Original Paper Received: January 21, 2014 Accepted after revision: July 25, 2014 Published online: May 13, 2015
Caries Res 2015;49:370–377 DOI: 10.1159/000366211
Lactotransferrin Gene Polymorphism Associated with Caries Experience Andrea D. Doetzer a João A. Brancher a Giovana D. Pecharki a Nina Schlipf b Renata Werneck a Marcelo T. Mira a Olaf Riess b Peter Bauer b, c Paula Cristina Trevilatto a, c
a
Core for Advanced Molecular Investigation (COMI), School of Health and Biosciences, Pontifícia Universidade Católica do Paraná (PUCPR), Curitiba, PR, Brazil; b Department of Medical Genetics, University of Tübingen, Tübingen, Germany; c Both authors share last authorship
Abstract Dental caries is a common multifactorial disease, resulting from the interaction of biofilm, cariogenic diet and host response over time. Lactotransferrin (LTF) is a main salivary glycoprotein, which modulates the host immune-inflammatory and antibacterial response. Although a genetic component for caries outcome has been identified, little is known over the genetic aspects underlying its susceptibility. Thus, the aim of this study was to investigate the association between LTF polymorphisms and caries susceptibility. Six hundred seventy seven 12-year-old students were selected: 346 with (DMFT ≥ 1) and 331 without caries experience (DMFT = 0). Also, individuals concentrating higher levels of disease (polarization group, DMFT ≥ 2, n = 253) were tested against those with DMFT ≤ 1 (n = 424). Along with clinical parameters, three representative LTF tag SNPs (rs6441989, rs2073495, rs11716497) were genotyped and the results were evaluated using univariate and multivariate analyses.
© 2015 S. Karger AG, Basel 0008–6568/15/0494–0370$39.50/0 E-Mail [email protected] www.karger.com/cre
Allele A for tag SNP rs6441989 was found to be significantly less frequent in the polarization group, conferring a protective effect against caries experience [AA + AG × GG (OR: 0.710, 95% CI: 0.514–0.980, p = 0.045)], and remained significantly associated with caries protection in the presence of gingivitis (p = 0.020) and plaque (p = 0.035). These results might contribute to the understanding of the genetic con© 2015 S. Karger AG, Basel trol of caries susceptibility in humans.
Introduction
One of the most important and common diseases that affects the population in several socioenvironmental and biological levels is dental caries, an infectious, multifactorial disease caused by an imbalance between the interaction of specific microbiota along with cariogenic diet and host response over time [Newbrun, 1978; Nordlund et al., 2009; Simón-Soro et al., 2013]. The contribution of behavioral [Chandra et al., 2009], environmental [Peres et al., 2009] and genetic risk factors in caries development Paula Cristina Trevilatto School of Health and Biosciences Pontifícia Universidade Católica do Paraná (PUCPR) Rua Imaculada Conceição, 1155, Curitiba, PR 80215-901 (Brazil) E-Mail paula.trevilatto @ pucpr.br
Downloaded by: NYU Medical Center Library 128.122.253.212 - 6/3/2015 5:43:08 AM
Key Words Caries · LTF · Tag SNPs · Susceptibility
[Werneck et al., 2010] has been well recognized. A global reduction in the prevalence of dental caries has been reported worldwide. This decrease may be due to improvement in the socioeconomical aspects [Oliveira et al., 2008], the presence of fluoride in toothpastes [Twetman, 2009], fluoride in the water supply [Evans et al., 2009], and better hygiene instruction [Longbottom et al., 2009]. In spite of such decrease, a great deal of investment is still being employed in dental treatments, instead of in developing preventive techniques. There has been evidence of caries concentration in some small groups (phenomenon termed polarization), who seem to be more susceptible to disease outcome [Peres et al., 2008]. Although a significant genetic component has been suggested by twin studies, [Bretz et al., 2005], very little is known about the genetic background underlying the susceptibility to dental caries [Werneck et