Gene, 91 (1990) 101-105
Elseviet
101
GENE 03622
L-Asparaginase II of E&ericlbiu coil K-12: cloning, mapping and sequencingof &e u~B
gm
(Bacterial genetics; leukaemia; physical map; periplasmic; recombinant DNA)
David T. Bonthron Human Gene& Unit,Departmentof Medicine, Western General Hosptial,Edtiqh
University,Edinburgh. EH4 2XU (U.K.)
Received by K.F. Chater:5 February1990 Revised: 9 February1990 Accepted: 10 February1990
SUMMARY The Escherichiu coli gene unsB, encoding the chemotherapeutic enzyme L-asparaginase II, has been cloned, using a strategy based on the polymerase chain reaction, and sequenced. The amino acid (ir& sequence eM e==in iiiiplfwen ==-.__ positions f&m &e 4zTa-
data previously derived by direct aa sequencing. A cleavable secretory signal peptide precedes the N terminus of the mature protein. The ansB gene maps to position 3 114 kb on the physical map of E. coli [ Kohara et al., Cell 50 (1987) 49%5081, corresponding to approx. 63.8 min on the genetic map.
INTRODUCTION
L-Asparaginase (EC 3.5.1.1) catalyses the hydrolysis of L-asparagine to aspartate and ammonia. E. co/i produces two forms of this enzyme, designated I and II, with respectively high and low &, for asparagine; tasparaginase II has been extensively studied biochemically, because of its utility in the treatment of lymphoid malignancy. This periplasmic enzyme is a tetramer (Epp et al., 1971) of approx. 140 kDa; its synthesis is 1009 to lOOO-foldinduced in anaerobic cultures using high concentrations of aa as carbon source (Cedar and Schwartz, 1968). Both it and a homologous enzyme from Erwiniuchrysanthemicause rapid decline of plasma and cerebrospinal fluid L-asparagine levels when administered to patients with lymphoblastic leukaemia, resulting in selective toxicity to malignant lymCorrespondenceto: Dr. D.T. Bonthron, Human Genetics Unit. Department of Medicine, Western General Hospital, EdinburghUniversity, Edinburgh,EH4 2XU (U.K.) Tel. (031)3327917; Fax (031)3432620.
Abbreviations:aa, aminoacid(s);ansB, geneencodingL-asparaginaseII; bp, base pair(s); kb, kilobase or 1000bp; nt, nucleotide(s); oligo, oligodeoxyribonucleotide;ORF, open readingframe;PCR, polymerase chain reaction. 0378-l 119/90/$03.50 0 1990 Elsevier Science Publishers B.V. (Biomedical Division)
phoblasts, which have a relatively high nutritional requirement for this aa (Balis et al., 1989). L-asparaginases vary in their associated L-glutaminase activity, which may also a&t the chemotherapeutic spectrum (Spiers and Wade, 1976).The structural basis of this variable substrate specificityis not clear. Primary structures are available for a number of L-asparaginases, and crystallographic studies have been undertaken with the aim of elucidating important catalytic residues and the determinants of substrate specificity (Tanaka et al., 1988). It is likely that rapid progress in this area will require site-directed mutagenesis to confirm the role of specific residues and to generate enzymes with varying substrate specificity. Use of recombinant DNA methods also seems the most promising approach to analysis of the determinants of the protein which are responsible for its toxicity(Zubrod, 1970; and e.g., Ridgway et al., 1989; Saito et al., 1989)and immunogenicity (Koerholz et al., 1989). The Er. chtysonthemi gene has been cloned (Minton et al., 1986),but the available primary structure of the widely used E. co/i L-asparaginase II is derived from direct protein sequencing (Maita et al., 1974; Maita and Matsuda, 1980). As a prerequisite for mutagenesis, I have cloned and sequenced the L-asparaginase II-encoding ansB gene from E. co/i K-12. The data
102 have also allowed the placing of ansB on the E. coil genetic map.
.~
a
bc
d
e
fgh
i
j k
I m
nop
q
r
s
EXPERIMENTAL AND DISCUSSION
(a) Isolation of ansB sequences using PCR A primary structure of L-asparaginase II from E. coil A 1-3 was proposed several years ago (Malta et al., 1974). To clone ansB, two degenerate oligo pools were designed, corresponding to all possible codons for aa 60-65 (sense) and aa 183-188 (antisense strand) (numbered as in Malta and Matsuda, 1980). The pools were used unpurified after deprotection; their sequences (with the nt included at each degenerate position separated by / and enclosed in parentheses) were: ASP60: 5'-GA(T/C)ATGAA-(T/C)GA(T/C)GA(T/C)GT-3'; and ASP183: 5'-C(T/G)CF/C)TG(G/A)TA(G/A)TC(A/G/T)AT(T/C)-TF-3'. Chromosomal DNA (100 ng) from E. coil JM 108 (YanischPerron et al., 1985) and 1 #g of each oligo were amplified by PCR for 30 cycles, in 100 #1 as described (Gould et al., 1989), except that cycle times were: 94°C, 1.5 rain; 50°C, 2 rain; 72°C, 2 min. To remove single-strand overhangs and allow cloning, ATP (to 1 mM) and 10 units of T4 polynucleotide kinase were added, followed after 15 min at 370C by 10 #1 of 10 x mung-bean buffer (Gubler, 1987) and 10 units of mung-bean nuclease, and a further 15 min at 37°C. Three major bands of approx. 1200, 390, and 210 bp (not shown) were seen on 2 ~ agarose-gel electrophoresis of the products. The expected size of the authentic ansB fragment (as predicted from Malta and Matsuda, 1980) being 386 bp, the 390-bp band was ligated into the Smal sl~.e cf pUCI3 (Messing, 1983); nt sequencing (Chen and Seeburg, 1985) confirmed that the resulting clones con tained part of ansB.
(b) Isolation of a phage ~ clone including ansB The 390-bp insert of one of the above clones (plasmid pansB4) was hybridised to a Southern blot ofE. coli JM 108 DNA restricted with various endonucleases (Fig. la). This gave single bands in most digests, suggesting a single chromosomal gene, although on longer exposure a faint additional band was visible in most lanes; this was not further investigated. As the 13-14-kb BarnHI fragment detected (lane q) was of suitable size for a phage ,~ replacement vector, ~2001 DNA (Karn et al., 1984) was digested with B a m H l and calf intestinal alkaline phosphatase, and 1/~g of this vector ligated to 3 pg of unfractionated BarnHldigested DNA from JMI08. The packaged library was propagated in E. coli P2392 (Stratagene, Inc.) and screened by plaque hybridisation with the probe from pansB4 to isolate a clone designated ~ansB. The insert of pansB4 contained a Kpnl site. Preliminary
B
~ ansB
=__2.~b y
B
R R
K
I
H
H ~
I
i
p~7
I
,
B
I
Ii
,
Fig. 1. Mapping ofansB. (Panel A) Southern blot of E. coilJM 108 DNA digested with lanes: a, Sail; b, Kpnl; e, Nhel; d, Xhol; e, Hinell; f,/~ul; q, Stul; h, Pstl; I, Nrul; ], Seal; k, Sad; I, NspV; m, Ndel; n, Smal; o, Xba !; p, Hindlll; q, BarnHI; r, EeoRI; s, Bglll, and probed with the insert of pansB4. Alkaline transfer from a 1% agarose gel to Zetaprobe membrane (Bio-Rad) was followedby hybridisationin 100mM Na. phos.
