European Journal of Pharmacology 740 (2014) 619–626
Contents lists available at ScienceDirect
European Journal of Pharmacology journal homepage: www.elsevier.com/locate/ejphar
Immunopharmacology and inflammation
Largazole, an inhibitor of class I histone deacetylases, attenuates inflammatory corneal neovascularization Hongyan Zhou a, Sheng Jiang b, Jianping Chen a, Xiangrong Ren a, Jiayi Jin a, Shao Bo Su a,n a b
The State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-sen University, 54 S Xianlie Road, Guangzhou 510060, China Guangzhou Institute of Biomedicine and Health, CAS, Guangzhou 510663, China
art ic l e i nf o
a b s t r a c t
Article history: Received 15 April 2014 Received in revised form 13 June 2014 Accepted 17 June 2014 Available online 26 June 2014
Histone deacetylases (HDACs) regulate gene transcription by modifying the acetylation level of histone and nonhistone proteins. In this study, we examined the effect of largazole, an inhibitor of class I HDACs, on inflammatory corneal angiogenesis. In a mouse model of alkali-induced corneal neovascularization (CNV), topical application of largazole to the injured corneas attenuated CNV. In addition, in vivo treatment with largazole down-regulated the expression of the pro-angiogenic factors VEGF, b-FGF, TGFβ1 and EGF but up-regulated the expression of the anti-angiogenic factors Thrombospondin-1 (Tsp1), Tsp-2 and ADAMTS-1 in the injured corneas. Furthermore, largazole inhibited the expression of pro-angiogenic factors, migration, proliferation and tube formation by human microvascular endothelial cells (HEMC-1) in vitro. These data indicate that largazole has therapeutic potential for angiogenesisassociated diseases. & 2014 Elsevier B.V. All rights reserved.
Keywords: Angiogenesis CNV HDACs Largazole
1. Introduction Neovascularization is an essential process in growth, organ development and wound healing. It also participates in the pathogenesis of cancer, atherosclerosis, diabetic retinopathy, rheumatoid arthritis and corneal neovascularization (CNV) (Braza-Boils et al., 2013; Folkman, 1995; Glunde et al., 2007; Li et al., 2012; Saber et al., 2011; Zhou et al., 2011). There is an absence of blood and lymphatic vessels in cornea under physiological conditions. Normally, it maintains its avascularity mediated by the balance between pro-angiogenic and antiangiogenic factors (Frantz et al., 2005). However, CNV can be caused by ocular insults, such as infection, immunological responses and injury that frequently impair vision. CNV is also an important risk factor for graft rejection after corneal transplantation. Therefore, anti-angiogenic therapy is an important approach for reducing corneal complications secondary to inflammation for preventing rejections of corneal transplantation. Histone deacetylases (HDACs) constitute a family of enzymes that regulate gene transcription by modifying the acetylation level of histone and nonhistone proteins (Minucci and Pelicci, 2006). Eighteen HDACs in human are grouped into four classes based on function and DNA sequence similarity. Class I HDACs include
n
Corresponding author. Tel.: þ 86 020 87330402; fax: þ 86 020 87330403. E-mail address: [email protected] (S.B. Su).
http://dx.doi.org/10.1016/j.ejphar.2014.06.019 0014-2999/& 2014 Elsevier B.V. All rights reserved.
HDAC1, 2, 3, 8 which are linked to cell proliferation and survival. The class II HDACs include class IIa (HDAC4, 5, 7 and 9) and IIb (HDAC6 and 10) according to their sequence homology and domain organizations which regulate the transcriptional corepressors by interaction with the MEF2 transcription factors and the N-CoR, BCoR and CtBP corepressors (Gray and Ekstrom, 2001; Mai et al., 2005). They also regulate the expression of genes involved in vascular homeostasis (Martin et al., 2007). Class III HDACs are called sirtuins and can negatively regulate multiple pathways for both tumor suppressors and oncogenic proteins. HDAC11 is the only member of class IV HDACs which shares sequence similarity with the catalytic core regions of both the class I and II enzymes (Bertos et al., 2001). Breaking the equilibrium of histone acetylation and deacetylation mediated by HDACs and histone acetylases (HATs) may cause tumor and neovascularization (Cress WD, 2000; Gao et al., 2002). Targeting HDACs in tumors by inhibiting cyclin D1 induces cell cycle arrest, apoptosis and gene program change. Inhibition of HDACs also sensitizes tumor cells to chemotherapy (Kerl et al., 2013). In addition, HDACs are essential for angiogenesis by regulating the expression of angiogenic growth factors such as VEGF (Ha et al., 2008a). Largazole is a natural macrocyclic depsipeptide originally isolated from Floridian marine cyanobacterium Symploca sp and selectively inhibits the activity of class I HDACs (Hong and Luesch, 2012). Largazole inhibits tumor growth in a xenograft mouse model and shows potential as a drug for bone-related disorders by stimulating bone formation and inhibiting bone
620
H. Zhou et al. / European Journal of Pharmacology 740 (2014) 619–626
resorption (Bowers et al., 2009; Liu et al., 2010, 2013; Taori et al., 2008; Ying et al., 2008). The largazole structure–activity relationship (SAR) has been comprehensively reviewed (Hong and Luesch, 2012). Further studies showed that largazole regulates the expression of TGF, VEGF, VEGFR, collagen I, CD34 and bcl (Liu et al., 2013), indicating its important activity of controlling angiogenesis. Since CNV associated with inflammation and infection may cause impaired vision, in this study, we studied the effect of largazole on a mouse model of alkali-induced CNV. We found that topical application of largazole to the injured corneas attenuated CNV by down-regulating the expression of the pro-angiogenic factors VEGF, b-FGF, TGFβ1 and EGF but up-regulating the expression of the anti-angiogenic factors Thrombospondin-1 (Tsp-1), Tsp-2 and ADAMTS-1. Thus, largazole may have therapeutic potential for angiogenesis-related diseases such as CNV.
2. Materials and methods 2.1. Animals All animal protocols were approved by the institutional animal care committee and were in accordance to the Association for Research in Vision and Ophthalmology's Statement for the Use of Animals in Ophthalmology and Vision Research. All mice were female BALB/c mice, aged 6 to 8 weeks (purchased from Charles River Laboratories, Sulzfeld, Germany). Animals were kept in a specific pathogen-free facility. Animal care and use were in compliance with institutional guidelines.
was applied topically to the eye twice a day. Eyes were examined with a slit lamp (Zeiss, Germany) 7 and 14 days after alkali injury, or at the indicated time intervals. Mice were killed and the corneas were removed from both eyes. The corneas were placed immediately into RNALater (Qiagen) and kept at 80 1C until total RNA extraction, or were fixed in 10% neutral formalin buffer for histological analysis. Each experiment was repeated at least three times. 2.4. Immunohistochemical staining and enumeration of CNV The paraffin-embedded tissues were cut into 6-μm-thick slices and mounted on poly-L-lysine-coated slides which were subjected to immunohistochemical staining. Immunohistochemical analyses were performed using anti-CD31 Abs. The sections were incubated with Abs at a concentration of 1 μg/ml at 4 1C overnight. After incubation with peroxidase conjugated secondary Ab, the chromogen diaminobenzidine tetrahydrochloride (DAB) was added, until color had developed sufficiently. Sections were counterstained with Mayer's hematoxylin. The numbers and sizes of the CNV were then determined by an examiner with no knowledge of the experimental procedures. Images were captured with a digital camera and imported into Adobe Photoshop (version 7.0). The number of neovascular tubes per mm2 and the proportions of CNV in the hot spots were determined using NIH Image analysis software version 1.62 (National Institutes of Health, Bethesda, MD). The numbers and areas of CNV in central region of the cornea were evaluated on at least two sections from each eye. 2.5. Proliferation assay
2.2. Reagents and antibodies Goat anti-mouse PECAM-1 (CD31) polyclonal antibody was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). TRIzol reagent and ExScriptTM RT reagent kit were purchased from TaKaRa (TaKaRa Biotechnology Co. Ltd. DaLian, China). Brilliant SYBRs Green QPCR Master Mix was purchased from Stratagene (La Jolla, CA USA). Rabbit anti-goat IgG-peroxidase antibody was purchased from Sigma Inc (St. Louis, MO, USA). The structure of largazole is shown in Fig. 1 and is synthesized as described before (Zeng et al., 2010). The purity was over 99%. Most of other reagents such as salt and buffer components were analytical grade and obtained from Sigma. 2.3. Alkali-induced corneal injury model and topical application of largazole Mice were anesthetized with i.p. administration of kessodrate. A 2-mm disc of filter paper saturated with 1 N NaOH was placed onto the right cornea of each mouse for 40 s, followed by rinsing extensively with 25 ml of PBS. The corneal epithelia were removed using a corneal knife in a rotary motion parallel to the limbus by gently scraping over the corneal surface without injuring the underlying corneal stroma. Five microliters of largazole or carrier
NH
HEMC-1 cells were seeded in a 6-well plate at a density of 1 106 cells/well in growth medium until they reached 90% confluence. A scratch was made through each well using a sterile tip. The monolayer was incubated with a migration assay buffer consisting of serum-free medium and largazole (0, 0.12, 0.6 and 3 μg/ml). Images were captured at 0 h, 6 h, 12 h and 24 h. The area of healing wound was calculated with Image J software (Liang et al., 2007). 2.7. Real-time quantitative RT-PCR
N N
O
2.6. Migration assays
S
O
O
Human microvascular endothelial cell line (HMEC-1) was obtained from American Type Culture Collection (Manassas, VA). HMEC-1 cells were cultured in human endothelial-SFM (Invitrogen, Carlsbad, CA). Triplicate 0.2-ml cultures containing 2 105 cells were seeded in round-bottom 96-well microtiter plates. The cells were treated with largazole (0, 0.12, 0.6, 3.0 μg/mL) at 37 1C in a CO2 incubator for 48 h. MTT solution (10 μl of 5 mg/ml) was added to each well and the cells were further incubated for 4 h at 37 1C. The cells were then resuspended in 100 μl of 0.04 M HCl/isopropanol solution and the incubation was continued for 2 h to solubilize formazan violet crystals in the cells. The absorbance in each well was determined by spectrophotometry at the dual wavelengths of 570 and 630 nm on a microplate reader (Pharmacia, Sweden).