al., 2010]. Recently, our group by means of complex segregation analysis identified a dominant, major gene effect controlling resistance to caries [Werneck et al., 2011]. However, the number and identity of the genes responsible for this effect is still unknown. Additionally, a linkage genomic scan was performed for dental caries and genomic regions were identified, harboring genes related with saliva properties and diet preference (host response) that could be functional candidate genes for susceptibility to caries [Vieira et al., 2008]. The linked regions associated with low caries susceptibility were fine-mapped and BTF3 (basic transcription factor 3) [Shimizu et al., 2013] as well as GR (glucocorticoid receptor) [Kuecheler et al., 2013] were associated and might have a functional role in protecting against caries. Saliva is one of the host factors that interact with the biofilm, influencing cariogenicity through its flow [Mese and Matsuo, 2007], composition and buffer capacity [Dawes, 2008]. One of the glycoproteins that composes saliva, involved in immune-inflammatory response is lactotransferrin (LTF) [Bournazou et al., 2009]. LTF is present in several fluids of the body, as well as in neutrophil second granules and exocrine glands [Pierce et al., 2009], playing an important role in antibacterial activities against Streptococcus mutans, the main bacteria that initiates caries lesions [Berlutti et al., 2004]. It binds to serum Fe+++, decreasing its availability to bacteria, therefore working as bacteriostatic agent [Arslan et al., 2009]. LTF gene is located on chromosome 3p21 and presents 17 exons. Polymorphisms in the LTF gene were reported to be associated with herpes simplex keratitis [Keijser et al., 2008], aggressive periodontitis [Wu et al., 2009], and car-
ies [Azevedo et al., 2010]. However, there are few studies investigating the association of polymorphisms in salivary protein genes with caries susceptibility [Jonasson et al., 2007; Peres et al., 2010; Schlafer et al., 2012; Gasse et al., 2013; Krasone et al., 2014]. Single nucleotide polymorphisms (SNPs) are nucleotide exchanges in the gene sequences that generate common alleles in the population and may modulate the protein expression rate and function. Nearby sets of SNPs are inherited in blocks or haplotypes. These blocks usually contain a large number of SNPs, and can be represented by few of them. These SNPs that represent sets of others are called tag SNPs [International Hapmap Project, 2008]. Tag SNPs capture the whole information of a gene in terms of variability and may influence individual susceptibility to diseases [Liu et al., 2010]. There are only a few studies analyzing the association of LTF gene polymorphism (rs1126478) with caries susceptibility [Azevedo et al., 2010; Fine et al., 2013]. Moreover, those studies analyzed only the second exon of LTF. Thus, the aim of this study was to investigate the association of tag SNPs in the whole LTF gene with susceptibility to dental caries in 12-year-old students.
Genetic Protective Effect of Lactotransferrin on Caries
Caries Res 2015;49:370–377 DOI: 10.1159/000366211
Sample Selection The sample was composed of 677 unrelated students from both sexes with a mean age of 12 from 6 private and 6 public schools of Curitiba-PR, Brazil. Curitiba is a city in southern Brazil with 1.8 million inhabitants. The sample was calculated using the Statcalc, Epi-Info Version 6 [O’Mullane, 1994], considering 50% for caries prevalence pattern, 5% error and 95% confidence level. The results showed that 379 individuals would be sufficient to give power for the analysis, considering 30,000 12-year-old subjects in Curitiba city. The scholars were not included if they were smokers, were using orthodontic appliances or taking chronic anti-inflammatory and/or antibiotics over the last three months. The students were volunteers and selected for study only if the parent/caregiver returned the informed consent form, according to norms of the Ethical Committee on Research of the School