phate pH 7.2/2~ SDS/5mM EDTA/!M NaCI/200/~g per ml of denaturedsalmonspermDNA/10%(v/v)skimmedmilk,and by washing in 25 mM Na.phosphate pH 7.2/1~ SDS, both at 65°C. The same conditions were used for screening~.plaques; probes were labelledby random priming(Feinbergand Vogelstein, 1985).The size marker is DNA cut withHlndlll: 23, 9.4, 6.6,4.4, 2.3, 2.0, 0.56kb. (B) Restriction mapsof,~ansBand its subolonepansB7. The bar at bottomrightindicates the region whose sequence is shown in Fig.2; the direction of transeriptionhere is leftto right.B, BarnHl; C, H£n¢ll;G, BgllI; H, Hindlll; K, Kpnl; P, Pstl; R, EeoRI; V, EcoRV. restriction mapping of ~ansB (Fig. lb) revealed a unique KpnI site, which therefore defined the position of the ansB coding region within the phage clone. The 7. l-kb BarnHI. HindIII fragment was subcloned in the plasmid p B S ( - ) (Stratagene, Inc.) and mapped in more detail. Restriction sites were consistent with fragment sizes seen on Southern blotting of chromosomal DNA, suggesting that no major rearrang~ents had occurred during cloning.
103 (c) Structure of the ansB gem The region indicated in Fig. lb was sequenced on both strands (Fig. 2). A single ORF extends from an AT(] at nt 346 (preceded by a putative ribosome-binding site; Stormo et al., 1982) to a stop codon at nt 1390. The deduced product of this ORF includes all of the sequence of Maita and Matsuda (1980). The 22 aa preceding the mature 1~I terminus (arrowed; Maita and Matsuda, 1980) encode a typical cleaved signal peptide (Watson, 1984), as expected for a periplasmic protein. The homologous Er. chrysanthemi ~-asparaginase II (Minton et al., 1986) and the ASPJ gene product of Saccharomyces cerevisiae (Kim et al., 1988) have similar signal peptides, whereas a signal peptide is, as expected, lacking from the cytoplasmic L-asparaginase I of E. coli (JerlstrOm et al., 1989). The deduced M,s of the precursor and processed periplasmic protein subunit are 36 854 and 34 599, respectively. There are a number of differences between the deduced aa sequence and that derived by Edman degradation (Maita
and Matsuda, 1980). In four positions (beginning at m 739, 811, 856 and 1210) the nt sequence predicts an extra Val, producing a Val-Val doublet. Only five such doublets occur in the translated ORF, and the systematic nature of this discrepancy, occurring at four ofthese five positions, makes it probable that it is due to an artefact ofthe dansyl-Edman procedure. Inspection of an alignment of the Maim and Matsuda (1980) sequence with that of two other bacterial L-asparaginases (Tanaka et al., 1988; Fig. 2) supports this conclusion; insertion ofa Val at each of these four positions allows the removal of a local gap introduced into the E. coil sequence to maximise homology. This type of artefact may result from incomplete hydrolysis of dansylated peptides (frequently a problem when the N-terminal aa is Val or lie) and subsequent failure to distinguish dansyl-Val from dansyl-Val-Val by thin-layer chromatography (Allen, 1981; Croft, 1980; Sutton and Bradshaw, 1978). The Leu at nt 1333-1335 is similarly missing from the Malta and Matsuda (1980) sequence, again requiring introduction of a gap
30
60
90
120
150
180
210
240
270
300
330
GC~AACCCATTACA~AATGTGCTGGGAAGCCTGG~G~G~CTGCAATCCTCAA~CCAAA~C~AGTGGAAAAA~CA~AAAAA~ATTT .CCAGCAGTTTGGCAAAGATGTTTGTAGCCGCG TTGTGAC~CTGGAAGA~AGCCGCAAAGC~CTGGTC0~AAT~TAAAATAATCCTCTATTTTAA0ACGGCATAATACTTTTTTATGCCGTTTAATTCTTC~TT~GTTA~TGCCTCTAAc 360
TTTGTA~ATCTCCAAAATATATTCAC~TT~TAAATT~TTTAACGTCAAATTT~cATACA~A~TAA~ATAATG~TA0~TT~A~TAACTGGA~AATGAAATGGA~~ ~O
390
~
420
HetGluPhePhelq,,s
450
460
AA~ACG~CACTT~CCGCACT~TTAT~GTTTTA~T~T~CAGCATT~GCATTACCCAA.rATCACCATTTTAGC~CC~ACCAT~C~~ACTCC~C~CC~
LysThrAlaLeuAlaAlaLeuValNetGlyPheSerGlyAlaAlaLeuAlaLeuProAsnl leThrI leLeuAlaThrGlyGIyThrlleAlaGlyGlyOlyAol~erAlaThrLysSer
510 540 570 600 AACTACACAGT~0GTAAAGTTGGCGTAGAAAATCTGGTTAATGCGGTGCCGCAACTA~t~AGACATTGC~AACGTTAAAG~GAG~A~GTAG~AATATCG~CTCC~A~~AT
AsnTyrThrVa...)~01yLysValGlyValGluAsnLeuValAanAlaValProGlnLeuLysAspl IeAIaAenValLFaGIyGIuGInValValAsnlleGlySerGlnAslA4etAsnAsp 630
660
720
690
A~TGTCTGGCT0ACAC~C~AAAAAAATTAA~ACC~ACT~ATAA~A~GAC~GCT~CGTCATTA~C~A~GGTAC~GA~A~A~G~G~TA~T~T~A~A~ As..nnValTrlpLeuThrLeuAlaLyaLyaI ~eAsnTh~AspC~A~pL~Th~Aap~yPheva~eThr~1sG~ThrAspTh~Het(]~uG~uTh~A~aT~rPheLeuAs~pLeuThrv~ 750 780 810 040 AAAT~A~AAACC~T~GT~ATGG~CG~CG~AAT~T~GT~AC~T~TAT~AG~A~A~TC~ATTC~AT~~HAG~A~A~AT~TC~C~M~ L~sAsPLysPr~Va~Va~Metva~G~FA~MetA~gP~e~hr~erM~t~e~A~aAs~pG~ProPheAsnLeu~rAsnA~ave~v~ThrA~A~aAspLysA~erA~Asn e
.