O
S
O N H
Largazole Fig. 1. Structure of largazole.
S
HEMC-1 cells were seeded in a 6-well plate at a density of 1 106 cells/well in growth medium and grew until reached 70% confluence. The cells were treated with largazole (0, 0.12, 0.6, 3 μg/ml) in the presence of LPS (100 ng/ml) for 4 h. The cell supernatants, lysates and RNA were collected for further experiments. Total RNA was extracted from the corneas or cultured HMEC1 cells with a TRIzol reagent kit and the cDNA was prepared by reverse transcription. Real-time PCR was performed on an Applied
H. Zhou et al. / European Journal of Pharmacology 740 (2014) 619–626
621
Table 1 Primer sequences of mouse and human for real-time RT-PCR.
Mouse
Gene
Sequence (50 to 30 )
TSP-1
Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense
GAAGCAACAAGTGGTGTCAGT ACAGTCTATGTAGAGTTGAGCCC CCTCAACTACTGGGTAGAAGGC TGACACTGTCGATAAGATCGCA TGCTCCAAGACATGCGGCTCAG TGGTACTGGCTGGCTTCACTTCC CATCTTCAAGCCGTCCTGTGT CTCCAGGGCTTCATCGTTACA CCCACCAGGCCACTTCAA GATGGATGCGCAGGAAGAA TCTACAACCAACACAACCCG TTGGACAACTGCTCCACCTT CTTATACAGGAATGGAGGCTGTG TTCACCTGACAGGATTGGATAAT TGAGCAAGAGAGAGGCCCTATC AGGCCCCTCCTGTTATTATG
Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense
AACATGCCACGGCCAACAAA TGCACTTGGCGTTCTTGTTGC AAGGATAACTGCCCCATCT CCGTCATTGTCATCGTCATC AAGGACAGGTGCAAGCTCAT GAGGTGGAATCTGGGCTACA TGCAGATTATGCGGATCAAACC TGCATTCACATTTGTTGTGCTGTAG CAGGCCCAGTTTCTGCCATT TTCCAGCTCAGCGTGGTCGTA CCAGCAAAAGCAGGGAGTCTGT TGTCTGTGTCATCGGAGTGATATCC GCAACAATTCCTGGCGATACC CTCCACGGCTCAACCACTG GTGTGTGCTAACCGTTACCT GCTCTTAGCAGACATTGGAAG ACTCTTCCAGCCTTCCTTCC AGCACTGTGTTGGCGTACAG
TSP-2 ADAMTS-1 VEGF bFGF TGF-β1 EGF GAPDH Human
TSP-1 TSP-2 ADAMTS-1 VEGF VEGFR-1 VEGFR-2 TGF-beta1 FGF2 β-Actin
NS
Product length
NS
109 67 71 118 139 93 87 95 104 81 82 100 111 217 117
100 50 0
Neovascular No/MM2
Day 7
Day 14
30
100
4
2
0
180 120 60 0
Largazole: 0 10
Largazole
150
Neovascular Area (%)
Largazole
NS
Neovascular No/MM2
Day 14
0
146
Largazole
Day 7
Largazole:
106
10
30 100 200 (μg/ml)
200 (μg/ml)
Fig. 2. The effect of topical largazole application on CNV. (A–D) 5 μl of 100 μg/ml largazole is topically applied on alkali-burn cornea twice a day. (A) Images are taken with slit lamp to show the frontal (left panels) and lateral (middle panels) view of each eye. (B) Corresponding cryosections from treated corneal tissues are immunostained with anti-CD31 Ab. Original magnification, 200. (C) and (D) Quantitative analysis of data are presented in (A) and (B). The CNV numbers per mm2 in hot spots (C) and % CNV areas in hot spots (D) are determined. (E) and (F) Dose–response of largazole in CNV. 5 μl of various doses of largazole are topically applied on alkali-burn corneas twice a day. (E) Images are taken and (F) quantitative analysis of data presented in (E). Data represent the means 7 S.E.M. (n¼ 6). *Po 0.05, largazole vs. saline-treated mice.
622
H. Zhou et al. / European Journal of Pharmacology 740 (2014) 619–626
Biosystems StepOne Real-Time PCR System using the comparative threshold cycle (CT) quantification method. Each reaction contained 12.5 μl of 2 SYBR green Master Mix, 300 nM oligonucleotide primers (Table 1) synthesized by Invitrogen Biotechnology Co. Ltd, (Shanghai, China), 10 μl of 1 in 10 dilution of the cDNA and water, to a total of 25 μl. The thermal cycling conditions included an initial denaturation at 95 1C for 10 min, 40 cycles at 95 1C for 30 s, 60 1C for 1 min, and 72 1C for 1 min. Each measurement of a sample was conducted in duplicate. All mRNA values were normalized against the levels of mouse β-actin or human GAPDH mRNA. The normalizing value derived from untreated control corneas or HMEC-1 cells was designated as 1 and the normalized values of treatment groups are expressed as fold increase over the untreated control group in y-axis.
inverted microscope using a 10 objective. Tube formation in cell culture was quantified by counting the tube-like structures in the gel and data were presented as the number of branches per field ( 100). In each experiment, 4 fields were calculated simultaneously and 3 independent experiments were performed. 2.9. Reproducibility and statistical analysis Experiments were repeated at least 3 times. Results were highly reproducible. Representative results are shown in the figures. The means and S.E.M. were calculated on all parameters determined in the study. Data were analyzed statistically using 1way ANOVA or 2-tailed Student's t test. A value of P o0.05 was accepted as statistically significant.
2.8. Tube formation assay 3. Results Tube formation assay was performed as described by Lin et al. (2006) and Sachdev et al. (2012). Briefly, HMEC1 cells were seeded on Matrigel at 40,000 cells/well in 96-well plates with LPS/largazole in depleted medium. The cells were cultured for 18 h at 37 1C in a 5% CO2 incubator. Photographs were taken on an
b-FGF
VEGF
30
3.1. Topical largazole application attenuated CNV. To determine the effect on angiogenesis, largazole (100 μg/ml) was topically applied on CNV induced by alkali burn. Fig. 2 shows
TGFβ1
15
EGF
12
Fold change
12 20
0
0 2
Fold change
4
2
TSP-1
60
4 TSP-2
18
40
5
4
12
0
2
0
4
2
4
ADAMTS-1
21
14 NS
20
6
0
Day
7
0 2
45
Fold change
8
6
10
Day
10
4
Largazole
0 2
4
2
4
Largazole(μg/ml): 0
10
30
100
30
15
0 VEGF
b-FGF
TGFβ1
EGF
TSP-1
TSP-2
ADAMTS-1
Fig. 3. Inhibition of angiogenic factor expression in Alkali-burn corneas by largazole. 5 μl of 100 μg/ml (A) or various doses (B) of largazole are topically applied on alkali-burn corneas twice a day. The mRNA expression of VEGF, b-FGF, TGFβ1, EGF, TSP-1. TSP-2 and ADAMTS-1 in wound sites on 2 and 4 day (A), or on 2 day (B) after injury is determined by quantitative RT-PCR. Results are expressed as the mean 7 S.E.M. of fold increase over control. nPo 0.05, largazole vs. saline-treated mice.
H. Zhou et al. / European Journal of Pharmacology 740 (2014) 619–626
3.2. Inhibition of angiogenic factor expression in alkali-injured corneas by largazole The balance of pro- and anti-angiogenic factors is important for angiogenesis. We next examined the effect of largazole on the expression of pro- and anti-angiogenic factors in alkali-burn corneal wounds. The mRNA expression of the pro-angiogenic factors VEGF, b-FGF, TGFβ1, EGF was down-regulated and the expression of anti-angiogenic factors Tsp-1, Tsp-2 and ADAMTS-1 was up-regulated in corneal wounds with the treatment of 100 μg/ml largazole (Fig. 3A). Furthermore, largazole dose-dependently
NS
regulated the expression of angiogenic factor genes (Fig. 3B). These data indicate that largazole may attenuate angiogenesis through down-regulation of pro-angiogenic factor expression but upregulation of anti-angiogenic factor expression in alkali-burn corneal wounds.