of Health and Biosciences of Pontifical Catholic University of Paraná (PUCPR), Resolution 96/96 of the Health National Council, register no. 487, obtained prior to the study. The students were diagnosed according to the decayed, missing, and filled teeth (DMFT) index in accordance with the WHO [WHO, 1997] guidelines. Two calibrated examiners performed all evaluations. Inter- and intra-examiner reproducibility was taken on 10% of the sample and the Kappa test was used to measure reliability. The obtained values for Kappa test were 0.93 for inter- and 0.99 for intra-examiner. Individuals were divided into two groups, according to the caries experience: Without (WHC): 331 individuals without caries experience (DMFT = 0);
371
Downloaded by: NYU Medical Center Library 128.122.253.212 - 6/3/2015 5:43:08 AM
Materials and Methods
Table 1. LTF gene primers and hybrid probes
Tag SNP
SNP alleles
Fragment length (bp)
Primers
Sequence 5′→3′
rs6441989
A/G
204
rs2073495
C/G
234
rs11716497
A/G
183
F* R** F R F R
Ψ M13-AACTCACGACTGCTCCCACT revM13-CTCTTTTGTCTAATCACTACGGAGG M13-CACCACGGCATGATTCGGGGCCATG revM13-CATTCCACTGACCTCCCAAATGCAC M13-TTCTGAGCCATCCCCTTATG revM13-CTAGCTGCCATACTCCC
Tag SNP
SNP alleles
Fragment length (bp)
Probe
sequence 5′→3′
rs6441989 rs2073495 rs11716497
A/G C/G A/G
204 234 183
P1 P2 P3
CCCTTCTTCCACACCCCCCCTTCTCA CTTAGCCCATGCCTCATTGTTATTT CTGAGTCTGCAGAGGTTTGGGGACA
* F = Forward; ** R = reverse; Ψ M13 = sequencing primer.
dents with Northern and Western European ancestry from the CEPH collection) was chosen due to the major European ancestry of the South Brazilian population. Following these criteria, 3 tag SNPs were included: rs11716497, rs2073495, and rs6441989, the latter located in the intergenic region between LTF and chemokine (C-C motif) receptor-like-2 (CCRL2) genes. The primers and hybrid probes used to screen the LTF gene (ENSG0000 0012223) were designed to flank and amplify the 3 tag SNPs representative of the whole LTF gene (table 1). Primer sequences are also available in table 1. The 3 tag SNPs were analyzed by high resolution melting (HRM) with a 465–510 SYBR Green I/ HRM Dye. The polymerase chain reaction (PCR) and HRM were performed in a single run on a LightCycler®480 instrument (Roche Diagnostics, Mannheim, Germany) with a total reaction volume of 10 μl in a 384-well microtiter plate. The LightCycler plate was centrifuged for 5 min to eliminate air bubbles that might disturb fluorescence. The reaction mixture contained 2 μl 10 ng genomic DNA, 1.2 μl 2.5 m M MgCl 2 , 0.4 μl 10 pmol each primer, 1 μl hybrid probe at 10 pmol, and 5 μl LightCycler®480 High Resolution Master Mix (Roche Diagnostics, Mannheim, Germany). The PCR touchdown cycling protocol consisted of an initial heating step at 95 ° C for 10 min followed by 45 cycles of denaturation at 95 ° C for 10 s, annealing starting at 68 ° C for 15 s (decreasing 1 ° C per cycle, in the first 10 cycles) and extension at 72 ° C for 20 s. After amplification, the amplicons were first heated to 95 ° C for 1 min, hybridized with probes at tag SNPs site at 40 ° C for 1 min and then the HMR program went over the range from 65 ° C to 95 ° C with 25 signal acquisitions per degree. Melting curve analysis of amplicon was performed with Tm Calling module, software version 1.5. After analyzing genotypes results, one sample of each group was sequenced to validate the results.
LTF Gene Amplification and High Resolution Melting Analysis Tag SNP markers were selected according to the information available at the International Hapmap Project website, release 24 [International Hapmap Project, 2008]. All selected markers presented a minor allele frequency of 0.25. The cutoff parameter to define linkage disequilibrium (LD) between two markers was a pairwise r2 > 0.8. Caucasian population (CEU-Utah resi-
372
Caries Res 2015;49:370–377 DOI: 10.1159/000366211
DNA Collection Epithelial cells DNA of oral mucosa was collected and extracted according to previously published protocols [Trevilatto and Line, 2000; Aidar and Line, 2007].