m
670 900 930 960 ~T~GCGTGCTG~AGTG&TGAA~GACACCGTGC~TGATGGCCGTGACG~CACCAAAACCAACACCACC~ACG~AGCGA~cTTCAAGTCTGTTAA~AC(~G~CCT~T~0G~ACATT~A~ ArgGIFValLeuVa~va--~MetA~nAspThrVa~LeuAsp~ArgAspva~ThrLy~ThrA~nThrThrAspVa~A~aThrPheLy~rVa~Asn~zG lYPr°LeuGlyTyr I lellls 990 1020 1060 1060 AACGG~AAGATTGAC~ACCAGCGTACCCC~GCACGTAAGC&TACCA~CGACACGCCATTC~ATGTCTcTAAQCT~AAT~AACTG~C~AAAGTCGGCA~TGT~ATAACTACGC~AACG~A As__nnOIyLysI leAspTyrGlnArgThrProAlaArilLysH1sThrSerAspThrProPheAspValGerLysLeuAsnGluLeuProLysValGIyI leValTyrAsnTyrAlaAsnAla 1110 1140 1170 1200 ~CC~ATCTTCCGGCTAAA~CACT(:(:TAGA~CGGGCTATGATGGCA~CGTTA(3C~CTG~TGTGGG~AACGGCAACCT~A~AAAT~T(~TGTTC~ACAC(~CT~C~ACC~CCGC~AAAA~C SerAspLeuProAlaLysAlaLeuValAspAlaG1yTyrAsl~llyI leValSerAlaGlyValG1yAsnGIyAsnLeuTyrLysSe_.~rValPheAspThrLeuAlaThrAlaAlaLFsThr 1230
1260
1290
1320
GGTACTGCAGTC0~GCGTTCT~CCCGCG~&CCGACGGGCGCTACCACTCAGGATGCCGAAGTGGATGATGCGAAA~ACGGCTTC0TCGCCTcT0GCAC(]~T~AACCC(3CAAAAAGC0~GC
~ThrA~aVa~a~Arg~er~erArgVa~Pr~ThrG~A~aThrThrG~nA~A~aG~uVa~AsPA~A~L~sTyrO~PheVa~A~a8erO~yThrLeuAsnP~nL¥sA~aArg
1350 1380 1410 1440 ~TTC~GCTGCAACTGGCTCT~ACGCAAA~GAT~CGCAG~AGATCCA~CAGA~CTTCAATCA~TAC~AATC~CC~C~CCCC~Q~ATC~T~:CGG~CTTTT~CAC~T~A~ACTCAc~ ValLeuLeuGlnLe.__uAlaLeuThrGlnThrLysAspProOlnGlnIleGlnGlnI lePheAsnGlnTyr 1470
1500
1590
1620
1630
1560
TCCATT~CCAATTTTAAT~ACCCTAATGA~AATCACCGGAATAAATTATTCCGCGTGAGGTTT~TC~GGT~AAAAAGCAATGGATTGTT~CAC~CACT~C~TATGTT~AT~At7/~TA 1640
ATGCCTGGGCAGATGGCGAACCGCCAACTQAAAATATCTT~GATC~TTC~GCAGTA?CA~CATTCTC~GCTT Pig. 2. Sequence of the E. co//arab gene. The signal peptide (see downward arrow for signal cleavage), and the aa residues which diverse from the sequence of Malta and Matsuda (1980), arc underlined, as is the Shinc-Dalgm'no (SD) region of complementarity to 16S rRHA. A possible RHA stem-loop structure [predicted free energy of formation -25.2 kcal/mol (-106 kJ/mol); Tinoco et al., 1973] followed by a run of five U residues is typical of Rho-independent transcriptional terminators (Platt, 1986) and is shown by facing arrows. The nt sequence data reported here have been dcpositcd with GenBank under accession No. M34234.
104 opposite the Leu of both other sequences in the alignment. At three positions the sequence of Malta and Matsuda (1980) has Asp while the nt sequence predicts Asn (nt 601-603, 961-963 and 1147-1149). At nt 1198-1200 Thr is predicted instead of Asp. At nt 490-492, Val and at nt 1165-1167 Ser, are predicted instead of Ala and Thr, respectively, both conservative substitutions. These may represent polymorphic variation between E. coliJM 108 and AI-3, or aa sequencing errors. The sequence of an independently isolated ansB clone from E. coil MC4100, published after this paper was submitted for publication (Jennings and Beacham, 1990) is in complete agreement with that shown in Fig. 2, making nt sequencing errors unlikely.
(d) Mapping of ansB on the Escherichia coil chromosome It has been proposed on the basis of sequence similarities that L-asparaginase I and L-asparaginase II arose by divergence from a common predecessor (Jerlstrom et al., 1989). The gene encoding L-asparaginase I of E. coli (ansA) has been mapped (del Casale et al., 1983) and cloned (Spring eta]., 1986; Jerlstr0m etal., 1989). Physical maps of ordered overlapping Aor cosmid clones greatly facilitate the mapping of cloned genes. To localize ansB, further restriction mapping of pansB7 was performed, using the enzymes £coRV and PstI in addition to BamHI, EcoRI, HindIII and Kpnl (Fig. lb). The almost complete physical map of E. coil W3110 (Kohara et al., 1987) was then inspected. A perfect match was found for all the sites mapped, unambiguously placing the limits of the insert of ~ n s B (BarnHI sites) at 3106-3120kb. The ansB coding region (defined by the unique Kpnl site), therefore, lies at position 3114 kb. Interpolation from the positions of known genetic markers on the physical map suggests that this corresponds to a map position of approx. 63.8 min (near gall') on the genetic map (Bachmann, 1983). Transcription of ansB is anticlockwise, away from cca (66.8 min) towards recB (60.6 min). This map location was confirmed by plaque hybridisation of three clones from the ordered array of Kohara
3090 I
3100 I
3110 I
3120 I
3130 I
kb
,2364S I
12Ce ,3A9
t
•, pansB4
Fig. 3. Alignment of,~ clones on the physical map. ~ B and three clones from the ordered array are shown, with scale in kb (Kohara et el., 1987). The position of the 390-bp probe from pa~B4 is also shown. (This corresponds to the position of the Kpnl site in Fig. IB, which is in the opposite orientation.~
et al. (1987). The pansB4 insert hybridised to clones 12C6 and 3A9, but not to 23G4S (Fig. 3); the latter overlaps JlansB, but terminates close to the 3' end ofthe ansB-coding region. Thus, ansB maps far from ansA (39 min) on the E. coil K-12 chromosome.
