Appl Biochem Biotechnol DOI 10.1007/s12010-014-1404-2

Lactobacillus crustorum KH: Novel Prospective Probiotic Strain Isolated from Iranian Traditional Dairy Products Hakimeh Sharafi & Venos Derakhshan & Mojgan Paknejad & Leila Alidoust & Azadeh Tohidi & Majid Pornour & Hamidreza Hajfarajollah & Hossein Shahbani Zahiri & Kambiz Akbari Noghabi

Received: 23 May 2014 / Accepted: 13 November 2014 # Springer Science+Business Media New York 2014

Abstract In recent years, exploring novel probiotic strains for therapeutic intervention has been raised due to the significant increase in market demand. This study aimed to investigate the certain probiotic properties of 15 Lactobacillus isolates from Iranian traditional dairy products. Among them, a novel potential probiotic strain was isolated and identified as Lactobacillus crustorum. The characteristics of potential probiotics were examined in terms of resistance to acidity, bile, and salinity as well as antibiotic tolerance and antibacterial activity. L. crustorum KH has shown tolerance property to bile (0.3 % w), acidity (pH 2–9), and salinity (1–5 % NaCl) and strong antibacterial activity against tested enteropathogens by well-diffusion assay. Furthermore, in vivo study and histological assays were performed to study whether live and heat-killed cells of L. crustorum KH are able to protect against the challenge of Escherichia coli O157:H7 in the gastrointestinal tract of mice used as an experimental model. Therefore, heat-killed and live cells of L. crustorum KH were inoculated by gavage to different groups of 4–6-week-old female BALB/c mice in doses of 108 colonyforming unit (CFU)/dose. Thereafter, these mice were challenged with E. coli O157:H7 also inoculated in the gastrointestinal tract (GIT) of the animals. The results showed that heat-killed cells of L. crustorum KH exert a protective effect against E. coli O157:H7 colonization at different degrees, being lower than that produced by viable cells. Keywords Probiotics . Lactobacillus crustorum KH . BALB/c . E. coli O157:H7

Hakimeh Sharafi and Venos Derakhshan contributed equally to this work.

H. Sharafi : V. Derakhshan : M. Paknejad : L. Alidoust : A. Tohidi : M. Pornour : H. Hajfarajollah : H. S. Zahiri : K. A. Noghabi (*) Division of Industrial and Environmental Biotechnology, National Institute of Genetic Engineering and Biotechnology (NIGEB), P.O. Box 14155-6343, Tehran, Iran e-mail: [email protected]

Appl Biochem Biotechnol

Introduction Probiotics, according to present-day explanation, refers to viable nonpathogenic and safe microorganisms, which, in sufficient numbers, alter the microbiota of a host body compartment and thereby bring to bear beneficial health effects [1]. The principles for selecting a good probiotic strain have been listed largely in literature [2]. A probiotic strain should be expected to be of human origin, be generally recognized as safe (GRAS), and be able to continue to be surviving through the intensive physiological conditions of the gastrointestinal tract (GIT), i.e., low pH, elevated osmolarity, and bile salts [3]. Probiotic strains should also have antibiotic resistance and sensitivity patterns, should be antagonistic against potential pathogens, and should have metabolic activities which bring valuable health benefits to the host [4]. According to previous studies, the most studied and investigated probiotic strains are lactic acid bacteria, particularly Lactobacillus and Bifidobacterium. Most of the Lactobacillus species are normal and nonpathogenic. They are inhabitants of the human and animal intestines, and their presence is important for the maintenance of the intestinal microbial ecosystem [5]. These species are usually present in raw milk and dairy products such as cheese, yogurt, and fermented milk [6]. Lactobacilli include a large and wide-ranging group of Gram-positive, nonspore-forming, catalase-negative, and rod-shaped bacteria, able to produce lactic acid as the main end product of the fermentation of carbohydrates [7]. They can be safely used as probiotics for medical and veterinary applications [8]. Lactobacilli have been shown to possess inhibitory activity toward the multiplication of enteropathogens, and they are highly competitive due to the production of several antimicrobial compounds [9]. The investigation on novel probiotic strains is vital so as to satisfy the increasing demand of the market and to gain functional products in which the probiotic cultures are more active [10]. Since the viability and activity of probiotic bacteria are needed in the GIT, these organisms should endure the adverse conditions that fall upon the host’s upper GIT. According to the joint FAO/WHO Working Group guidelines, two of the currently most widely used in vitro tests for characterization of probiotic organisms are resistance to gastric acidity and bile compounds based on both survival and growth studies [11]. Resistance to lysozyme, salinity, and antibiotics and antibacterial activity are other crucial characters of probiotics. However, many probiotic bacteria lack the ability to survive the harsh acidity and bile concentration encountered in the GIT [12]. All bile salts, depending upon its concentration, can inhibit the growth of bacteria. Bile acids inhibit many Gram-positive probiotic organisms such as Bifidobacterium and Lactobacillus; however, they have little effect against Gramnegative organisms such as Escherichia coli [13, 14]. On the other hand, the ability of probiotic strains to hydrolyze bile salts has often been included among the criteria for probiotic strain selection, and a number of bile salt hydrolases (BSHs) have been identified and characterized [15]. The present study was aimed at isolating and characterizing some lactobacilli strains from Iranian traditional dairy products and studying the probiotic properties of these isolates for their use in the industry. Among the isolates, one isolate with more appropriate probiotic properties, Lactobacillus crustorum KH, was selected for further in vivo experiments. We have focused on L. crustorum KH to acquire better insights into what it’s like to have developed a protective role against intestinal pathogens in in vitro and in vivo conditions.