Statistical Analysis Nominal variables were expressed as frequencies and percentages. To access the association between nominal variables, χ2, Fisher’s test, Mantel Haenszel exact test, and Odds Ratio (OR) estimation were used. The continuous variables were accessed by
Doetzer/Brancher/Pecharki/Schlipf/ Werneck/Mira/Riess/Bauer/Trevilatto
Downloaded by: NYU Medical Center Library 128.122.253.212 - 6/3/2015 5:43:08 AM
With Caries (WC): 346 individuals with caries experience (DMFT ≥1). The sample was also analyzed focusing on polarization aspects, once caries mean index in Curitiba is 1.53 [Curitiba Health Program, 2010], and the sample was divided into: Group 1 (G1): 424 individuals with low caries experience (DMFT ≤1); Group 2 (G2): 253 individuals with high caries experience (DMFT ≥2). The following clinical variables were evaluated: fluorosis, salivary flow, buffer capacity, gingivitis, and presence of plaque. The presence of any degree of fluorosis was established according to Dean’s index [WHO, 1997]. The stimulated salivary flow rate (SSFR) was measured as previously described [de Almeida Pdel et al., 2008]. The buffering capacity (BC) was performed as described previously [Ericsson, 1959]. The final pH value of the mixture was determined according to Kitasako et al. [2005]. Individuals were considered positive for gingivitis when all teeth from at least one sextant were affected, with bleeding and inflammation [WHO, 1997]. The biofilm accumulation was verified by the Plaque Index (PI) [Loe and Silness, 1963] modified, which adopted the same criteria, but evaluating 6 teeth surfaces: 16 [buccal (B)], 12 B, 26 [lingual (L)], 36 B, 32 L, and 46 L.
Table 2. Baseline characteristics and clinical parameters of all sampled subjects (n = 677)
Variables Ethnic group, n (%) Caucasian African-American Asian Gender, n (%) Female Male Clinical variables Fluorosis Salivary flow ≤0.5 ml/min Buffer capacity pH
Caries Res 2015;49:370–377 DOI: 10.1159/000366211
Lactotransferrin Gene Polymorphism Associated with Caries Experience Andrea D. Doetzer a João A. Brancher a Giovana D. Pecharki a Nina Schlipf b Renata Werneck a Marcelo T. Mira a Olaf Riess b Peter Bauer b, c Paula Cristina Trevilatto a, c
a
Core for Advanced Molecular Investigation (COMI), School of Health and Biosciences, Pontifícia Universidade Católica do Paraná (PUCPR), Curitiba, PR, Brazil; b Department of Medical Genetics, University of Tübingen, Tübingen, Germany; c Both authors share last authorship
Abstract Dental caries is a common multifactorial disease, resulting from the interaction of biofilm, cariogenic diet and host response over time. Lactotransferrin (LTF) is a main salivary glycoprotein, which modulates the host immune-inflammatory and antibacterial response. Although a genetic component for caries outcome has been identified, little is known over the genetic aspects underlying its susceptibility. Thus, the aim of this study was to investigate the association between LTF polymorphisms and caries susceptibility. Six hundred seventy seven 12-year-old students were selected: 346 with (DMFT ≥ 1) and 331 without caries experience (DMFT = 0). Also, individuals concentrating higher levels of disease (polarization group, DMFT ≥ 2, n = 253) were tested against those with DMFT ≤ 1 (n = 424). Along with clinical parameters, three representative LTF tag SNPs (rs6441989, rs2073495, rs11716497) were genotyped and the results were evaluated using univariate and multivariate analyses.
© 2015 S. Karger AG, Basel 0008–6568/15/0494–0370$39.50/0 E-Mail [email protected] www.karger.com/cre
Allele A for tag SNP rs6441989 was found to be significantly less frequent in the polarization group, conferring a protective effect against caries experience [AA + AG × GG (OR: 0.710, 95% CI: 0.514–0.980, p = 0.045)], and remained significantly associated with caries protection in the presence of gingivitis (p = 0.020) and plaque (p = 0.035). These results might contribute to the understanding of the genetic con© 2015 S. Karger AG, Basel trol of caries susceptibility in humans.