(e) Conclusions (1) Cloning and sequencing of ansB shows that it encodes a pre-protein with Mr 36 854 and a 22-aa signal peptide. Some residues differ from those determined previously by direct sequencing of L-asparaginase II. (2) The ansB locus lies at 63.8 min on the E. coli chromosome. ACKNOWLEDGEMENTS DNA from E. coil JM108 was a kind gift of Dr. Anne Wakefield. I am grateful to Dr. Millicent Masters for supplying the ~, clones from the library of Kohara et al. (1987). REFERENCES Allen, G.: Sequencingof Proteins and Peptides. Elsevier, Amsterdam, 1981, pp. 171-173. Balls, F.M., Holcenberg,J.S. and Poplack, D.G.: General principles of chemotherapy. In Pizzo, P.A. and Poplack, D.G. (Eds.), Principles and Practice of Pediatric Oncology.Lippincott,Philadelphia, 1989, pp. 165-205. Bachmann, B.J.: Linkagemap of£scherlchia coil K-12,edition 7. Microbiol. Rev. 47 (1983) 180-230. Cedar, H. and Schwartz, J.H.: Production of t.-asparaginase II by Escherichla colt, J. Bacteriol. 96 (1968) 2043-2048. Chen, E.Y. and Seebur8,P.H.: Supercoilsequencing:a fast and simple method for sequencingplasmid DNA. DNA 4 (1985) 165-170. Croft, LR.: Handbook of Protein Sequence Analysis,2nd ed. Wiley, Chichester, 1980,p. 108. del Casale, T., Sollitti,P. and Chesney, R.H.: CytoplasmicL-asparaginase: isolationof a defectivestrain and mappingofansA. J. Bacteriol. 154 (1983) 513-515. Epp,O., Steigemann,W., Formanek,H. and Huber,R.: Crystallographic evidence for the tetrameric subunit structure of L-asparaginasefrom Escherichla coll. Eur. J. Biochem.20 (1971) 432-437. Feinberg, A.P. and Vogelstein,B.: A technique for radiolabellingDNA restriction fragments to high specific activity. Anal. Biochem. 137 (1985) 266-267. Gould, SJ., Subramani,S. and Schemer,I.M.: Use ofDNA polymerase chain reaction for homologyprobing: isolation of partial cDNA or genomicclonesencodingthe iron-sulfurproteinofsuccinatedehydro8enase from several species. Proc. Natl. Acad. Sci. USA 86 (1989) 1934-1938. Gubler, U.: Second-strand cDNA synthesis: mRNA fragments as primers. Methods Enzymol.152 (1987) 330-335. Jennings, M.P. and Beacham,I.R.: Ana!ysisof the £scherichia coli gene encoding L-asparaginaseII, ansB, and its regulationby cyclicAMP receptor and FNR protein. J. Bacteriol. 172 (1990) 1491-1498. Jerlstrgm, P.G., Bezjak,D.A.,Jennings,M.P. and Beacham,I.R.: Structure and expression in Escherichia coli K-12 of the c-asparaginase
105 I-encoding ansA gene and its flanking regions. Gene 78 (1989) 37-46. Kum, J., Matthes, H.W.D., Gait, MJ. and Brenner, S.: A new selective phage cloning vector, Z2001, with sites for Xbal, BamHl, H/ndlll, EcoRl, SsH and Xhol. Gene 32 (1984) 217-224. Kim, K.-W., Kamerud, J.Q., Livingston, D.M. and Roon, R.J.: Asparaginase II of Saccharomyces ceret,isiae. Characterization of the ASP3 gene. J. Biol. Chem. 263 (1988) 11948-11953. Koerholz, D., Brueck, M., Nuernberger, W., Juergens, H., Goebel, U. and Wahn, V.: Chemical and immunological characteristics of four different L-asparaginase preparations. Eur. $. Haematol. 42 (1989) 417-424. Kohara, Y., Akiyama, K. and Isono, K.: The physical map of the whole E. co~~chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 (1987) 495-508. Maita, T., Morokuma, K. and Matsuda, G.: Amino acid sequence of L-asparaginase from £scherichia co~~. J. Biochem. 76 (1974) 1351-1354. Maita, T. and Matsuda, G.: The primary structure of L-asparaginase from E. co~~. Hoppe-Seyler's Z. Physiol. Chem. 361 (1980) 105-117. Messing, J.: New MI3 vectors for cloning. Methods Enzymol. 101 (1983) 20-78. Minton, N.P., Bulhnan, H.M.S., Scawen, M.D., Atkinson, T. and Gilbert, H.J. Nucleotide sequence of the Erwinia chrysanthemi NCPPB 1066 L-asparaginase gene. Gene 46 (1986) 25-35. Platt, T.: Transcription termination and the regulation of gene expression. Annu. Rev. Biochem. 55 (1986) 339-372. Ridgway, D., Neerhout, R.C. and Bleyer, A.: Attenuation of asparaginase-induced hyperglycemia after substitution ofthe Erwinia carotovora for the Escherichia co~~enzyme preparation. Cancer 63 (1989) 561-563. Saito, M., Asakura, H., Jokaji, H., Uotani, C., Kumabashiri, I., lto, K.
and Matsuda, T.: Changes in hemostatic and fibrinolytic proteins in patients receiving L-asparaginase therapy. Am. J. Hematol. 32 (1989) 20-23. Spiers, A.S.D. and Wade, H.E.: Bacterial giutaminase in treatment of acute leukaemia. Br. Med. J. I (1976) 1317-1319. Spring, KJ., JeHstrOm, P.G., Bums, D.M. and Beacham, I.R.: L-Asparaginase genes in EscheKc&'aco//: isolation ofmutants and characterization ofthe ansA gene and its protein producL J. Bacteriol. 166 (1986) 135-142. Stormo, G.D., Schneider, T.D. and Gold, LM.: Characterization of translational initiation sites in E. co//. Nucleic Acids Res. I0 (1982) 2971-2996. Sutton, M.R. and Bradshaw, R.A.: Identification ofdansyl dipeptidcs in the dansyl-Edman peptide degradation. Anal. Biochem. 88 (1978) 344-346. Tanaka, S., Robinson, E.A., Appella, E., Miller, M., Anunon, H.L., Roberts, J., Weber, I.T. and Wlodawer, A.: Structures of amidohydrolases. Amino-acid sequence of a giutaminase-asparaginase from Acinetobacter glutaminasiflcans and preliminary crystallographic data for an asparaginase from Erwinia chrysamhemi. J. Biol. Chem. 263 (1988) 8583-8591. Tinoco Jr., !., Borer, P.N., Dengier, B., Levine, M.D., Uhlenbeck, O.C., Crothers, D.M. and Gralla, J.: Improved estimation of secondary structure in ribonucleic acids. Nature New Biol. 246 (1973) 40-41. Watson, M.E.E.: Compilation of published signal sequences. Nucleic Acids Res. 12 (1984) 5145-5164. Yanisch-Perron, C., Vieira, J. and Messing, J.: Improved MI3 vectors and host strains: nucleotide sequences of the M 13mpl8 and pUCI9 vectors. Gene 33 (1985) 103-119. Zubrod, C.G.: The clinical toxicities of L-asparaginase in treatment of leukemia and lymphoma. Pediatrics 45 (1970) 555-559.
