Chin Kuan, Liew Pei Sheng, Patsamon Rijiravanich, Kasi Marimuthu, Manickam Ravichandran, Lee Su Yin, Benchaporn Lertanantawong, Werasak Surareungchai, Talanta 117 (2013) 312. [19] J. Turkevich, P.C. Stevenson, J. Hillier, Discuss. Faraday Soc. 11 (1951) 55. [20] P. Lalitha, M.N. Siti Suraiya, K.L. Lim, S.Y. Lee, A.R. Nur Haslindawaty, Y.Y. Chan, A. Ismail, Z.F. Zainuddin, M. Ravichandran, J. Microbiol. Methods 75 (2008) 142. [21] K. Okada, S. Chantaroj, T. Taniguchi, Y. Suzuki, A. Roobthaisong, O. Puiprom, T. Honda, P. Sawanpanyalert, Diagn. Microbiol. Infect. Dis. 66 (2010) 135. [22] D.A. Weitz, M.Y. Lin, C.J. Sandroff, Surf. Sci. 158 (1985) 147. [23] K.C. Grabar, R.G. Freeman, M.B. Hommer, M.J. Natan, Anal. Chem. 67 (1995) 735. [24] F. Tang, H. Tanhnoto, S. Okuda, Nanostruct. Mater. 6 (1995) 563. [25] D. Christensen, D. Kirby, C. Foged, E.M. Agger, P. Andersen, Y. Perrie, H.M. Nielsen, Biochim. Biophys. Acta 1778 (2008) 1365. [26] N. Jovanović, A. Bouchard, G.W. Hofland, G.-J. Witkamp, D.J.A. Crommelin, W. Jiskoot, Eur. J. Pharm. Sci. 27 (2006) 336. [27] S. Doktorovova, R. Shegokar, L. Fernandes, P. Martins-Lopes, A.M. Silva, R.H. Müller, E.B. Souto, Pharm. Dev. Technol. 19 (2014) 922. [28] P. Fonte, S. Soares, F. Sousa, A. Costa, V. Seabra, S. Reis, B. Sarmento, Biomacromolecules 15 (2014) 3753. [29] R.K. Barman, Y. Iwao, Y. Funakoshi, A.-H. Ranneh, S. Noguchi, M.I.I. Wahed, S. Itai, Chem. Pharm. Bull. 62 (2014) 399. [30] C.Y. Yu, G.Y. Ang, C.Y. Yean, Chem. Commun. 49 (2013) 2019. [31] K.-F. Low, A. Karimah, C.Y. Yean, Biosens. Bioelectron. 47 (2013) 38. [32] S. Xie, Y. Chai, Y. Yuan, L. Bai, R. Yuan, Biosens. Bioelectron. 55 (2014) 324. [33] W. Sun, P. Qin, H. Gao, G. Li, K. Jiao, Biosens. Bioelectron. 25 (2010) 1264. [34] D.M. Tourlousse, F. Ahmad, R.D. Stedtfeld, G. Seyrig, J.M. Tiedje, S.A. Hashsham, Biomed. Microdevices 14 (2012) 769. [35] A. Garrido-Maestu, M.-J. Chapela, J.M. Vieites, A.G. Cabado, Food Microbiol. 46 (2015) 535. [36] M.S. Cho, J. Microbiol. Biotechnol. 23 (2013) 555. [37] J.M. Vital Brazil, R.M. Alves, I.N.G. Rivera, D.P. Rodrigues, D.K.R. Karaolis, L.C. Campos, FEMS Microbiol. Lett. 215 (2002) 15. [38] A. Fasano, J.В Kaper, M. Trucksis, in: I.K. Wachsmuth, Ø. Olsvik, P.A. Blake (Eds.), Vibrio Cholerae Cholera, American Society of Microbiology, Washington DC, 1994, pp. 145–176. [39] B. Nandi, R.K. Nandy, S. Mukhopadhyay, G.B. Nair, T. Shimada, A.C. Ghose, J. Clin. Microbiol. 38 (2000) 4145.