Introduction
One of the most important and common diseases that affects the population in several socioenvironmental and biological levels is dental caries, an infectious, multifactorial disease caused by an imbalance between the interaction of specific microbiota along with cariogenic diet and host response over time [Newbrun, 1978; Nordlund et al., 2009; Simón-Soro et al., 2013]. The contribution of behavioral [Chandra et al., 2009], environmental [Peres et al., 2009] and genetic risk factors in caries development Paula Cristina Trevilatto School of Health and Biosciences Pontifícia Universidade Católica do Paraná (PUCPR) Rua Imaculada Conceição, 1155, Curitiba, PR 80215-901 (Brazil) E-Mail paula.trevilatto @ pucpr.br
Downloaded by: NYU Medical Center Library 128.122.253.212 - 6/3/2015 5:43:08 AM
Key Words Caries · LTF · Tag SNPs · Susceptibility
[Werneck et al., 2010] has been well recognized. A global reduction in the prevalence of dental caries has been reported worldwide. This decrease may be due to improvement in the socioeconomical aspects [Oliveira et al., 2008], the presence of fluoride in toothpastes [Twetman, 2009], fluoride in the water supply [Evans et al., 2009], and better hygiene instruction [Longbottom et al., 2009]. In spite of such decrease, a great deal of investment is still being employed in dental treatments, instead of in developing preventive techniques. There has been evidence of caries concentration in some small groups (phenomenon termed polarization), who seem to be more susceptible to disease outcome [Peres et al., 2008]. Although a significant genetic component has been suggested by twin studies, [Bretz et al., 2005], very little is known about the genetic background underlying the susceptibility to dental caries [Werneck et al., 2010]. Recently, our group by means of complex segregation analysis identified a dominant, major gene effect controlling resistance to caries [Werneck et al., 2011]. However, the number and identity of the genes responsible for this effect is still unknown. Additionally, a linkage genomic scan was performed for dental caries and genomic regions were identified, harboring genes related with saliva properties and diet preference (host response) that could be functional candidate genes for susceptibility to caries [Vieira et al., 2008]. The linked regions associated with low caries susceptibility were fine-mapped and BTF3 (basic transcription factor 3) [Shimizu et al., 2013] as well as GR (glucocorticoid receptor) [Kuecheler et al., 2013] were associated and might have a functional role in protecting against caries. Saliva is one of the host factors that interact with the biofilm, influencing cariogenicity through its flow [Mese and Matsuo, 2007], composition and buffer capacity [Dawes, 2008]. One of the glycoproteins that composes saliva, involved in immune-inflammatory response is lactotransferrin (LTF) [Bournazou et al., 2009]. LTF is present in several fluids of the body, as well as in neutrophil second granules and exocrine glands [Pierce et al., 2009], playing an important role in antibacterial activities against Streptococcus mutans, the main bacteria that initiates caries lesions [Berlutti et al., 2004]. It binds to serum Fe+++, decreasing its availability to bacteria, therefore working as bacteriostatic agent [Arslan et al., 2009]. LTF gene is located on chromosome 3p21 and presents 17 exons. Polymorphisms in the LTF gene were reported to be associated with herpes simplex keratitis [Keijser et al., 2008], aggressive periodontitis [Wu et al., 2009], and car-
ies [Azevedo et al., 2010]. However, there are few studies investigating the association of polymorphisms in salivary protein genes with caries susceptibility [Jonasson et al., 2007; Peres et al., 2010; Schlafer et al., 2012; Gasse et al., 2013; Krasone et al., 2014]. Single nucleotide polymorphisms (SNPs) are nucleotide exchanges in the gene sequences that generate common alleles in the population and may modulate the protein expression rate and function. Nearby sets of SNPs are inherited in blocks or haplotypes. These blocks usually contain a large number of SNPs, and can be represented by few of them. These SNPs that represent sets of others are called tag SNPs [International Hapmap Project, 2008]. Tag SNPs capture the whole information of a gene in terms of variability and may influence individual susceptibility to diseases [Liu et al., 2010]. There are only a few studies analyzing the association of LTF gene polymorphism (rs1126478) with caries susceptibility [Azevedo et al., 2010; Fine et al., 2013]. Moreover, those studies analyzed only the second exon of LTF. Thus, the aim of this study was to investigate the association of tag SNPs in the whole LTF gene with susceptibility to dental caries in 12-year-old students.