Elseviet
101
GENE 03622
L-Asparaginase II of E&ericlbiu coil K-12: cloning, mapping and sequencingof &e u~B
gm
(Bacterial genetics; leukaemia; physical map; periplasmic; recombinant DNA)
David T. Bonthron Human Gene& Unit,Departmentof Medicine, Western General Hosptial,Edtiqh
University,Edinburgh. EH4 2XU (U.K.)
Received by K.F. Chater:5 February1990 Revised: 9 February1990 Accepted: 10 February1990
SUMMARY The Escherichiu coli gene unsB, encoding the chemotherapeutic enzyme L-asparaginase II, has been cloned, using a strategy based on the polymerase chain reaction, and sequenced. The amino acid (ir& sequence eM e==in iiiiplfwen ==-.__ positions f&m &e 4zTa-
data previously derived by direct aa sequencing. A cleavable secretory signal peptide precedes the N terminus of the mature protein. The ansB gene maps to position 3 114 kb on the physical map of E. coli [ Kohara et al., Cell 50 (1987) 49%5081, corresponding to approx. 63.8 min on the genetic map.
INTRODUCTION
L-Asparaginase (EC 3.5.1.1) catalyses the hydrolysis of L-asparagine to aspartate and ammonia. E. co/i produces two forms of this enzyme, designated I and II, with respectively high and low &, for asparagine; tasparaginase II has been extensively studied biochemically, because of its utility in the treatment of lymphoid malignancy. This periplasmic enzyme is a tetramer (Epp et al., 1971) of approx. 140 kDa; its synthesis is 1009 to lOOO-foldinduced in anaerobic cultures using high concentrations of aa as carbon source (Cedar and Schwartz, 1968). Both it and a homologous enzyme from Erwiniuchrysanthemicause rapid decline of plasma and cerebrospinal fluid L-asparagine levels when administered to patients with lymphoblastic leukaemia, resulting in selective toxicity to malignant lymCorrespondenceto: Dr. D.T. Bonthron, Human Genetics Unit. Department of Medicine, Western General Hospital, EdinburghUniversity, Edinburgh,EH4 2XU (U.K.) Tel. (031)3327917; Fax (031)3432620.
Abbreviations:aa, aminoacid(s);ansB, geneencodingL-asparaginaseII; bp, base pair(s); kb, kilobase or 1000bp; nt, nucleotide(s); oligo, oligodeoxyribonucleotide;ORF, open readingframe;PCR, polymerase chain reaction. 0378-l 119/90/$03.50 0 1990 Elsevier Science Publishers B.V. (Biomedical Division)
phoblasts, which have a relatively high nutritional requirement for this aa (Balis et al., 1989). L-asparaginases vary in their associated L-glutaminase activity, which may also a&t the chemotherapeutic spectrum (Spiers and Wade, 1976).The structural basis of this variable substrate specificityis not clear. Primary structures are available for a number of L-asparaginases, and crystallographic studies have been undertaken with the aim of elucidating important catalytic residues and the determinants of substrate specificity (Tanaka et al., 1988). It is likely that rapid progress in this area will require site-directed mutagenesis to confirm the role of specific residues and to generate enzymes with varying substrate specificity. Use of recombinant DNA methods also seems the most promising approach to analysis of the determinants of the protein which are responsible for its toxicity(Zubrod, 1970; and e.g., Ridgway et al., 1989; Saito et al., 1989)and immunogenicity (Koerholz et al., 1989). The Er. chtysonthemi gene has been cloned (Minton et al., 1986),but the available primary structure of the widely used E. co/i L-asparaginase II is derived from direct protein sequencing (Maita et al., 1974; Maita and Matsuda, 1980). As a prerequisite for mutagenesis, I have cloned and sequenced the L-asparaginase II-encoding ansB gene from E. co/i K-12. The data
102 have also allowed the placing of ansB on the E. coil genetic map.
.~
a
bc
d
e
fgh
i
j k
I m
nop
q
r
s
EXPERIMENTAL AND DISCUSSION
(a) Isolation of ansB sequences using PCR A primary structure of L-asparaginase II from E. coil A 1-3 was proposed several years ago (Malta et al., 1974). To clone ansB, two degenerate oligo pools were designed, corresponding to all possible codons for aa 60-65 (sense) and aa 183-188 (antisense strand) (numbered as in Malta and Matsuda, 1980). The pools were used unpurified after deprotection; their sequences (with the nt included at each degenerate position separated by / and enclosed in parentheses) were: ASP60: 5'-GA(T/C)ATGAA-(T/C)GA(T/C)GA(T/C)GT-3'; and ASP183: 5'-C(T/G)CF/C)TG(G/A)TA(G/A)TC(A/G/T)AT(T/C)-TF-3'. Chromosomal DNA (100 ng) from E. coil JM 108 (YanischPerron et al., 1985) and 1 #g of each oligo were amplified by PCR for 30 cycles, in 100 #1 as described (Gould et al., 1989), except that cycle times were: 94°C, 1.5 rain; 50°C, 2 rain; 72°C, 2 min. To remove single-strand overhangs and allow cloning, ATP (to 1 mM) and 10 units of T4 polynucleotide kinase were added, followed after 15 min at 370C by 10 #1 of 10 x mung-bean buffer (Gubler, 1987) and 10 units of mung-bean nuclease, and a further 15 min at 37°C. Three major bands of approx. 1200, 390, and 210 bp (not shown) were seen on 2 ~ agarose-gel electrophoresis of the products. The expected size of the authentic ansB fragment (as predicted from Malta and Matsuda, 1980) being 386 bp, the 390-bp band was ligated into the Smal sl~.e cf pUCI3 (Messing, 1983); nt sequencing (Chen and Seeburg, 1985) confirmed that the resulting clones con tained part of ansB.
(b) Isolation of a phage ~ clone including ansB The 390-bp insert of one of the above clones (plasmid pansB4) was hybridised to a Southern blot ofE. coli JM 108 DNA restricted with various endonucleases (Fig. la). This gave single bands in most digests, suggesting a single chromosomal gene, although on longer exposure a faint additional band was visible in most lanes; this was not further investigated. As the 13-14-kb BarnHI fragment detected (lane q) was of suitable size for a phage ,~ replacement vector, ~2001 DNA (Karn et al., 1984) was digested with B a m H l and calf intestinal alkaline phosphatase, and 1/~g of this vector ligated to 3 pg of unfractionated BarnHldigested DNA from JMI08. The packaged library was propagated in E. coli P2392 (Stratagene, Inc.) and screened by plaque hybridisation with the probe from pansB4 to isolate a clone designated ~ansB. The insert of pansB4 contained a Kpnl site. Preliminary
B
~ ansB
=__2.~b y
B
R R
K
I
H
H ~
I
i
p~7
I
,
B
I
Ii
,
Fig. 1. Mapping ofansB. (Panel A) Southern blot of E. coilJM 108 DNA digested with lanes: a, Sail; b, Kpnl; e, Nhel; d, Xhol; e, Hinell; f,/~ul; q, Stul; h, Pstl; I, Nrul; ], Seal; k, Sad; I, NspV; m, Ndel; n, Smal; o, Xba !; p, Hindlll; q, BarnHI; r, EeoRI; s, Bglll, and probed with the insert of pansB4. Alkaline transfer from a 1% agarose gel to Zetaprobe membrane (Bio-Rad) was followedby hybridisationin 100mM Na. phos.