Appl Biochem Biotechnol

Materials and Methods Sampling, Isolation, and Molecular Identification Samples were collected from various Iranian traditional dairy products. For isolation and purification of lactobacilli, 1 ml of dairy sample was dissolved in an appropriate amount of sterile 0.9 % buffered saline and 10-fold serial dilutions were performed. A volume of 50 μl of appropriate dilutions was spread plated in triplicate on de Man, Rogosa, and Sharpe (MRS) agar (Merck, Germany). All plates were incubated at 30 °C for 48–72 h under aerobic condition. Catalase-negative and Gram-positive rod colonies were suspected to be lactobacilli. These colonies were subcultured into MRS broth and then kept at −70 °C in 15 % (v/v) glycerol stocks for further studies [16]. PCR experiments were performed to screen the presence of bsh gene encoding the BSH. Bile salt hydrolase is one of the most important properties of probiotic bacteria. PCR primers were used with the following sequences: 5′eCGTATCCAAGTGCTCATGGTTTAAe3′ (bsh For, nucleotide positions 150568 to 150593 of the bsh gene) and 50eATGTGTACTGCCATAACTTATCAATC TTe30 (bsh Rev). The primers were designed to obtain PCR product lengths of 919 bp (for bsh). DNA amplifications were set as follows: 4 min at 94 °C; 30 cycles of 30 S at 94 °C, 30 s at 64 °C (bsh For/Rev), and 1 min at 72 °C; the final extension step consisted of 10 min at 72 °C [16]. Screening of Isolated Lactobacillus Species for Probiotic Properties Bile Resistance The ability of the lactobacilli to grow in the presence of bile was determined according to the method described by Vinderola and Reinheimer [17]. According to this method, each strain was inoculated (2 % v/v) into MRS broth supplemented with 0.3 % (w/v) of filter-sterilized bile (oxgall, Sigma). Cultures were then incubated at 37 °C for 24 h. After this period of time, the growth of bacteria was measured in terms of optical density (at 560 nm using a PerkinElmer spectrophotometer, USA) and compared to the control culture. The results were expressed as the percentage of growth (A560 nm) in the presence of bile salts compared to the control [17]. The experiments were performed with three replicates. Lysozyme Resistance Overnight culture of Lactobacillus strains was pelleted by centrifugation (5000g, 4 °C, 15 min, using Sigma equipment, Germany), washed twice with phosphate buffer (0.1 M, pH 7.0), and resuspended in 2 ml of Ringer solution (Sigma-Aldrich). Then, 10 % of the bacterial suspensions were inoculated in a sterile electrolyte solution (SES) containing 0.22 g/l CaCl2, 6.2 g/l NaCl, 2.2 g/l KCl, and 1.2 g/l NaHCO3 in the presence of 100 mg/l of lysozyme (Sigma-Aldrich) [18]. Bacterial suspension in SES without lysozyme was considered as control. Samples were incubated at 37 °C for 120 min and colony count of the samples was carried out on MRS agar (48 h; 30 °C). Survival rate was calculated as the percentage of the colony-forming unit (CFU) per milliliter after 120 min compared to the CFU per milliliter at zero time [19]. Tolerance to Simulated Gastric Juice After centrifugation (5000g, 4 °C, 12 min) of the overnight Lactobacillus cultures, the pellet was washed twice with phosphate buffer (0.1 M, pH 7.0), then resuspended in SES, and