0.8 MTT (OD570)
that alkali burn in control mice resulted in a rapid neovascularization with limbal vessels sprouting into corneas at day 7 and reached a maximal level in 14 days after injury (Fig. 2A). However, fewer new blood vessels sprouting near the limbal area appeared in largazole-treated group (Fig. 2A). Immunohistochemical analysis using anti-CD31 antibody showed that vascular areas in largazole-treated mice were significantly smaller in comparison with control group (Fig. 2B–D). Further studies showed that largazole dose-dependently inhibited CNV with a maximum effect at 100 μg/ml (Fig. 2E and F). These data indicate that largazole has an inhibitory effect on angiogenesis in alkali-induced injured cornea.
623
0.4
0 Largazole :
0
0.12
0.6
3.0
(μg/ml)
Fig. 5. The effect of largazole on cell proliferation. HMEC-1 cells (2 105) are cultured with largazole (0, 0.12, 0.6, 3.0 μg/ml) at 37 1C in a CO2 incubator and the proliferation is determined by a MTT method. Shown are results from one representative experiment of three performed (in triplicates). n, statistically significant difference in values from vehicle-treated group (Po 0.05).
Largazole
0h
12 h
24 h
Fig. 4. Inhibition of HMEC-1 migration by largazole. Images of HMEC-1 cell migration which are assessed in a scratch assay are captured at the same position at 0 h, 12 h and 24 h after incubating with a migration assay buffer containing largazole or normal saline. The area of the wound is calculated with Image J software. nPo 0.05, largazole vs. saline-treated mice.
624
H. Zhou et al. / European Journal of Pharmacology 740 (2014) 619–626
NS VEGF
FGF2
Fold change
TGFβ1
100
200
* 0
8
4
180
140
2
90
0
0
0
Fold change
75
100
50
50
0
* **
25
*
*
0
**
0
0.12
0.6
TGFβ1 300
10
200
*
TSP-2 15
*
*
100
5
0
0
0
*
10
* *
*
*
3
TSP-1
15
5
8
*
0
FGF2
150
ADAMTS-1 270
280
Largazole (μg/ml): VEGF
TSP-2
420
4
0
TSP-1
12
*
50
100
Largazole
*
ADAMTS-1 180
** 120
* 60
0
Fig. 6. Angiogenic factor expression by largazole-treated HMEC-1 cells. HEMC-1 cells are seeded in a 6-well plate at a density of 1 106 cells/well in growth medium and grew until 70% confluence. The cells are treated with 0.6 μg/ml (A) or various doses (B) of largazole and LPS (100 ng/ml) for 4 h and RNA is extracted. The mRNA level for angiogenic factors is detected by RT-PCR and normalized to GAPDH mRNA. Results are expressed as the mean7 SE. *Po 0.05 compared to the untreated group.
LPS: Largazole :
0
1
1
1
1
0
0
0.12
0.6
3
(βμ/ml) (βμ/ml)
Fig. 7. The effect of largazole on tube formation in HMEC-1 cells. 40,000 HMEC1 cells/well are seeded on Matrigel containing LPS/largazole in depleted medium. The cells are cultured for 18 h at 37 1C 5% CO2. Tube formation is quantified by counting the tube-like structures in the gel and data are presented as the number of branches per field. Scale bar ¼200 μm.
3.3. The effect of largazole on HEMC-1 cell proliferation and migration The motility and proliferation of endothelial cells are key processes in angiogenesis. We examined the role of largazole in the motility and proliferation of a human microvascular endothelial cell line HMEC-1 cells (van der Meer et al., 2010). Fig. 4 shows that the healing area of HEMC-1 cells in largazole-treated group at the 24 h time point was reduced than that of control group in scratch assays. Fig. 5 shows that largazole inhibited cell proliferation in comparison to the control cells.
genes (Fig. 6B). These data suggest that largazole inhibits angiogenesis by enhancing the expression of anti-angiogenic factors by endothelial cells. 3.5. The effect of largazole on tube formation Tube formation is a critical process in neovascularization. We examined the effect of largazole on tube formation by HMEC-1 cells in vitro. Fig. 7 shows that largazole attenuates LPS-induced tube formation.
3.4. Angiogenic factor expression by largazole-treated HMEC-1 cells
4. Discussion
We then examined the effect of largazole on the expression of the pro-angiogenic factors VEGF, b-FGF, TGFβ1 and the antiangiogenic factors Tsp-1, Tsp-2 and ADAMTS-1 in LPS-treated HMEC-1 cells. The cells were treated with largazole (0.6 μg/ml) and LPS (100 ng/ml) for 4 h. Similar to the expression in alkaliburn wounds, largazole down-regulated the mRNA expression of pro-angiogenic factors but up-regulated the anti-angiogenic factors in HMEC-1 cells (Fig. 6A). Further study showed that largazole dose-dependently regulated the expression of angiogenic factor
Alkali burns of the cornea destroy surface epithelia and cause necrosis of the tissue, therefore may lead to CNV and vision damage. Glucocorticoids are widely used for the treatment of alkali injury of the eye. However, the therapeutic benefits are limited (Den et al., 2004; Sekundo et al., 2002). Thus, it is important to develop novel treatment of CNV. In this study, we demonstrated that topical application of largazole markedly attenuated CNV formation with down-regulation of pro-angiogenic factors but up-regulation of anti-angiogenic molecules, raising the
H. Zhou et al. / European Journal of Pharmacology 740 (2014) 619–626
possibility that largazole could be used as a therapeutic drug for corneal injury by preventing angiogenesis associated with inflammation. HDACs regulate the expression of genes by controlling the reversible dynamic modification and the degree of acetylation of chromatin regional core protein with HAT. Early study showed that global inhibition of HDAC activity inhibited angiogenesis by reducing the expression of pro-angiogenic factors and enhancing the expression of angiogenic inhibitors (Kerl et al., 2013). Recent studies also demonstrated that members of class IIa HDACs can regulate angiogenesis, in particular, HDAC5 and HDAC7 play an essential role in VEGF induction in vitro (Ha et al., 2008b; Martin et al., 2008; Mottet et al., 2007; Qian et al., 2006). In this study, we found that largazole, an inhibitor of class I HDACs, inhibited CNV induced by alkali injury (Fig. 2), indicating that class I HDACs may play an important role in angiogenesis. Further study showed that largazole inhibited the expression of pro-angiogenic factors but enhanced the expression of anti-angiogenic factors (Fig. 3), suggesting that largazole inhibits CNV by promoting the expression of these genes. VEGF is a key factor in angiogenesis by regulating the proliferation, migration, and survival of ECs (Gilabert-Estelles et al., 2007; Olsson et al., 2006; Wang et al., 2008). Other growth factors, such FGF, EGF and TGF also enhance endothelial proliferation and function (Cox et al., 2006; Takehara et al., 2004). The proliferation and migration of endothelial precursor cells are the basis for the formation of new vessels. Endothelial cell migration is initiated by the cells to a migratory phenotype. The endothelial precursor cells are guided to the position where the primary vascular plexus is formed (Kawano et al., 2005). Our study showed that largazole inhibited the proliferation, migration and tube formation of an endothelial cell line HMEC-1 (Figs. 4, 5, and 7). This may be due to the inhibitory effect of largazole on the expression of proangiogenic factors such as VEGF produced by endothelial cells. In conclusion, we found that topical application of largazole, an inhibitor of class I HDACs, to the injured corneas attenuated CNV and down-regulated the expression of the pro-angiogenic factors but up-regulated the expression of the anti-angiogenic factors in the injured corneas. Furthermore, largazole inhibited the expression of pro-angiogenic factors, migration, proliferation and tube formation by human microvascular endothelial cells (HEMC-1) in vitro. These data suggest that largazole has therapeutic potential for angiogenesis-associated diseases such as CNV.
Sources of funding This project was supported in part by the grants from Guangdong Natural Science Foundation (S2011010006048) and the Fundamental Research Funds of State Key Laboratory of Ophthalmology (303060202400439).
