Tumor Biol. DOI 10.1007/s13277-014-2746-7
RESEARCH ARTICLE
KCNJ1 inhibits tumor proliferation and metastasis and is a prognostic factor in clear cell renal cell carcinoma Zhongqiang Guo & Jin Liu & Lian Zhang & Boxing Su & Yunchao Xing & Qun He & Weimin Ci & Xuesong Li & Liqun Zhou
Received: 28 July 2014 / Accepted: 15 October 2014 # International Society of Oncology and BioMarkers (ISOBM) 2014
Abstract Potassium inwardly rectifying channel, subfamily J, member 1 (KCNJ1), as an ATP-dependent potassium channel, plays an essential role in potassium balance. KCNJ1 variation is associated with multiple diseases, such as antenatal Bartter syndrome and diabetes. However, the role of KCNJ1 in clear cell renal cell carcinoma (ccRCC) is still unknown. Here, we studied the expression and function of KCNJ1 in ccRCC. The expression of KCNJ1 was evaluated in ccRCC tissues and cell lines by quantitative real-time PCR (qRT-PCR), Western blot, and immunohistochemistry analysis. The relationship between KCNJ1 expression and clinicopathological characteristics was analyzed. p3xFLAG-CMV14 vector containing KCNJ1 was constructed and used for transfecting ccRCC cell lines 786-O and Caki-2. The effects of KCNJ1 on cell proliferation, invasion, and apoptosis were detected in ccRCC cell lines using cell proliferation assay, transwell assay, and flow cytometry, respectively. We found that KCNJ1 was low-expressed in ccRCC tissues samples and cell lines, and its expression level was significantly associated with tumor pathology grade (P=0.002) and clinical stage (P= 0.023). Furthermore, the KCNJ1 expression was a prognostic Z. Guo : J. Liu : L. Zhang : B. Su : Y. Xing : Q. He : X. Li : L. Zhou Department of Urology, Peking University First Hospital, No. 8, Xishiku Street, Xicheng District, Beijing 100034, China Z. Guo : J. Liu : L. Zhang : B. Su : Y. Xing : Q. He : X. Li (*) : L. Zhou (*) The Institute of Urology, Peking University, No. 8, Xishiku Street, Xicheng District, Beijing 100034, China e-mail: [email protected] e-mail: [email protected] Z. Guo : J. Liu : L. Zhang : B. Su : Y. Xing : Q. He : X. Li : L. Zhou National Urological Cancer Center, Beijing 100034, China W. Ci Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing 100101, China
factor of ccRCC patient’s survival (P = 0.033). The reexpression of KCNJ1 in 786-O and Caki-2 significantly inhibited cancer cell growth and invasion and promoted cancer cell apoptosis. Moreover, knockdown of KCNJ1 in HK-2 cells promoted cell proliferation. Collectively, these data highlight that KCNJ1, low-expressed in ccRCC and associated with poor prognosis, plays an important role in ccRCC cell growth and metastasis. Keywords KCNJ1 . Clear cell renal cell carcinoma . Prognostic factor . Proliferation . Invasion . Apoptosis
Introduction Renal cell carcinoma (RCC) is the most common adult renal cancer, accounting for approximately 90 % of renal malignant tumor [1]. RCC is the eighth most common malignancy, accounting for about 4 % of all cancers in the USA [2]. RCC can be classified into several pathological subtypes: clear cell, papillary, chromophobe, collecting duct, and unclassified subtype. Among these subtypes, clear cell renal cell carcinoma (ccRCC) is the most common subtype of RCC, accounting for approximately 60–80 % of all cases [3]. Unfortunately, most of the ccRCCs are not sensitive to radiotherapy or chemotherapy. Radical nephrectomy is effective on early and local ccRCCs, but metastatic ccRCCs have poor prognosis. Although therapeutic approaches, such as the tumor targeting therapy, have improved over time, the 5-year survival rate for metastatic ccRCC remains under 10 % [4]. Therefore, effective novel treatments for advanced ccRCC are urgently needed. Potassium inwardly rectifying channel, subfamily J, member 1 (KCNJ1), also named as renal outer medullary K+ channel (ROMK), is an ATP-dependent potassium channel in apical membranes of kidney tubules [5]. KCNJ1 plays an
Tumor Biol.