Appl Biochem Biotechnol

immediately added to the same volume of “gastric” solution [0.6 % (w/v) pepsin, 1 % (w/v) NaCl]. Cell suspensions were immediately placed in a water bath (37 °C) and then gradually acidified (from pH 5.0 to 2.2), under gentle agitation for 90 min [20]. Cell counts on MRS agar were performed at time intervals of 0, 30, 60, 70, 80, and 90 min. After 90 min, an aliquot of each cell suspension was taken, pelleted by centrifugation, and resuspended in phosphate buffer (0.1 M, pH 8.0) containing 0.3 % bile and 0.1 % (w/v) pancreatin (Sigma-Aldrich). The cells were kept for further 60 min at 37 °C and then counted. Washed cells, resuspended in phosphate buffer and subjected to the same conditions, were considered as control. Survival rate was calculated as the percentage of the CFU per milliliter after 30, 60, 70, 80, 90, and 150 min compared to the CFU per milliliter at zero time [21]. Tolerance to Salinity Tolerance of lactobacilli isolates to salinity was determined by providing test tubes containing MRS broth with different concentrations of sodium nitrate (1–3–5 % w/v). After sterilization, each test tube was inoculated with 1 % (v/v) fresh overnight culture of Lactobacillus species and incubated at 37 °C for 24 h. After that, their growth was determined by observing their turbidity, comparing with the control (MRS without NaCl) [22]. Tolerance to Acidity Isolated lactobacilli were evaluated for their tolerance to acidity. For this purpose, bacteria were cultured in various degrees of acidity. MRS broth with pH values of 2, 5, 7, and 9 was prepared using 1 M HCl or 0.5 M NaOH. The amount of 105 CFU/ml of each lactobacilli isolate was inoculated to the each tube. Test tubes were incubated at 37 °C for 120 min. Survival of lactobacilli was calculated as the percentage of growth in pH-adjusted media compared to the control [23]. Bile Salt Hydrolytic Activity In order to determine BSH activity of lactobacilli isolates, an overnight culture of selected strains was spotted on MRS agar plates containing 0.37 g/l CaCl2 and 0.5 % w sodium salt of glycodeoxycholic acid (GDCA) (Sigma-Aldrich) according to Nguyen et al. [24] with some modifications. Plates were anaerobically incubated at 37 °C for 72 h. The presence of an inhibition zone around colonies or white opaque colonies indicates BSH activity. The negative control was the inocula of each strain in MRS agar without supplementation. Antimicrobial Activity Well diffusion assay was employed in the detection of isolates with antibacterial activity. Antimicrobial activity was conducted against several pathogens including Staphylococcus aureus PTCC 1112, Bacillus subtilis PTCC 1715, Bacillus cereus PTCC 1015, E. coli PTCC 1338, Salmonella typhimurium (wild type), Klebsiella pneumoniae PTCC 1290, Pseudomonas aeruginosa PTCC 1310, and E. coli O157 (ATCC 4388). Indicator organisms were spread on Müller-Hinton agar plates and 100 μl of the 2-fold serially diluted cell-free culture supernatant was transferred into the formed wells in the agar plates, while the MRS medium served as the control [25]. The diameter of the inhibition zone surrounding the wells was then measured. The diameter of the zone was scored as