Acknowledgment We are grateful to Dr. Ji Ming Wang of the NCI, NIH for critique of the manuscript. References Bertos, N.R., Wang, A.H., Yang, X.J., 2001. Class II histone deacetylases: structure, function, and regulation. Biochem. Cell Biol. 79, 243–252. Bowers, A.A., West, N., Newkirk, T.L., Troutman-Youngman, A.E., Schreiber, S.L., Wiest, O., Bradner, J.E., Williams, R.M., 2009. Synthesis and histone deacetylase inhibitory activity of largazole analogs: alteration of the zinc-binding domain and macrocyclic scaffold. Org. Lett. 11, 1301–1304. Braza-Boils, A., Gilabert-Estelles, J., Ramon, L.A., Gilabert, J., Mari-Alexandre, J., Chirivella, M., Espana, F., Estelles, A., 2013. Peritoneal fluid reduces
625
angiogenesis-related microRNA expression in cell cultures of endometrial and endometriotic tissues from women with endometriosis. PLoS One 8, e62370. Cox, C.M., D’Agostino, S.L., Miller, M.K., Heimark, R.L., Krieg, P.A., 2006. Apelin, the ligand for the endothelial G-protein-coupled receptor, APJ, is a potent angiogenic factor required for normal vascular development of the frog embryo. Dev. Biol. 296, 177–189. Cress WD, S.E., 2000. Histone deacetylases, transcriptional control, and cancer. J. Cell. Physiol. 184, 1–16. Den, S., Sotozono, C., Kinoshita, S., Ikeda, T., 2004. Efficacy of early systemic betamethasone or cyclosporin A after corneal alkali injury via inflammatory cytokine reduction. Acta Ophthalmol. Scand. 82, 195–199. Folkman, J., 1995. Angiogenesis in cancer, vascular, rheumatoid and other disease. Nat. Med. 1, 27–31. Frantz, S., Vincent, K.A., Feron, O., Kelly, R.A., 2005. Innate immunity and angiogenesis. Circ. Res. 96, 15–26. Gao, L., Cueto, M.A., Asselbergs, F., Atadja, P., 2002. Cloning and functional characterization of HDAC11, a novel member of the human histone deacetylase family. J. Biol. Chem. 277, 25748–25755. Gilabert-Estelles, J., Ramon, L.A., Espana, F., Gilabert, J., Vila, V., Reganon, E., Castello, R., Chirivella, M., Estelles, A., 2007. Expression of angiogenic factors in endometriosis: relationship to fibrinolytic and metalloproteinase systems. Hum. Reprod. 22, 2120–2127. Glunde, K., Pathak, A.P., Bhujwalla, Z.M., 2007. Molecular-functional imaging of cancer: to image and imagine. Trends Mol. Med. 13, 287–297. Gray, S.G., Ekstrom, T.J., 2001. The human histone deacetylase family. Exp. Cell Res. 262, 75–83. Ha, C.H., Jhun, B.S., Kao, H.Y., Jin, Z.G., 2008a. VEGF stimulates HDAC7 phosphorylation and cytoplasmic accumulation modulating matrix metalloproteinase expression and angiogenesis. Arterioscler. Thromb. Vasc. Biol. 28, 1782–1788. Ha, C.H., Wang, W., Jhun, B.S., Wong, C., Hausser, A., Pfizenmaier, K., McKinsey, T.A., Olson, E.N., Jin, Z.G., 2008b. Protein kinase D-dependent phosphorylation and nuclear export of histone deacetylase 5 mediates vascular endothelial growth factor-induced gene expression and angiogenesis. J. Biol. Chem. 283, 14590–14599. Hong, J., Luesch, H., 2012. Largazole: from discovery to broad-spectrum therapy. Nat. Prod. Rep. 29, 449–456. Kawano, Y., Nakamura, S., Nasu, K., Fukuda, J., Narahara, H., Miyakawa, I., 2005. Expression and regulation of thrombospondin-1 by human endometrial stromal cells. Fertil. Steril. 83, 1056–1059. Kerl, K., Ries, D., Unland, R., Borchert, C., Moreno, N., Hasselblatt, M., Jurgens, H., Kool, M., Gorlich, D., Eveslage, M., Jung, M., Meisterernst, M., Fruhwald, M., 2013. The histone deacetylase inhibitor SAHA acts in synergism with fenretinide and doxorubicin to control growth of rhabdoid tumor cells. BMC Cancer 13, 286. Li, S., Fu, X.A., Zhou, X.F., Chen, Y.Y., Chen, W.Q., 2012. Angiogenesis-related cytokines in serum of proliferative diabetic retinopathy patients before and after vitrectomy. Int. J. Ophthalmol. 5, 726–730. Liang, C.C., Park, A.Y., Guan, J.L., 2007. in vitro scratch assay: a convenient and inexpensive method for analysis of cell migration in vitro. Nat. Protoc. 2, 329–333. Lin, C.M., Chang, H., Chen, Y.H., Li, S.Y., Wu, I.H., Chiu, J.H., 2006. Protective role of wogonin against lipopolysaccharide-induced angiogenesis via VEGFR-2, not VEGFR-1. Int. Immunopharmacol. 6, 1690–1698. Liu, Y., Salvador, L.A., Byeon, S., Ying, Y., Kwan, J.C., Law, B.K., Hong, J., Luesch, H., 2010. Anticolon cancer activity of largazole, a marine-derived tunable histone deacetylase inhibitor. J. Pharmacol. Exp. Ther. 335, 351–361. Liu, Y., Wang, Z., Wang, J., Lam, W., Kwong, S., Li, F., Friedman, S.L., Zhou, S., Ren, Q., Xu, Z., Wang, X., Ji, L., Tang, S., Zhang, H., Lui, E.L., Ye, T., 2013. A histone deacetylase inhibitor, largazole, decreases liver fibrosis and angiogenesis by inhibiting transforming growth factor-beta and vascular endothelial growth factor signalling. Liver Int. 33, 504–515. Mai, A., Massa, S., Pezzi, R., Simeoni, S., Rotili, D., Nebbioso, A., Scognamiglio, A., Altucci, L., Loidl, P., Brosch, G., 2005. Class II (IIa)-selective histone deacetylase inhibitors. 1. Synthesis and biological evaluation of novel (aryloxopropenyl) pyrrolyl hydroxyamides. J. Med. Chem. 48, 3344–3353. Martin, M., Kettmann, R., Dequiedt, F., 2007. Class IIa histone deacetylases: regulating the regulators. Oncogene 26, 5450–5467. Martin, M., Potente, M., Janssens, V., Vertommen, D., Twizere, J.C., Rider, M.H., Goris, J., Dimmeler, S., Kettmann, R., Dequiedt, F., 2008. Protein phosphatase 2A controls the activity of histone deacetylase 7 during T cell apoptosis and angiogenesis. Proc. Natl. Acad.Sci. U.S.A. 105, 4727–4732. Minucci, S., Pelicci, P.G., 2006. Histone deacetylase inhibitors and the promise of epigenetic (and more) treatments for cancer. Nat. Rev. Cancer 6, 38–51. Mottet, D., Bellahcene, A., Pirotte, S., Waltregny, D., Deroanne, C., Lamour, V., Lidereau, R., Castronovo, V., 2007. Histone deacetylase 7 silencing alters endothelial cell migration, a key step in angiogenesis. Circ. Res. 101, 1237–1246. Olsson, A.K., Dimberg, A., Kreuger, J., Claesson-Welsh, L., 2006. VEGF receptor signalling—in control of vascular function. Nat. Rev. Mol. Cell Biol. 7, 359–371. Qian, D.Z., Kato, Y., Shabbeer, S., Wei, Y., Verheul, H.M., Salumbides, B., Sanni, T., Atadja, P., Pili, R., 2006. Targeting tumor angiogenesis with histone deacetylase inhibitors: the hydroxamic acid derivative LBH589. Clin. Cancer Res. 12, 634–642. Saber, T., Veale, D.J., Balogh, E., McCormick, J., NicAnUltaigh, S., Connolly, M., Fearon, U., 2011. Toll-like receptor 2 induced angiogenesis and invasion is mediated through the Tie2 signalling pathway in rheumatoid arthritis. PLoS One 6, e23540.
626
H. Zhou et al. / European Journal of Pharmacology 740 (2014) 619–626
Sachdev, U., Cui, X., Hong, G., Namkoong, S., Karlsson, J.M., Baty, C.J., Tzeng, E., 2012. High mobility group box 1 promotes endothelial cell angiogenic behavior in vitro and improves muscle perfusion in vivo in response to ischemic injury. J. Vasc. Surg. 55, 180–191. Sekundo, W., Augustin, A.J., Strempel, I., 2002. Topical allopurinol or corticosteroids and acetylcysteine in the early treatment of experimental corneal alkali burns: a pilot study. Eur. J. Ophthalmol. 12, 366–372. Takehara, M., Ueda, M., Yamashita, Y., Terai, Y., Hung, Y.C., Ueki, M., 2004. Vascular endothelial growth factor A and C gene expression in endometriosis. Hum. Pathol. 35, 1369–1375. Taori, K., Paul, V.J., Luesch, H., 2008. Structure and activity of largazole, a potent antiproliferative agent from the Floridian marine cyanobacterium Symploca sp. J. Am. Chem. Soc. 130, 1806–1807. van der Meer, A.D., Vermeul, K., Poot, A.A., Feijen, J., Vermes, I., 2010. A microfluidic wound-healing assay for quantifying endothelial cell migration. Am. J. Physiol. Heart Circ. Physiol. 298, H719–725.
Wang, S., Li, X., Parra, M., Verdin, E., Bassel-Duby, R., Olson, E.N., 2008. Control of endothelial cell proliferation and migration by VEGF signaling to histone deacetylase 7. Proc. Natl. Acad. Sci. U.S.A. 105, 7738–7743. Ying, Y., Taori, K., Kim, H., Hong, J., Luesch, H., 2008. Total synthesis and molecular target of largazole, a histone deacetylase inhibitor. J. Am. Chem. Soc. 130, 8455–8459. Zeng, X., Yin, B., Hu, Z., Liao, C., Liu, J., Li, S., Li, Z., Nicklaus, M.C., Zhou, G., Jiang, S., 2010. Total synthesis and biological evaluation of largazole and derivatives with promising selectivity for cancers cells. Org. Lett. 12, 1368–1371. Zhou, B., Margariti, A., Zeng, L., Xu, Q., 2011. Role of histone deacetylases in vascular cell homeostasis and arteriosclerosis. Cardiovasc. Res. 90, 413–420.