essential role in potassium balance [6]. Moreover, mitochondrial KCNJ1 has an important role in the protection against hypoxia-induced brain injury during stroke or other ischemic attacks [7]. Surface expression state is important for KCNJ1 to exert its transporting function [8]. The phosphorylation of KCNJ1 can affect its surface expression and gating [8]. KCNJ1 activity is regulated by variety of kinases and phosphatases. The tyrosine kinase Src [9] and threonine kinases PKC [10], PKA [11], and WNK [5, 9] change KCNJ1 surface expression by affecting its phosphorylation state. KCNJ1 variation is associated with multiple diseases. KCNJ1 mutation could lead to antenatal Bartter syndrome, which is characterized by hypokalemic alkalosis, hypercalciuria, salt wasting, and low blood pressure [12–15]. In Karnes’s study on African-American showed that KCNJ1 single nucleotide polymorphisms (SNPs) and haplotypes are associated with thiazide-induced dysglycemia and new onset diabetes (strongest association: OR=2.14) [16]. According to the Framingham Heart Study, humans heterozygous for KCNJ1 mutation have reduced blood pressure [17]. Two-phase study of KCNJ1 based on 1,818 colorectal adenoma cases and 3,992 controls tagged 13 SNPs in the KCNJ1 and concluded that KCNJ1 variants significantly interacted with calcium and magnesium intakes, which will increase the risk of colorectal adenoma, particularly for multiple adenoma [18]. This study implied that KCNJ1 may play a crucial role in tumorigenesis. However, the precise mechanism of KCNJ1 in adenomas is unknown, and there is no further study of KCNJ1 in other carcinomas. A study about genome-wide analysis of differential expressed genes in ccRCC hints that KCNJ1 is downregulated in ccRCC tissues compared with adjacent normal kidney tissues [19]. However, the role of KCNJ1 in ccRCC tumorigenesis and development remains elusive. Therefore, in this study, we determined the low expression of KCNJ1 in ccRCC tissue samples and cell lines using quantitative real-time PCR (qRT-PCR), Western blot, and immunohistochemistry analysis and found that KCNJ1 expression level is correlated with clinical stage, pathological grade, and overall survival of ccRCC patients. We also studied the potential function of KCNJ1 in ccRCC cell growth, invasion, and apoptosis by plasmid transfection. Upregulation of KCNJ1 in ccRCC cells 786-O and Caki-2 may reduce cell proliferation, inhibit cell invasion, and promote cell apoptosis.
Materials and methods Patient samples In total, 102 human ccRCCs and their corresponding adjacent normal kidney samples were obtained at the time of surgical
resection at Peking University First Hospital from January 2006 to January 2010. These samples were paraffin-embedded. The pathological grade and subtype of samples were assessed by the Peking University First Hospital Department of Urology Pathology. Seventeen paired ccRCC and matched adjacent normal kidney samples were randomly selected from the 102 patients for real-time RT-PCR, and three of them were analyzed by Western blot analysis. Samples were stored in liquid nitrogen until use. Informed consent forms and approval for the study were obtained from the Ethics Committee of Peking University First Hospital. Cell culture The ccRCC cell lines, A498, Caki-1, Caki-2, Ketr-3, OS-RC2, and 786-O were purchased from the National Platform of Experimental Cell Resources for Sci-Tech (Beijing, China), and the HEK293 cells were purchased from ATCC (Manassas, VA, USA). Cells were cultured in Dulbecco’s modified Eagle’s medium/high glucose (DMEM/HG) or McCoy’s medium containing 10 % Gibco fetal bovine serum (FBS; Carlsbad, CA, USA). The human kidney tubular epithelial cells (HK-2) were purchased from ATCC and cultured in KSF medium with bovine pituitary extract and epidermal growth factor (Gibco, Carlsbad, CA, USA). All cells were cultured at 37 °C in a humidified incubator with 5 % CO2. Quantitative real-time PCR assay The total RNA from frozen samples and cultured cells was isolated using TRIzol Reagent (Invitrogen), and 3 μg of total RNA was reverse-transcribed into complementary DNA (cDNA) using the Reverse Transcription System Kit (Promega, Madison, WI, USA). Equal volume of cDNA was used as template for quantitative PCR (qPCR), using SYBR Green PCR Mix (Rothe, Indianapolis, IN, USA) in the Applied Biosystems 7300 Fast Real-time PCR system. The primer sequences were as follows: KCNJ1, TTCGGAAATGGG TCGTCACTCG (forward) and CCCCAAGAAGGCTGTG ATGAAAA (reverse); GAPDH, CGACCACTTTGTCAAG CTCA (forward) and CCCTGTTGCTGTAGCCAAAT (reverse). The KCNJ1 level was calculated using the comparative ΔΔCT method with the GAPDH for normalization. Immunohistochemistry assay Paraffin-embedded samples were cut to 4-μm thickness and mounted on the polylysine-coated slides. Endogenous peroxidase was inactivated by 3 % hydrogen peroxide for 10 min. The sections were incubated with rabbit anti-KCNJ1 antibody (1:50, Sigma, USA) at 4 °C overnight, and then the sections were incubated with the secondary antibody (ZSGB-BIO, China) for 30 min. DAB Enhancer (Dako) was used for
Tumor Biol.