phate pH 7.2/2~ SDS/5mM EDTA/!M NaCI/200/~g per ml of denaturedsalmonspermDNA/10%(v/v)skimmedmilk,and by washing in 25 mM Na.phosphate pH 7.2/1~ SDS, both at 65°C. The same conditions were used for screening~.plaques; probes were labelledby random priming(Feinbergand Vogelstein, 1985).The size marker is DNA cut withHlndlll: 23, 9.4, 6.6,4.4, 2.3, 2.0, 0.56kb. (B) Restriction mapsof,~ansBand its subolonepansB7. The bar at bottomrightindicates the region whose sequence is shown in Fig.2; the direction of transeriptionhere is leftto right.B, BarnHl; C, H£n¢ll;G, BgllI; H, Hindlll; K, Kpnl; P, Pstl; R, EeoRI; V, EcoRV. restriction mapping of ~ansB (Fig. lb) revealed a unique KpnI site, which therefore defined the position of the ansB coding region within the phage clone. The 7. l-kb BarnHI. HindIII fragment was subcloned in the plasmid p B S ( - ) (Stratagene, Inc.) and mapped in more detail. Restriction sites were consistent with fragment sizes seen on Southern blotting of chromosomal DNA, suggesting that no major rearrang~ents had occurred during cloning.
103 (c) Structure of the ansB gem The region indicated in Fig. lb was sequenced on both strands (Fig. 2). A single ORF extends from an AT(] at nt 346 (preceded by a putative ribosome-binding site; Stormo et al., 1982) to a stop codon at nt 1390. The deduced product of this ORF includes all of the sequence of Maita and Matsuda (1980). The 22 aa preceding the mature 1~I terminus (arrowed; Maita and Matsuda, 1980) encode a typical cleaved signal peptide (Watson, 1984), as expected for a periplasmic protein. The homologous Er. chrysanthemi ~-asparaginase II (Minton et al., 1986) and the ASPJ gene product of Saccharomyces cerevisiae (Kim et al., 1988) have similar signal peptides, whereas a signal peptide is, as expected, lacking from the cytoplasmic L-asparaginase I of E. coli (JerlstrOm et al., 1989). The deduced M,s of the precursor and processed periplasmic protein subunit are 36 854 and 34 599, respectively. There are a number of differences between the deduced aa sequence and that derived by Edman degradation (Maita
and Matsuda, 1980). In four positions (beginning at m 739, 811, 856 and 1210) the nt sequence predicts an extra Val, producing a Val-Val doublet. Only five such doublets occur in the translated ORF, and the systematic nature of this discrepancy, occurring at four ofthese five positions, makes it probable that it is due to an artefact ofthe dansyl-Edman procedure. Inspection of an alignment of the Maim and Matsuda (1980) sequence with that of two other bacterial L-asparaginases (Tanaka et al., 1988; Fig. 2) supports this conclusion; insertion ofa Val at each of these four positions allows the removal of a local gap introduced into the E. coil sequence to maximise homology. This type of artefact may result from incomplete hydrolysis of dansylated peptides (frequently a problem when the N-terminal aa is Val or lie) and subsequent failure to distinguish dansyl-Val from dansyl-Val-Val by thin-layer chromatography (Allen, 1981; Croft, 1980; Sutton and Bradshaw, 1978). The Leu at nt 1333-1335 is similarly missing from the Malta and Matsuda (1980) sequence, again requiring introduction of a gap
30
60
90
120
150
180
210
240
270
300
330
GC~AACCCATTACA~AATGTGCTGGGAAGCCTGG~G~G~CTGCAATCCTCAA~CCAAA~C~AGTGGAAAAA~CA~AAAAA~ATTT .CCAGCAGTTTGGCAAAGATGTTTGTAGCCGCG TTGTGAC~CTGGAAGA~AGCCGCAAAGC~CTGGTC0~AAT~TAAAATAATCCTCTATTTTAA0ACGGCATAATACTTTTTTATGCCGTTTAATTCTTC~TT~GTTA~TGCCTCTAAc 360
TTTGTA~ATCTCCAAAATATATTCAC~TT~TAAATT~TTTAACGTCAAATTT~cATACA~A~TAA~ATAATG~TA0~TT~A~TAACTGGA~AATGAAATGGA~~ ~O
390
~
420
HetGluPhePhelq,,s
450
460
AA~ACG~CACTT~CCGCACT~TTAT~GTTTTA~T~T~CAGCATT~GCATTACCCAA.rATCACCATTTTAGC~CC~ACCAT~C~~ACTCC~C~CC~
LysThrAlaLeuAlaAlaLeuValNetGlyPheSerGlyAlaAlaLeuAlaLeuProAsnl leThrI leLeuAlaThrGlyGIyThrlleAlaGlyGlyOlyAol~erAlaThrLysSer
510 540 570 600 AACTACACAGT~0GTAAAGTTGGCGTAGAAAATCTGGTTAATGCGGTGCCGCAACTA~t~AGACATTGC~AACGTTAAAG~GAG~A~GTAG~AATATCG~CTCC~A~~AT
AsnTyrThrVa...)~01yLysValGlyValGluAsnLeuValAanAlaValProGlnLeuLysAspl IeAIaAenValLFaGIyGIuGInValValAsnlleGlySerGlnAslA4etAsnAsp 630
660
720
690
A~TGTCTGGCT0ACAC~C~AAAAAAATTAA~ACC~ACT~ATAA~A~GAC~GCT~CGTCATTA~C~A~GGTAC~GA~A~A~G~G~TA~T~T~A~A~ As..nnValTrlpLeuThrLeuAlaLyaLyaI ~eAsnTh~AspC~A~pL~Th~Aap~yPheva~eThr~1sG~ThrAspTh~Het(]~uG~uTh~A~aT~rPheLeuAs~pLeuThrv~ 750 780 810 040 AAAT~A~AAACC~T~GT~ATGG~CG~CG~AAT~T~GT~AC~T~TAT~AG~A~A~TC~ATTC~AT~~HAG~A~A~AT~TC~C~M~ L~sAsPLysPr~Va~Va~Metva~G~FA~MetA~gP~e~hr~erM~t~e~A~aAs~pG~ProPheAsnLeu~rAsnA~ave~v~ThrA~A~aAspLysA~erA~Asn e
.