Genetic Protective Effect of Lactotransferrin on Caries
Caries Res 2015;49:370–377 DOI: 10.1159/000366211
Sample Selection The sample was composed of 677 unrelated students from both sexes with a mean age of 12 from 6 private and 6 public schools of Curitiba-PR, Brazil. Curitiba is a city in southern Brazil with 1.8 million inhabitants. The sample was calculated using the Statcalc, Epi-Info Version 6 [O’Mullane, 1994], considering 50% for caries prevalence pattern, 5% error and 95% confidence level. The results showed that 379 individuals would be sufficient to give power for the analysis, considering 30,000 12-year-old subjects in Curitiba city. The scholars were not included if they were smokers, were using orthodontic appliances or taking chronic anti-inflammatory and/or antibiotics over the last three months. The students were volunteers and selected for study only if the parent/caregiver returned the informed consent form, according to norms of the Ethical Committee on Research of the School of Health and Biosciences of Pontifical Catholic University of Paraná (PUCPR), Resolution 96/96 of the Health National Council, register no. 487, obtained prior to the study. The students were diagnosed according to the decayed, missing, and filled teeth (DMFT) index in accordance with the WHO [WHO, 1997] guidelines. Two calibrated examiners performed all evaluations. Inter- and intra-examiner reproducibility was taken on 10% of the sample and the Kappa test was used to measure reliability. The obtained values for Kappa test were 0.93 for inter- and 0.99 for intra-examiner. Individuals were divided into two groups, according to the caries experience: Without (WHC): 331 individuals without caries experience (DMFT = 0);
371
Downloaded by: NYU Medical Center Library 128.122.253.212 - 6/3/2015 5:43:08 AM
Materials and Methods
Table 1. LTF gene primers and hybrid probes
Tag SNP
SNP alleles
Fragment length (bp)
Primers
Sequence 5′→3′
rs6441989
A/G
204
rs2073495
C/G
234
rs11716497
A/G
183
F* R** F R F R
Ψ M13-AACTCACGACTGCTCCCACT revM13-CTCTTTTGTCTAATCACTACGGAGG M13-CACCACGGCATGATTCGGGGCCATG revM13-CATTCCACTGACCTCCCAAATGCAC M13-TTCTGAGCCATCCCCTTATG revM13-CTAGCTGCCATACTCCC
Tag SNP
SNP alleles
Fragment length (bp)
Probe
sequence 5′→3′
rs6441989 rs2073495 rs11716497
A/G C/G A/G
204 234 183
P1 P2 P3
CCCTTCTTCCACACCCCCCCTTCTCA CTTAGCCCATGCCTCATTGTTATTT CTGAGTCTGCAGAGGTTTGGGGACA
* F = Forward; ** R = reverse; Ψ M13 = sequencing primer.