Contents lists available at ScienceDirect
European Journal of Pharmacology journal homepage: www.elsevier.com/locate/ejphar
Immunopharmacology and inflammation
Largazole, an inhibitor of class I histone deacetylases, attenuates inflammatory corneal neovascularization Hongyan Zhou a, Sheng Jiang b, Jianping Chen a, Xiangrong Ren a, Jiayi Jin a, Shao Bo Su a,n a b
The State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-sen University, 54 S Xianlie Road, Guangzhou 510060, China Guangzhou Institute of Biomedicine and Health, CAS, Guangzhou 510663, China
art ic l e i nf o
a b s t r a c t
Article history: Received 15 April 2014 Received in revised form 13 June 2014 Accepted 17 June 2014 Available online 26 June 2014
Histone deacetylases (HDACs) regulate gene transcription by modifying the acetylation level of histone and nonhistone proteins. In this study, we examined the effect of largazole, an inhibitor of class I HDACs, on inflammatory corneal angiogenesis. In a mouse model of alkali-induced corneal neovascularization (CNV), topical application of largazole to the injured corneas attenuated CNV. In addition, in vivo treatment with largazole down-regulated the expression of the pro-angiogenic factors VEGF, b-FGF, TGFβ1 and EGF but up-regulated the expression of the anti-angiogenic factors Thrombospondin-1 (Tsp1), Tsp-2 and ADAMTS-1 in the injured corneas. Furthermore, largazole inhibited the expression of pro-angiogenic factors, migration, proliferation and tube formation by human microvascular endothelial cells (HEMC-1) in vitro. These data indicate that largazole has therapeutic potential for angiogenesisassociated diseases. & 2014 Elsevier B.V. All rights reserved.
Keywords: Angiogenesis CNV HDACs Largazole
1. Introduction Neovascularization is an essential process in growth, organ development and wound healing. It also participates in the pathogenesis of cancer, atherosclerosis, diabetic retinopathy, rheumatoid arthritis and corneal neovascularization (CNV) (Braza-Boils et al., 2013; Folkman, 1995; Glunde et al., 2007; Li et al., 2012; Saber et al., 2011; Zhou et al., 2011). There is an absence of blood and lymphatic vessels in cornea under physiological conditions. Normally, it maintains its avascularity mediated by the balance between pro-angiogenic and antiangiogenic factors (Frantz et al., 2005). However, CNV can be caused by ocular insults, such as infection, immunological responses and injury that frequently impair vision. CNV is also an important risk factor for graft rejection after corneal transplantation. Therefore, anti-angiogenic therapy is an important approach for reducing corneal complications secondary to inflammation for preventing rejections of corneal transplantation. Histone deacetylases (HDACs) constitute a family of enzymes that regulate gene transcription by modifying the acetylation level of histone and nonhistone proteins (Minucci and Pelicci, 2006). Eighteen HDACs in human are grouped into four classes based on function and DNA sequence similarity. Class I HDACs include
n
Corresponding author. Tel.: þ 86 020 87330402; fax: þ 86 020 87330403. E-mail address: [email protected] (S.B. Su).
http://dx.doi.org/10.1016/j.ejphar.2014.06.019 0014-2999/& 2014 Elsevier B.V. All rights reserved.
HDAC1, 2, 3, 8 which are linked to cell proliferation and survival. The class II HDACs include class IIa (HDAC4, 5, 7 and 9) and IIb (HDAC6 and 10) according to their sequence homology and domain organizations which regulate the transcriptional corepressors by interaction with the MEF2 transcription factors and the N-CoR, BCoR and CtBP corepressors (Gray and Ekstrom, 2001; Mai et al., 2005). They also regulate the expression of genes involved in vascular homeostasis (Martin et al., 2007). Class III HDACs are called sirtuins and can negatively regulate multiple pathways for both tumor suppressors and oncogenic proteins. HDAC11 is the only member of class IV HDACs which shares sequence similarity with the catalytic core regions of both the class I and II enzymes (Bertos et al., 2001). Breaking the equilibrium of histone acetylation and deacetylation mediated by HDACs and histone acetylases (HATs) may cause tumor and neovascularization (Cress WD, 2000; Gao et al., 2002). Targeting HDACs in tumors by inhibiting cyclin D1 induces cell cycle arrest, apoptosis and gene program change. Inhibition of HDACs also sensitizes tumor cells to chemotherapy (Kerl et al., 2013). In addition, HDACs are essential for angiogenesis by regulating the expression of angiogenic growth factors such as VEGF (Ha et al., 2008a). Largazole is a natural macrocyclic depsipeptide originally isolated from Floridian marine cyanobacterium Symploca sp and selectively inhibits the activity of class I HDACs (Hong and Luesch, 2012). Largazole inhibits tumor growth in a xenograft mouse model and shows potential as a drug for bone-related disorders by stimulating bone formation and inhibiting bone
620
H. Zhou et al. / European Journal of Pharmacology 740 (2014) 619–626
resorption (Bowers et al., 2009; Liu et al., 2010, 2013; Taori et al., 2008; Ying et al., 2008). The largazole structure–activity relationship (SAR) has been comprehensively reviewed (Hong and Luesch, 2012). Further studies showed that largazole regulates the expression of TGF, VEGF, VEGFR, collagen I, CD34 and bcl (Liu et al., 2013), indicating its important activity of controlling angiogenesis. Since CNV associated with inflammation and infection may cause impaired vision, in this study, we studied the effect of largazole on a mouse model of alkali-induced CNV. We found that topical application of largazole to the injured corneas attenuated CNV by down-regulating the expression of the pro-angiogenic factors VEGF, b-FGF, TGFβ1 and EGF but up-regulating the expression of the anti-angiogenic factors Thrombospondin-1 (Tsp-1), Tsp-2 and ADAMTS-1. Thus, largazole may have therapeutic potential for angiogenesis-related diseases such as CNV.
2. Materials and methods 2.1. Animals All animal protocols were approved by the institutional animal care committee and were in accordance to the Association for Research in Vision and Ophthalmology's Statement for the Use of Animals in Ophthalmology and Vision Research. All mice were female BALB/c mice, aged 6 to 8 weeks (purchased from Charles River Laboratories, Sulzfeld, Germany). Animals were kept in a specific pathogen-free facility. Animal care and use were in compliance with institutional guidelines.
was applied topically to the eye twice a day. Eyes were examined with a slit lamp (Zeiss, Germany) 7 and 14 days after alkali injury, or at the indicated time intervals. Mice were killed and the corneas were removed from both eyes. The corneas were placed immediately into RNALater (Qiagen) and kept at 80 1C until total RNA extraction, or were fixed in 10% neutral formalin buffer for histological analysis. Each experiment was repeated at least three times. 2.4. Immunohistochemical staining and enumeration of CNV The paraffin-embedded tissues were cut into 6-μm-thick slices and mounted on poly-L-lysine-coated slides which were subjected to immunohistochemical staining. Immunohistochemical analyses were performed using anti-CD31 Abs. The sections were incubated with Abs at a concentration of 1 μg/ml at 4 1C overnight. After incubation with peroxidase conjugated secondary Ab, the chromogen diaminobenzidine tetrahydrochloride (DAB) was added, until color had developed sufficiently. Sections were counterstained with Mayer's hematoxylin. The numbers and sizes of the CNV were then determined by an examiner with no knowledge of the experimental procedures. Images were captured with a digital camera and imported into Adobe Photoshop (version 7.0). The number of neovascular tubes per mm2 and the proportions of CNV in the hot spots were determined using NIH Image analysis software version 1.62 (National Institutes of Health, Bethesda, MD). The numbers and areas of CNV in central region of the cornea were evaluated on at least two sections from each eye. 2.5. Proliferation assay
2.2. Reagents and antibodies Goat anti-mouse PECAM-1 (CD31) polyclonal antibody was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). TRIzol reagent and ExScriptTM RT reagent kit were purchased from TaKaRa (TaKaRa Biotechnology Co. Ltd. DaLian, China). Brilliant SYBRs Green QPCR Master Mix was purchased from Stratagene (La Jolla, CA USA). Rabbit anti-goat IgG-peroxidase antibody was purchased from Sigma Inc (St. Louis, MO, USA). The structure of largazole is shown in Fig. 1 and is synthesized as described before (Zeng et al., 2010). The purity was over 99%. Most of other reagents such as salt and buffer components were analytical grade and obtained from Sigma. 2.3. Alkali-induced corneal injury model and topical application of largazole Mice were anesthetized with i.p. administration of kessodrate. A 2-mm disc of filter paper saturated with 1 N NaOH was placed onto the right cornea of each mouse for 40 s, followed by rinsing extensively with 25 ml of PBS. The corneal epithelia were removed using a corneal knife in a rotary motion parallel to the limbus by gently scraping over the corneal surface without injuring the underlying corneal stroma. Five microliters of largazole or carrier
NH
HEMC-1 cells were seeded in a 6-well plate at a density of 1 106 cells/well in growth medium until they reached 90% confluence. A scratch was made through each well using a sterile tip. The monolayer was incubated with a migration assay buffer consisting of serum-free medium and largazole (0, 0.12, 0.6 and 3 μg/ml). Images were captured at 0 h, 6 h, 12 h and 24 h. The area of healing wound was calculated with Image J software (Liang et al., 2007). 2.7. Real-time quantitative RT-PCR
N N
O
2.6. Migration assays
S
O
O
Human microvascular endothelial cell line (HMEC-1) was obtained from American Type Culture Collection (Manassas, VA). HMEC-1 cells were cultured in human endothelial-SFM (Invitrogen, Carlsbad, CA). Triplicate 0.2-ml cultures containing 2 105 cells were seeded in round-bottom 96-well microtiter plates. The cells were treated with largazole (0, 0.12, 0.6, 3.0 μg/mL) at 37 1C in a CO2 incubator for 48 h. MTT solution (10 μl of 5 mg/ml) was added to each well and the cells were further incubated for 4 h at 37 1C. The cells were then resuspended in 100 μl of 0.04 M HCl/isopropanol solution and the incubation was continued for 2 h to solubilize formazan violet crystals in the cells. The absorbance in each well was determined by spectrophotometry at the dual wavelengths of 570 and 630 nm on a microplate reader (Pharmacia, Sweden).