Appl Biochem Biotechnol

follows: since the diameter of the well is 8 mm, 8 mm equals no inhibition (−), diameter lower than 10 mm (weak, +), diameter between 10 and 20 mm (good, ++), and diameter larger than 20 mm (strong, +++). All experiments were performed in three independent experiments. Determination of Antibiotic Resistance The isolated Lactobacillus strains were tested for resistance to nine antibiotics (amoxicillin, ampicillin, cefixime, cefotaxime, azithromycin, tetracycline, gentamicin, streptomycin, and chloromphenicol). The results were expressed as sensitive (S) or resistant (R). This test was performed using the standard disk diffusion method. Identification of the Isolates The pure isolate selected as a potential probiotic was preliminarily identified on the basis of its cultural, morphological, physiological, and biochemical characteristics [26]. 16S ribosomal RNA (rRNA) analysis was conducted at the American Type Culture Collection (ATCC) of microorganisms, and the resulting sequence was aligned with available, almost complete sequence of typed strains of genus Lactobacillus and then with corresponding sequences of the representative Lactobacillus species. In each case, the reference sequence was retrieved from the GenBank databases. The phylogenetic tree was illustrated using version 4 of Molecular Evolutionary Genetics Analysis (MEGA). In Vivo Feeding Trial Mice Feeding Twenty female BALB/c mice (4–6 weeks of age) were purchased from the Pasteur Institute of Iran and housed under specific pathogen-free conditions and were supplied with steam-sterilized pellet food and drinking water. Three groups of bacteria were prepared. L. crustorum KH was cultured in a shaking incubator in MRS broth medium at 30 °C, 100 rpm, for 18 h. E. coli O157 with an optical density adjusted to 0.5 McFarland was also prepared. Another group of L. crustorum KH was heat-killed. For this purpose, the microorganisms were heat-treated for 1 h at 100 °C. The absence of live microorganisms was tested by culturing in MRS agar. The animals were divided into six groups, each group containing three mice. Group A was orally treated with 1×108 cells of L. crustorum KH. Group B was orally challenged with 1 × 108 cells of heat-killed Lactobacillus. Animals in group C were kept without any treatment (the healthy control group). Group D of animals was orally challenged with E. coli O157 and orally treated once a day with culture of live L. crustorum KH. Group E was orally challenged with E. coli O157 and orally treated once a day with heat-killed L. crustorum KH. Group F was orally challenged with E. coli O157 without any other treatment (the infected control group) in the infection dose of 1×108. All of the cages were disinfected by 70 % ethyl alcohol every morning. Stool sample was collected from each cage every day in the morning. To enumerate viable E. coli O157 of stool samples and MRS agar for L. crustorum KH, the plates were counted using MacConkey sorbitol agar. The plates were incubated at 37 °C for 24 h before enumeration. A sensitive balance was used for weighing the mice and stool samples every day [27].

Appl Biochem Biotechnol

Bacterial Translocation Assay At the end of the feeding period, mice were killed by cervical dislocation and the liver and spleen were aseptically removed. Before liver and spleen removal, blood samples were collected to screen for translocation of bacteria to blood. Organs were homogenized in 5 ml of 0.1 % sterile peptone water; 1 ml of each homogenate was placed on MacConkey agar. Blood sample was incubated at 37 °C for 24 h and then placed on MacConkey agar. Plates were incubated under aerobic conditions for 48 h at 37 °C. At the end of the incubation period, the results were expressed as positive (presence of bacteria on plates) or negative (absence of bacteria on plates) bacterial translocation. Translocation is considered to happen when colonies are observed on agar plates, since the liver and spleen are normally devoid of bacteria. Histological Studies of the Gut Since E. coli O157:H7 affected the intestinal track of mice, therefore, the jejunum, stomach, and colon of mice were removed from the treated and control groups at the end of the feeding period immediately and smoothly flushed with 5 ml of cold (5 °C) buffered formaldehyde fixing solution to avoid tissue damage by the action of autolytic enzymes. Organs were processed for paraffin inclusion following the Sainte-Marie technique [28]. Serial paraffin sections (4 mm) were stained with hematoxylin-eosin followed by light microscopy examination [29]. Statistical Analysis All data were analyzed using the SPSS 11.5 statistical analysis system. A one-way analysis of variance was used to determine whether a significant difference existed between the treated groups and controls. Data were expressed as mean values±standard deviation and differences were considered statistically significant if P