m
670 900 930 960 ~T~GCGTGCTG~AGTG&TGAA~GACACCGTGC~TGATGGCCGTGACG~CACCAAAACCAACACCACC~ACG~AGCGA~cTTCAAGTCTGTTAA~AC(~G~CCT~T~0G~ACATT~A~ ArgGIFValLeuVa~va--~MetA~nAspThrVa~LeuAsp~ArgAspva~ThrLy~ThrA~nThrThrAspVa~A~aThrPheLy~rVa~Asn~zG lYPr°LeuGlyTyr I lellls 990 1020 1060 1060 AACGG~AAGATTGAC~ACCAGCGTACCCC~GCACGTAAGC&TACCA~CGACACGCCATTC~ATGTCTcTAAQCT~AAT~AACTG~C~AAAGTCGGCA~TGT~ATAACTACGC~AACG~A As__nnOIyLysI leAspTyrGlnArgThrProAlaArilLysH1sThrSerAspThrProPheAspValGerLysLeuAsnGluLeuProLysValGIyI leValTyrAsnTyrAlaAsnAla 1110 1140 1170 1200 ~CC~ATCTTCCGGCTAAA~CACT(:(:TAGA~CGGGCTATGATGGCA~CGTTA(3C~CTG~TGTGGG~AACGGCAACCT~A~AAAT~T(~TGTTC~ACAC(~CT~C~ACC~CCGC~AAAA~C SerAspLeuProAlaLysAlaLeuValAspAlaG1yTyrAsl~llyI leValSerAlaGlyValG1yAsnGIyAsnLeuTyrLysSe_.~rValPheAspThrLeuAlaThrAlaAlaLFsThr 1230
1260
1290
1320
GGTACTGCAGTC0~GCGTTCT~CCCGCG~&CCGACGGGCGCTACCACTCAGGATGCCGAAGTGGATGATGCGAAA~ACGGCTTC0TCGCCTcT0GCAC(]~T~AACCC(3CAAAAAGC0~GC
~ThrA~aVa~a~Arg~er~erArgVa~Pr~ThrG~A~aThrThrG~nA~A~aG~uVa~AsPA~A~L~sTyrO~PheVa~A~a8erO~yThrLeuAsnP~nL¥sA~aArg
1350 1380 1410 1440 ~TTC~GCTGCAACTGGCTCT~ACGCAAA~GAT~CGCAG~AGATCCA~CAGA~CTTCAATCA~TAC~AATC~CC~C~CCCC~Q~ATC~T~:CGG~CTTTT~CAC~T~A~ACTCAc~ ValLeuLeuGlnLe.__uAlaLeuThrGlnThrLysAspProOlnGlnIleGlnGlnI lePheAsnGlnTyr 1470
1500
1590
1620
1630
1560
TCCATT~CCAATTTTAAT~ACCCTAATGA~AATCACCGGAATAAATTATTCCGCGTGAGGTTT~TC~GGT~AAAAAGCAATGGATTGTT~CAC~CACT~C~TATGTT~AT~At7/~TA 1640
ATGCCTGGGCAGATGGCGAACCGCCAACTQAAAATATCTT~GATC~TTC~GCAGTA?CA~CATTCTC~GCTT Pig. 2. Sequence of the E. co//arab gene. The signal peptide (see downward arrow for signal cleavage), and the aa residues which diverse from the sequence of Malta and Matsuda (1980), arc underlined, as is the Shinc-Dalgm'no (SD) region of complementarity to 16S rRHA. A possible RHA stem-loop structure [predicted free energy of formation -25.2 kcal/mol (-106 kJ/mol); Tinoco et al., 1973] followed by a run of five U residues is typical of Rho-independent transcriptional terminators (Platt, 1986) and is shown by facing arrows. The nt sequence data reported here have been dcpositcd with GenBank under accession No. M34234.
104 opposite the Leu of both other sequences in the alignment. At three positions the sequence of Malta and Matsuda (1980) has Asp while the nt sequence predicts Asn (nt 601-603, 961-963 and 1147-1149). At nt 1198-1200 Thr is predicted instead of Asp. At nt 490-492, Val and at nt 1165-1167 Ser, are predicted instead of Ala and Thr, respectively, both conservative substitutions. These may represent polymorphic variation between E. coliJM 108 and AI-3, or aa sequencing errors. The sequence of an independently isolated ansB clone from E. coil MC4100, published after this paper was submitted for publication (Jennings and Beacham, 1990) is in complete agreement with that shown in Fig. 2, making nt sequencing errors unlikely.
(d) Mapping of ansB on the Escherichia coil chromosome It has been proposed on the basis of sequence similarities that L-asparaginase I and L-asparaginase II arose by divergence from a common predecessor (Jerlstrom et al., 1989). The gene encoding L-asparaginase I of E. coli (ansA) has been mapped (del Casale et al., 1983) and cloned (Spring eta]., 1986; Jerlstr0m etal., 1989). Physical maps of ordered overlapping Aor cosmid clones greatly facilitate the mapping of cloned genes. To localize ansB, further restriction mapping of pansB7 was performed, using the enzymes £coRV and PstI in addition to BamHI, EcoRI, HindIII and Kpnl (Fig. lb). The almost complete physical map of E. coil W3110 (Kohara et al., 1987) was then inspected. A perfect match was found for all the sites mapped, unambiguously placing the limits of the insert of ~ n s B (BarnHI sites) at 3106-3120kb. The ansB coding region (defined by the unique Kpnl site), therefore, lies at position 3114 kb. Interpolation from the positions of known genetic markers on the physical map suggests that this corresponds to a map position of approx. 63.8 min (near gall') on the genetic map (Bachmann, 1983). Transcription of ansB is anticlockwise, away from cca (66.8 min) towards recB (60.6 min). This map location was confirmed by plaque hybridisation of three clones from the ordered array of Kohara
3090 I
3100 I
3110 I
3120 I
3130 I
kb
,2364S I
12Ce ,3A9
t
•, pansB4
Fig. 3. Alignment of,~ clones on the physical map. ~ B and three clones from the ordered array are shown, with scale in kb (Kohara et el., 1987). The position of the 390-bp probe from pa~B4 is also shown. (This corresponds to the position of the Kpnl site in Fig. IB, which is in the opposite orientation.~
et al. (1987). The pansB4 insert hybridised to clones 12C6 and 3A9, but not to 23G4S (Fig. 3); the latter overlaps JlansB, but terminates close to the 3' end ofthe ansB-coding region. Thus, ansB maps far from ansA (39 min) on the E. coil K-12 chromosome.