O
S
O N H
Largazole Fig. 1. Structure of largazole.
S
HEMC-1 cells were seeded in a 6-well plate at a density of 1 106 cells/well in growth medium and grew until reached 70% confluence. The cells were treated with largazole (0, 0.12, 0.6, 3 μg/ml) in the presence of LPS (100 ng/ml) for 4 h. The cell supernatants, lysates and RNA were collected for further experiments. Total RNA was extracted from the corneas or cultured HMEC1 cells with a TRIzol reagent kit and the cDNA was prepared by reverse transcription. Real-time PCR was performed on an Applied
H. Zhou et al. / European Journal of Pharmacology 740 (2014) 619–626
621
Table 1 Primer sequences of mouse and human for real-time RT-PCR.
Mouse
Gene
Sequence (50 to 30 )
TSP-1
Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense
GAAGCAACAAGTGGTGTCAGT ACAGTCTATGTAGAGTTGAGCCC CCTCAACTACTGGGTAGAAGGC TGACACTGTCGATAAGATCGCA TGCTCCAAGACATGCGGCTCAG TGGTACTGGCTGGCTTCACTTCC CATCTTCAAGCCGTCCTGTGT CTCCAGGGCTTCATCGTTACA CCCACCAGGCCACTTCAA GATGGATGCGCAGGAAGAA TCTACAACCAACACAACCCG TTGGACAACTGCTCCACCTT CTTATACAGGAATGGAGGCTGTG TTCACCTGACAGGATTGGATAAT TGAGCAAGAGAGAGGCCCTATC AGGCCCCTCCTGTTATTATG
Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense
AACATGCCACGGCCAACAAA TGCACTTGGCGTTCTTGTTGC AAGGATAACTGCCCCATCT CCGTCATTGTCATCGTCATC AAGGACAGGTGCAAGCTCAT GAGGTGGAATCTGGGCTACA TGCAGATTATGCGGATCAAACC TGCATTCACATTTGTTGTGCTGTAG CAGGCCCAGTTTCTGCCATT TTCCAGCTCAGCGTGGTCGTA CCAGCAAAAGCAGGGAGTCTGT TGTCTGTGTCATCGGAGTGATATCC GCAACAATTCCTGGCGATACC CTCCACGGCTCAACCACTG GTGTGTGCTAACCGTTACCT GCTCTTAGCAGACATTGGAAG ACTCTTCCAGCCTTCCTTCC AGCACTGTGTTGGCGTACAG
TSP-2 ADAMTS-1 VEGF bFGF TGF-β1 EGF GAPDH Human
TSP-1 TSP-2 ADAMTS-1 VEGF VEGFR-1 VEGFR-2 TGF-beta1 FGF2 β-Actin
NS
Product length
NS
109 67 71 118 139 93 87 95 104 81 82 100 111 217 117
100 50 0
Neovascular No/MM2
Day 7
Day 14
30
100
4
2
0
180 120 60 0
Largazole: 0 10
Largazole
150
Neovascular Area (%)
Largazole
NS
Neovascular No/MM2
Day 14
0
146
Largazole
Day 7
Largazole:
106
10
30 100 200 (μg/ml)
200 (μg/ml)
Fig. 2. The effect of topical largazole application on CNV. (A–D) 5 μl of 100 μg/ml largazole is topically applied on alkali-burn cornea twice a day. (A) Images are taken with slit lamp to show the frontal (left panels) and lateral (middle panels) view of each eye. (B) Corresponding cryosections from treated corneal tissues are immunostained with anti-CD31 Ab. Original magnification, 200. (C) and (D) Quantitative analysis of data are presented in (A) and (B). The CNV numbers per mm2 in hot spots (C) and % CNV areas in hot spots (D) are determined. (E) and (F) Dose–response of largazole in CNV. 5 μl of various doses of largazole are topically applied on alkali-burn corneas twice a day. (E) Images are taken and (F) quantitative analysis of data presented in (E). Data represent the means 7 S.E.M. (n¼ 6). *Po 0.05, largazole vs. saline-treated mice.
622
H. Zhou et al. / European Journal of Pharmacology 740 (2014) 619–626
Biosystems StepOne Real-Time PCR System using the comparative threshold cycle (CT) quantification method. Each reaction contained 12.5 μl of 2 SYBR green Master Mix, 300 nM oligonucleotide primers (Table 1) synthesized by Invitrogen Biotechnology Co. Ltd, (Shanghai, China), 10 μl of 1 in 10 dilution of the cDNA and water, to a total of 25 μl. The thermal cycling conditions included an initial denaturation at 95 1C for 10 min, 40 cycles at 95 1C for 30 s, 60 1C for 1 min, and 72 1C for 1 min. Each measurement of a sample was conducted in duplicate. All mRNA values were normalized against the levels of mouse β-actin or human GAPDH mRNA. The normalizing value derived from untreated control corneas or HMEC-1 cells was designated as 1 and the normalized values of treatment groups are expressed as fold increase over the untreated control group in y-axis.
inverted microscope using a 10 objective. Tube formation in cell culture was quantified by counting the tube-like structures in the gel and data were presented as the number of branches per field ( 100). In each experiment, 4 fields were calculated simultaneously and 3 independent experiments were performed. 2.9. Reproducibility and statistical analysis Experiments were repeated at least 3 times. Results were highly reproducible. Representative results are shown in the figures. The means and S.E.M. were calculated on all parameters determined in the study. Data were analyzed statistically using 1way ANOVA or 2-tailed Student's t test. A value of P o0.05 was accepted as statistically significant.
2.8. Tube formation assay 3. Results Tube formation assay was performed as described by Lin et al. (2006) and Sachdev et al. (2012). Briefly, HMEC1 cells were seeded on Matrigel at 40,000 cells/well in 96-well plates with LPS/largazole in depleted medium. The cells were cultured for 18 h at 37 1C in a 5% CO2 incubator. Photographs were taken on an
b-FGF
VEGF
30
3.1. Topical largazole application attenuated CNV. To determine the effect on angiogenesis, largazole (100 μg/ml) was topically applied on CNV induced by alkali burn. Fig. 2 shows
TGFβ1
15
EGF
12
Fold change
12 20
0
0 2
Fold change
4
2
TSP-1
60
4 TSP-2
18
40
5
4
12
0
2
0
4
2
4
ADAMTS-1
21
14 NS
20
6
0
Day
7
0 2
45
Fold change
8
6
10
Day
10
4
Largazole
0 2
4
2
4
Largazole(μg/ml): 0
10
30
100
30
15
0 VEGF
b-FGF
TGFβ1
EGF
TSP-1
TSP-2
ADAMTS-1
Fig. 3. Inhibition of angiogenic factor expression in Alkali-burn corneas by largazole. 5 μl of 100 μg/ml (A) or various doses (B) of largazole are topically applied on alkali-burn corneas twice a day. The mRNA expression of VEGF, b-FGF, TGFβ1, EGF, TSP-1. TSP-2 and ADAMTS-1 in wound sites on 2 and 4 day (A), or on 2 day (B) after injury is determined by quantitative RT-PCR. Results are expressed as the mean 7 S.E.M. of fold increase over control. nPo 0.05, largazole vs. saline-treated mice.
H. Zhou et al. / European Journal of Pharmacology 740 (2014) 619–626
3.2. Inhibition of angiogenic factor expression in alkali-injured corneas by largazole The balance of pro- and anti-angiogenic factors is important for angiogenesis. We next examined the effect of largazole on the expression of pro- and anti-angiogenic factors in alkali-burn corneal wounds. The mRNA expression of the pro-angiogenic factors VEGF, b-FGF, TGFβ1, EGF was down-regulated and the expression of anti-angiogenic factors Tsp-1, Tsp-2 and ADAMTS-1 was up-regulated in corneal wounds with the treatment of 100 μg/ml largazole (Fig. 3A). Furthermore, largazole dose-dependently
NS
regulated the expression of angiogenic factor genes (Fig. 3B). These data indicate that largazole may attenuate angiogenesis through down-regulation of pro-angiogenic factor expression but upregulation of anti-angiogenic factor expression in alkali-burn corneal wounds.