dents with Northern and Western European ancestry from the CEPH collection) was chosen due to the major European ancestry of the South Brazilian population. Following these criteria, 3 tag SNPs were included: rs11716497, rs2073495, and rs6441989, the latter located in the intergenic region between LTF and chemokine (C-C motif) receptor-like-2 (CCRL2) genes. The primers and hybrid probes used to screen the LTF gene (ENSG0000 0012223) were designed to flank and amplify the 3 tag SNPs representative of the whole LTF gene (table 1). Primer sequences are also available in table 1. The 3 tag SNPs were analyzed by high resolution melting (HRM) with a 465–510 SYBR Green I/ HRM Dye. The polymerase chain reaction (PCR) and HRM were performed in a single run on a LightCycler®480 instrument (Roche Diagnostics, Mannheim, Germany) with a total reaction volume of 10 μl in a 384-well microtiter plate. The LightCycler plate was centrifuged for 5 min to eliminate air bubbles that might disturb fluorescence. The reaction mixture contained 2 μl 10 ng genomic DNA, 1.2 μl 2.5 m M MgCl 2 , 0.4 μl 10 pmol each primer, 1 μl hybrid probe at 10 pmol, and 5 μl LightCycler®480 High Resolution Master Mix (Roche Diagnostics, Mannheim, Germany). The PCR touchdown cycling protocol consisted of an initial heating step at 95 ° C for 10 min followed by 45 cycles of denaturation at 95 ° C for 10 s, annealing starting at 68 ° C for 15 s (decreasing 1 ° C per cycle, in the first 10 cycles) and extension at 72 ° C for 20 s. After amplification, the amplicons were first heated to 95 ° C for 1 min, hybridized with probes at tag SNPs site at 40 ° C for 1 min and then the HMR program went over the range from 65 ° C to 95 ° C with 25 signal acquisitions per degree. Melting curve analysis of amplicon was performed with Tm Calling module, software version 1.5. After analyzing genotypes results, one sample of each group was sequenced to validate the results.
LTF Gene Amplification and High Resolution Melting Analysis Tag SNP markers were selected according to the information available at the International Hapmap Project website, release 24 [International Hapmap Project, 2008]. All selected markers presented a minor allele frequency of 0.25. The cutoff parameter to define linkage disequilibrium (LD) between two markers was a pairwise r2 > 0.8. Caucasian population (CEU-Utah resi-
372
Caries Res 2015;49:370–377 DOI: 10.1159/000366211
DNA Collection Epithelial cells DNA of oral mucosa was collected and extracted according to previously published protocols [Trevilatto and Line, 2000; Aidar and Line, 2007].
Statistical Analysis Nominal variables were expressed as frequencies and percentages. To access the association between nominal variables, χ2, Fisher’s test, Mantel Haenszel exact test, and Odds Ratio (OR) estimation were used. The continuous variables were accessed by
Doetzer/Brancher/Pecharki/Schlipf/ Werneck/Mira/Riess/Bauer/Trevilatto
Downloaded by: NYU Medical Center Library 128.122.253.212 - 6/3/2015 5:43:08 AM
With Caries (WC): 346 individuals with caries experience (DMFT ≥1). The sample was also analyzed focusing on polarization aspects, once caries mean index in Curitiba is 1.53 [Curitiba Health Program, 2010], and the sample was divided into: Group 1 (G1): 424 individuals with low caries experience (DMFT ≤1); Group 2 (G2): 253 individuals with high caries experience (DMFT ≥2). The following clinical variables were evaluated: fluorosis, salivary flow, buffer capacity, gingivitis, and presence of plaque. The presence of any degree of fluorosis was established according to Dean’s index [WHO, 1997]. The stimulated salivary flow rate (SSFR) was measured as previously described [de Almeida Pdel et al., 2008]. The buffering capacity (BC) was performed as described previously [Ericsson, 1959]. The final pH value of the mixture was determined according to Kitasako et al. [2005]. Individuals were considered positive for gingivitis when all teeth from at least one sextant were affected, with bleeding and inflammation [WHO, 1997]. The biofilm accumulation was verified by the Plaque Index (PI) [Loe and Silness, 1963] modified, which adopted the same criteria, but evaluating 6 teeth surfaces: 16 [buccal (B)], 12 B, 26 [lingual (L)], 36 B, 32 L, and 46 L.
Table 2. Baseline characteristics and clinical parameters of all sampled subjects (n = 677)
Variables Ethnic group, n (%) Caucasian African-American Asian Gender, n (%) Female Male Clinical variables Fluorosis Salivary flow ≤0.5 ml/min Buffer capacity pH