(e) Conclusions (1) Cloning and sequencing of ansB shows that it encodes a pre-protein with Mr 36 854 and a 22-aa signal peptide. Some residues differ from those determined previously by direct sequencing of L-asparaginase II. (2) The ansB locus lies at 63.8 min on the E. coli chromosome. ACKNOWLEDGEMENTS DNA from E. coil JM108 was a kind gift of Dr. Anne Wakefield. I am grateful to Dr. Millicent Masters for supplying the ~, clones from the library of Kohara et al. (1987). REFERENCES Allen, G.: Sequencingof Proteins and Peptides. Elsevier, Amsterdam, 1981, pp. 171-173. Balls, F.M., Holcenberg,J.S. and Poplack, D.G.: General principles of chemotherapy. In Pizzo, P.A. and Poplack, D.G. (Eds.), Principles and Practice of Pediatric Oncology.Lippincott,Philadelphia, 1989, pp. 165-205. Bachmann, B.J.: Linkagemap of£scherlchia coil K-12,edition 7. Microbiol. Rev. 47 (1983) 180-230. Cedar, H. and Schwartz, J.H.: Production of t.-asparaginase II by Escherichla colt, J. Bacteriol. 96 (1968) 2043-2048. Chen, E.Y. and Seebur8,P.H.: Supercoilsequencing:a fast and simple method for sequencingplasmid DNA. DNA 4 (1985) 165-170. Croft, LR.: Handbook of Protein Sequence Analysis,2nd ed. Wiley, Chichester, 1980,p. 108. del Casale, T., Sollitti,P. and Chesney, R.H.: CytoplasmicL-asparaginase: isolationof a defectivestrain and mappingofansA. J. Bacteriol. 154 (1983) 513-515. Epp,O., Steigemann,W., Formanek,H. and Huber,R.: Crystallographic evidence for the tetrameric subunit structure of L-asparaginasefrom Escherichla coll. Eur. J. Biochem.20 (1971) 432-437. Feinberg, A.P. and Vogelstein,B.: A technique for radiolabellingDNA restriction fragments to high specific activity. Anal. Biochem. 137 (1985) 266-267. Gould, SJ., Subramani,S. and Schemer,I.M.: Use ofDNA polymerase chain reaction for homologyprobing: isolation of partial cDNA or genomicclonesencodingthe iron-sulfurproteinofsuccinatedehydro8enase from several species. Proc. Natl. Acad. Sci. USA 86 (1989) 1934-1938. Gubler, U.: Second-strand cDNA synthesis: mRNA fragments as primers. Methods Enzymol.152 (1987) 330-335. Jennings, M.P. and Beacham,I.R.: Ana!ysisof the £scherichia coli gene encoding L-asparaginaseII, ansB, and its regulationby cyclicAMP receptor and FNR protein. J. Bacteriol. 172 (1990) 1491-1498. Jerlstrgm, P.G., Bezjak,D.A.,Jennings,M.P. and Beacham,I.R.: Structure and expression in Escherichia coli K-12 of the c-asparaginase
105 I-encoding ansA gene and its flanking regions. Gene 78 (1989) 37-46. Kum, J., Matthes, H.W.D., Gait, MJ. and Brenner, S.: A new selective phage cloning vector, Z2001, with sites for Xbal, BamHl, H/ndlll, EcoRl, SsH and Xhol. Gene 32 (1984) 217-224. Kim, K.-W., Kamerud, J.Q., Livingston, D.M. and Roon, R.J.: Asparaginase II of Saccharomyces ceret,isiae. Characterization of the ASP3 gene. J. Biol. Chem. 263 (1988) 11948-11953. Koerholz, D., Brueck, M., Nuernberger, W., Juergens, H., Goebel, U. and Wahn, V.: Chemical and immunological characteristics of four different L-asparaginase preparations. Eur. $. Haematol. 42 (1989) 417-424. Kohara, Y., Akiyama, K. and Isono, K.: The physical map of the whole E. co~~chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 (1987) 495-508. Maita, T., Morokuma, K. and Matsuda, G.: Amino acid sequence of L-asparaginase from £scherichia co~~. J. Biochem. 76 (1974) 1351-1354. Maita, T. and Matsuda, G.: The primary structure of L-asparaginase from E. co~~. Hoppe-Seyler's Z. Physiol. Chem. 361 (1980) 105-117. Messing, J.: New MI3 vectors for cloning. Methods Enzymol. 101 (1983) 20-78. Minton, N.P., Bulhnan, H.M.S., Scawen, M.D., Atkinson, T. and Gilbert, H.J. Nucleotide sequence of the Erwinia chrysanthemi NCPPB 1066 L-asparaginase gene. Gene 46 (1986) 25-35. Platt, T.: Transcription termination and the regulation of gene expression. Annu. Rev. Biochem. 55 (1986) 339-372. Ridgway, D., Neerhout, R.C. and Bleyer, A.: Attenuation of asparaginase-induced hyperglycemia after substitution ofthe Erwinia carotovora for the Escherichia co~~enzyme preparation. Cancer 63 (1989) 561-563. Saito, M., Asakura, H., Jokaji, H., Uotani, C., Kumabashiri, I., lto, K.
and Matsuda, T.: Changes in hemostatic and fibrinolytic proteins in patients receiving L-asparaginase therapy. Am. J. Hematol. 32 (1989) 20-23. Spiers, A.S.D. and Wade, H.E.: Bacterial giutaminase in treatment of acute leukaemia. Br. Med. J. I (1976) 1317-1319. Spring, KJ., JeHstrOm, P.G., Bums, D.M. and Beacham, I.R.: L-Asparaginase genes in EscheKc&'aco//: isolation ofmutants and characterization ofthe ansA gene and its protein producL J. Bacteriol. 166 (1986) 135-142. Stormo, G.D., Schneider, T.D. and Gold, LM.: Characterization of translational initiation sites in E. co//. Nucleic Acids Res. I0 (1982) 2971-2996. Sutton, M.R. and Bradshaw, R.A.: Identification ofdansyl dipeptidcs in the dansyl-Edman peptide degradation. Anal. Biochem. 88 (1978) 344-346. Tanaka, S., Robinson, E.A., Appella, E., Miller, M., Anunon, H.L., Roberts, J., Weber, I.T. and Wlodawer, A.: Structures of amidohydrolases. Amino-acid sequence of a giutaminase-asparaginase from Acinetobacter glutaminasiflcans and preliminary crystallographic data for an asparaginase from Erwinia chrysamhemi. J. Biol. Chem. 263 (1988) 8583-8591. Tinoco Jr., !., Borer, P.N., Dengier, B., Levine, M.D., Uhlenbeck, O.C., Crothers, D.M. and Gralla, J.: Improved estimation of secondary structure in ribonucleic acids. Nature New Biol. 246 (1973) 40-41. Watson, M.E.E.: Compilation of published signal sequences. Nucleic Acids Res. 12 (1984) 5145-5164. Yanisch-Perron, C., Vieira, J. and Messing, J.: Improved MI3 vectors and host strains: nucleotide sequences of the M 13mpl8 and pUCI9 vectors. Gene 33 (1985) 103-119. Zubrod, C.G.: The clinical toxicities of L-asparaginase in treatment of leukemia and lymphoma. Pediatrics 45 (1970) 555-559.