0.8 MTT (OD570)
that alkali burn in control mice resulted in a rapid neovascularization with limbal vessels sprouting into corneas at day 7 and reached a maximal level in 14 days after injury (Fig. 2A). However, fewer new blood vessels sprouting near the limbal area appeared in largazole-treated group (Fig. 2A). Immunohistochemical analysis using anti-CD31 antibody showed that vascular areas in largazole-treated mice were significantly smaller in comparison with control group (Fig. 2B–D). Further studies showed that largazole dose-dependently inhibited CNV with a maximum effect at 100 μg/ml (Fig. 2E and F). These data indicate that largazole has an inhibitory effect on angiogenesis in alkali-induced injured cornea.
623
0.4
0 Largazole :
0
0.12
0.6
3.0
(μg/ml)
Fig. 5. The effect of largazole on cell proliferation. HMEC-1 cells (2 105) are cultured with largazole (0, 0.12, 0.6, 3.0 μg/ml) at 37 1C in a CO2 incubator and the proliferation is determined by a MTT method. Shown are results from one representative experiment of three performed (in triplicates). n, statistically significant difference in values from vehicle-treated group (Po 0.05).
Largazole
0h
12 h
24 h
Fig. 4. Inhibition of HMEC-1 migration by largazole. Images of HMEC-1 cell migration which are assessed in a scratch assay are captured at the same position at 0 h, 12 h and 24 h after incubating with a migration assay buffer containing largazole or normal saline. The area of the wound is calculated with Image J software. nPo 0.05, largazole vs. saline-treated mice.
624
H. Zhou et al. / European Journal of Pharmacology 740 (2014) 619–626
NS VEGF
FGF2
Fold change
TGFβ1
100
200
* 0
8
4
180
140
2
90
0
0
0
Fold change
75
100
50
50
0
* **
25
*
*
0
**
0
0.12
0.6
TGFβ1 300
10
200
*
TSP-2 15
*
*
100
5
0
0
0
*
10
* *
*
*
3
TSP-1
15
5
8
*
0
FGF2
150
ADAMTS-1 270
280
Largazole (μg/ml): VEGF
TSP-2
420
4
0
TSP-1
12
*
50
100
Largazole
*
ADAMTS-1 180
** 120
* 60
0
Fig. 6. Angiogenic factor expression by largazole-treated HMEC-1 cells. HEMC-1 cells are seeded in a 6-well plate at a density of 1 106 cells/well in growth medium and grew until 70% confluence. The cells are treated with 0.6 μg/ml (A) or various doses (B) of largazole and LPS (100 ng/ml) for 4 h and RNA is extracted. The mRNA level for angiogenic factors is detected by RT-PCR and normalized to GAPDH mRNA. Results are expressed as the mean7 SE. *Po 0.05 compared to the untreated group.
LPS: Largazole :
0
1
1
1
1
0
0
0.12
0.6
3
(βμ/ml) (βμ/ml)
Fig. 7. The effect of largazole on tube formation in HMEC-1 cells. 40,000 HMEC1 cells/well are seeded on Matrigel containing LPS/largazole in depleted medium. The cells are cultured for 18 h at 37 1C 5% CO2. Tube formation is quantified by counting the tube-like structures in the gel and data are presented as the number of branches per field. Scale bar ¼200 μm.
3.3. The effect of largazole on HEMC-1 cell proliferation and migration The motility and proliferation of endothelial cells are key processes in angiogenesis. We examined the role of largazole in the motility and proliferation of a human microvascular endothelial cell line HMEC-1 cells (van der Meer et al., 2010). Fig. 4 shows that the healing area of HEMC-1 cells in largazole-treated group at the 24 h time point was reduced than that of control group in scratch assays. Fig. 5 shows that largazole inhibited cell proliferation in comparison to the control cells.
genes (Fig. 6B). These data suggest that largazole inhibits angiogenesis by enhancing the expression of anti-angiogenic factors by endothelial cells. 3.5. The effect of largazole on tube formation Tube formation is a critical process in neovascularization. We examined the effect of largazole on tube formation by HMEC-1 cells in vitro. Fig. 7 shows that largazole attenuates LPS-induced tube formation.
3.4. Angiogenic factor expression by largazole-treated HMEC-1 cells
4. Discussion
We then examined the effect of largazole on the expression of the pro-angiogenic factors VEGF, b-FGF, TGFβ1 and the antiangiogenic factors Tsp-1, Tsp-2 and ADAMTS-1 in LPS-treated HMEC-1 cells. The cells were treated with largazole (0.6 μg/ml) and LPS (100 ng/ml) for 4 h. Similar to the expression in alkaliburn wounds, largazole down-regulated the mRNA expression of pro-angiogenic factors but up-regulated the anti-angiogenic factors in HMEC-1 cells (Fig. 6A). Further study showed that largazole dose-dependently regulated the expression of angiogenic factor
Alkali burns of the cornea destroy surface epithelia and cause necrosis of the tissue, therefore may lead to CNV and vision damage. Glucocorticoids are widely used for the treatment of alkali injury of the eye. However, the therapeutic benefits are limited (Den et al., 2004; Sekundo et al., 2002). Thus, it is important to develop novel treatment of CNV. In this study, we demonstrated that topical application of largazole markedly attenuated CNV formation with down-regulation of pro-angiogenic factors but up-regulation of anti-angiogenic molecules, raising the
H. Zhou et al. / European Journal of Pharmacology 740 (2014) 619–626
possibility that largazole could be used as a therapeutic drug for corneal injury by preventing angiogenesis associated with inflammation. HDACs regulate the expression of genes by controlling the reversible dynamic modification and the degree of acetylation of chromatin regional core protein with HAT. Early study showed that global inhibition of HDAC activity inhibited angiogenesis by reducing the expression of pro-angiogenic factors and enhancing the expression of angiogenic inhibitors (Kerl et al., 2013). Recent studies also demonstrated that members of class IIa HDACs can regulate angiogenesis, in particular, HDAC5 and HDAC7 play an essential role in VEGF induction in vitro (Ha et al., 2008b; Martin et al., 2008; Mottet et al., 2007; Qian et al., 2006). In this study, we found that largazole, an inhibitor of class I HDACs, inhibited CNV induced by alkali injury (Fig. 2), indicating that class I HDACs may play an important role in angiogenesis. Further study showed that largazole inhibited the expression of pro-angiogenic factors but enhanced the expression of anti-angiogenic factors (Fig. 3), suggesting that largazole inhibits CNV by promoting the expression of these genes. VEGF is a key factor in angiogenesis by regulating the proliferation, migration, and survival of ECs (Gilabert-Estelles et al., 2007; Olsson et al., 2006; Wang et al., 2008). Other growth factors, such FGF, EGF and TGF also enhance endothelial proliferation and function (Cox et al., 2006; Takehara et al., 2004). The proliferation and migration of endothelial precursor cells are the basis for the formation of new vessels. Endothelial cell migration is initiated by the cells to a migratory phenotype. The endothelial precursor cells are guided to the position where the primary vascular plexus is formed (Kawano et al., 2005). Our study showed that largazole inhibited the proliferation, migration and tube formation of an endothelial cell line HMEC-1 (Figs. 4, 5, and 7). This may be due to the inhibitory effect of largazole on the expression of proangiogenic factors such as VEGF produced by endothelial cells. In conclusion, we found that topical application of largazole, an inhibitor of class I HDACs, to the injured corneas attenuated CNV and down-regulated the expression of the pro-angiogenic factors but up-regulated the expression of the anti-angiogenic factors in the injured corneas. Furthermore, largazole inhibited the expression of pro-angiogenic factors, migration, proliferation and tube formation by human microvascular endothelial cells (HEMC-1) in vitro. These data suggest that largazole has therapeutic potential for angiogenesis-associated diseases such as CNV.
Sources of funding This project was supported in part by the grants from Guangdong Natural Science Foundation (S2011010006048) and the Fundamental Research Funds of State Key Laboratory of Ophthalmology (303060202400439).
Acknowledgment We are grateful to Dr. Ji Ming Wang of the NCI, NIH for critique of the manuscript. References Bertos, N.R., Wang, A.H., Yang, X.J., 2001. Class II histone deacetylases: structure, function, and regulation. Biochem. Cell Biol. 79, 243–252. Bowers, A.A., West, N., Newkirk, T.L., Troutman-Youngman, A.E., Schreiber, S.L., Wiest, O., Bradner, J.E., Williams, R.M., 2009. Synthesis and histone deacetylase inhibitory activity of largazole analogs: alteration of the zinc-binding domain and macrocyclic scaffold. Org. Lett. 11, 1301–1304. Braza-Boils, A., Gilabert-Estelles, J., Ramon, L.A., Gilabert, J., Mari-Alexandre, J., Chirivella, M., Espana, F., Estelles, A., 2013. Peritoneal fluid reduces
625
angiogenesis-related microRNA expression in cell cultures of endometrial and endometriotic tissues from women with endometriosis. PLoS One 8, e62370. Cox, C.M., D’Agostino, S.L., Miller, M.K., Heimark, R.L., Krieg, P.A., 2006. Apelin, the ligand for the endothelial G-protein-coupled receptor, APJ, is a potent angiogenic factor required for normal vascular development of the frog embryo. Dev. Biol. 296, 177–189. Cress WD, S.E., 2000. Histone deacetylases, transcriptional control, and cancer. J. Cell. Physiol. 184, 1–16. Den, S., Sotozono, C., Kinoshita, S., Ikeda, T., 2004. Efficacy of early systemic betamethasone or cyclosporin A after corneal alkali injury via inflammatory cytokine reduction. Acta Ophthalmol. Scand. 82, 195–199. Folkman, J., 1995. Angiogenesis in cancer, vascular, rheumatoid and other disease. Nat. Med. 1, 27–31. Frantz, S., Vincent, K.A., Feron, O., Kelly, R.A., 2005. Innate immunity and angiogenesis. Circ. Res. 96, 15–26. Gao, L., Cueto, M.A., Asselbergs, F., Atadja, P., 2002. Cloning and functional characterization of HDAC11, a novel member of the human histone deacetylase family. J. Biol. Chem. 277, 25748–25755. Gilabert-Estelles, J., Ramon, L.A., Espana, F., Gilabert, J., Vila, V., Reganon, E., Castello, R., Chirivella, M., Estelles, A., 2007. Expression of angiogenic factors in endometriosis: relationship to fibrinolytic and metalloproteinase systems. Hum. Reprod. 22, 2120–2127. Glunde, K., Pathak, A.P., Bhujwalla, Z.M., 2007. Molecular-functional imaging of cancer: to image and imagine. Trends Mol. Med. 13, 287–297. Gray, S.G., Ekstrom, T.J., 2001. The human histone deacetylase family. Exp. Cell Res. 262, 75–83. Ha, C.H., Jhun, B.S., Kao, H.Y., Jin, Z.G., 2008a. VEGF stimulates HDAC7 phosphorylation and cytoplasmic accumulation modulating matrix metalloproteinase expression and angiogenesis. Arterioscler. Thromb. Vasc. Biol. 28, 1782–1788. Ha, C.H., Wang, W., Jhun, B.S., Wong, C., Hausser, A., Pfizenmaier, K., McKinsey, T.A., Olson, E.N., Jin, Z.G., 2008b. Protein kinase D-dependent phosphorylation and nuclear export of histone deacetylase 5 mediates vascular endothelial growth factor-induced gene expression and angiogenesis. J. Biol. Chem. 283, 14590–14599. Hong, J., Luesch, H., 2012. Largazole: from discovery to broad-spectrum therapy. Nat. Prod. Rep. 29, 449–456. Kawano, Y., Nakamura, S., Nasu, K., Fukuda, J., Narahara, H., Miyakawa, I., 2005. Expression and regulation of thrombospondin-1 by human endometrial stromal cells. Fertil. Steril. 83, 1056–1059. Kerl, K., Ries, D., Unland, R., Borchert, C., Moreno, N., Hasselblatt, M., Jurgens, H., Kool, M., Gorlich, D., Eveslage, M., Jung, M., Meisterernst, M., Fruhwald, M., 2013. The histone deacetylase inhibitor SAHA acts in synergism with fenretinide and doxorubicin to control growth of rhabdoid tumor cells. BMC Cancer 13, 286. Li, S., Fu, X.A., Zhou, X.F., Chen, Y.Y., Chen, W.Q., 2012. Angiogenesis-related cytokines in serum of proliferative diabetic retinopathy patients before and after vitrectomy. Int. J. Ophthalmol. 5, 726–730. Liang, C.C., Park, A.Y., Guan, J.L., 2007. in vitro scratch assay: a convenient and inexpensive method for analysis of cell migration in vitro. Nat. Protoc. 2, 329–333. Lin, C.M., Chang, H., Chen, Y.H., Li, S.Y., Wu, I.H., Chiu, J.H., 2006. Protective role of wogonin against lipopolysaccharide-induced angiogenesis via VEGFR-2, not VEGFR-1. Int. Immunopharmacol. 6, 1690–1698. Liu, Y., Salvador, L.A., Byeon, S., Ying, Y., Kwan, J.C., Law, B.K., Hong, J., Luesch, H., 2010. Anticolon cancer activity of largazole, a marine-derived tunable histone deacetylase inhibitor. J. Pharmacol. Exp. Ther. 335, 351–361. Liu, Y., Wang, Z., Wang, J., Lam, W., Kwong, S., Li, F., Friedman, S.L., Zhou, S., Ren, Q., Xu, Z., Wang, X., Ji, L., Tang, S., Zhang, H., Lui, E.L., Ye, T., 2013. A histone deacetylase inhibitor, largazole, decreases liver fibrosis and angiogenesis by inhibiting transforming growth factor-beta and vascular endothelial growth factor signalling. Liver Int. 33, 504–515. Mai, A., Massa, S., Pezzi, R., Simeoni, S., Rotili, D., Nebbioso, A., Scognamiglio, A., Altucci, L., Loidl, P., Brosch, G., 2005. Class II (IIa)-selective histone deacetylase inhibitors. 1. Synthesis and biological evaluation of novel (aryloxopropenyl) pyrrolyl hydroxyamides. J. Med. Chem. 48, 3344–3353. Martin, M., Kettmann, R., Dequiedt, F., 2007. Class IIa histone deacetylases: regulating the regulators. Oncogene 26, 5450–5467. Martin, M., Potente, M., Janssens, V., Vertommen, D., Twizere, J.C., Rider, M.H., Goris, J., Dimmeler, S., Kettmann, R., Dequiedt, F., 2008. Protein phosphatase 2A controls the activity of histone deacetylase 7 during T cell apoptosis and angiogenesis. Proc. Natl. Acad.Sci. U.S.A. 105, 4727–4732. Minucci, S., Pelicci, P.G., 2006. Histone deacetylase inhibitors and the promise of epigenetic (and more) treatments for cancer. Nat. Rev. Cancer 6, 38–51. Mottet, D., Bellahcene, A., Pirotte, S., Waltregny, D., Deroanne, C., Lamour, V., Lidereau, R., Castronovo, V., 2007. Histone deacetylase 7 silencing alters endothelial cell migration, a key step in angiogenesis. Circ. Res. 101, 1237–1246. Olsson, A.K., Dimberg, A., Kreuger, J., Claesson-Welsh, L., 2006. VEGF receptor signalling—in control of vascular function. Nat. Rev. Mol. Cell Biol. 7, 359–371. Qian, D.Z., Kato, Y., Shabbeer, S., Wei, Y., Verheul, H.M., Salumbides, B., Sanni, T., Atadja, P., Pili, R., 2006. Targeting tumor angiogenesis with histone deacetylase inhibitors: the hydroxamic acid derivative LBH589. Clin. Cancer Res. 12, 634–642. Saber, T., Veale, D.J., Balogh, E., McCormick, J., NicAnUltaigh, S., Connolly, M., Fearon, U., 2011. Toll-like receptor 2 induced angiogenesis and invasion is mediated through the Tie2 signalling pathway in rheumatoid arthritis. PLoS One 6, e23540.
626
H. Zhou et al. / European Journal of Pharmacology 740 (2014) 619–626
Sachdev, U., Cui, X., Hong, G., Namkoong, S., Karlsson, J.M., Baty, C.J., Tzeng, E., 2012. High mobility group box 1 promotes endothelial cell angiogenic behavior in vitro and improves muscle perfusion in vivo in response to ischemic injury. J. Vasc. Surg. 55, 180–191. Sekundo, W., Augustin, A.J., Strempel, I., 2002. Topical allopurinol or corticosteroids and acetylcysteine in the early treatment of experimental corneal alkali burns: a pilot study. Eur. J. Ophthalmol. 12, 366–372. Takehara, M., Ueda, M., Yamashita, Y., Terai, Y., Hung, Y.C., Ueki, M., 2004. Vascular endothelial growth factor A and C gene expression in endometriosis. Hum. Pathol. 35, 1369–1375. Taori, K., Paul, V.J., Luesch, H., 2008. Structure and activity of largazole, a potent antiproliferative agent from the Floridian marine cyanobacterium Symploca sp. J. Am. Chem. Soc. 130, 1806–1807. van der Meer, A.D., Vermeul, K., Poot, A.A., Feijen, J., Vermes, I., 2010. A microfluidic wound-healing assay for quantifying endothelial cell migration. Am. J. Physiol. Heart Circ. Physiol. 298, H719–725.
Wang, S., Li, X., Parra, M., Verdin, E., Bassel-Duby, R., Olson, E.N., 2008. Control of endothelial cell proliferation and migration by VEGF signaling to histone deacetylase 7. Proc. Natl. Acad. Sci. U.S.A. 105, 7738–7743. Ying, Y., Taori, K., Kim, H., Hong, J., Luesch, H., 2008. Total synthesis and molecular target of largazole, a histone deacetylase inhibitor. J. Am. Chem. Soc. 130, 8455–8459. Zeng, X., Yin, B., Hu, Z., Liao, C., Liu, J., Li, S., Li, Z., Nicklaus, M.C., Zhou, G., Jiang, S., 2010. Total synthesis and biological evaluation of largazole and derivatives with promising selectivity for cancers cells. Org. Lett. 12, 1368–1371. Zhou, B., Margariti, A., Zeng, L., Xu, Q., 2011. Role of histone deacetylases in vascular cell homeostasis and arteriosclerosis. Cardiovasc. Res. 90, 413–420.