1 min to enrich the brown color. All sections were counterstained with hematoxylin for 1 min. The expression of KCNJ1 in all sections was assessed by two experienced pathologists. The staining intensity was scored as follows: “−” for negative staining, “+” for weak staining, “++” for moderate staining, and “+++” for strong staining. The KCNJ1 expression level was considered “low or none” when staining intensity was “−” or “+” and “high” when the staining intensity was “++” or “+++.”
DMEM/HG medium with 2 % FBS for 12 h, and then to DMEM/HG with 10 % FBS for 24 h. At the end of incubation, cells were trypsinized and washed with cold phosphatebuffered saline (PBS), and fixed with 75 % ice-cold ethanol for 24 h at −20 °C and then, cells were measured on a FACScalibur flow cytometer (Becton Dickinson, San Jose, CA, USA).
Construction of KCNJ1 expressing vector
The cell invasive and migratory potential in vitro was detected using 8-μm Cell Culture Inserts (Millipore Corporation, Billerica, MA, USA) coated with Matrigel (BD Biosciences, Bedford, MA, USA). Transfected 786-O and Caki-2 cells (2×104) in 100 μl serum-free DMEM/HG medium were added to the upper chamber of transwell, while the lower chamber was filled with 600 μl of DMEM/HG medium containing 10 % FBS. After incubating cells at 37 °C for 24 h, the transwells were fixed with methanol for 30 min, stained with 0.1 % crystal violet buffer for 15 min, and then scrape off the cells on the top of the transwells using a cotton swab. For quantification, invasive cells were counted under a microscope in five fields randomly at ×200 magnification and summarized by means±SD (standard deviation). All assays were repeated three times independently.
Human KCNJ1 fragment was acquired from HEK293 cell cDNA. To amplify the KCNJ1 fragment, we used the following primers: TGCGGCCGCGATGAATGCTTCCAGTCGG AAT (forward) and CCGGATCCCATTTTGGTGTCATCT GTTTCA (reverse). The amplified fragments were purified and digested using NotI and BamHI and then cloned into p3xFLAG-CMV-14 vector with a 3xFlag tag. The constructed vector was verified by standard DNA sequencing. RNA interference The small interfering RNA (siRNA) targeting the human KCNJ1 transcript was designed using the software developed by Ambion (Foster, CA, USA); target sequences are as follows: siKCNJ1-1: UGUGGAGGCACAGTCAAGGTT, siKCNJ1-2: ACGUGCCAAGACCAUUACGTT, and siControl: UUCUCCGAACGUGUCACGUTT. Transient siRNA transfection was performed using Lipofectamine RNAiMAX transfection reagent (Invitrogen, USA) according to the manufacturer’s instruction. The interference efficiency of each individual siRNA was checked using Western blot analysis. Cell proliferation assay The CellTiter-Blue Reagent (Promega, Madison, WI, USA) was performed to test cell viability and proliferation. After transfection, 786-O and Caki-2 cells (1,000–2,000/well) were seeded into 96-well plates and cultured, and the cell viability was detected using CellTiter-Blue Reagent every 24 h. To detect cell viability, 20 μl CellTiter-Blue Reagent was added into each well, incubating the plate for 3 h at 37 °C, and then fluorescence was recorded at an excitation wavelength of 560 nm and an emission wavelength of 590 nm with a Labsystems Fluoroskan Ascent plate reader.
Cell invasion assay
Cell apoptosis assay Flow cytometry 786-O and Caki-2 cells were plated into sixwell plates at a density of 2×105 cells/well and cultured overnight, then transfected using KCNJ1 vector or control vector, and cultured for 3 days. The cells were trypsinized and washed with cold PBS for twice, stained using the Annexin V-PE/7-AAD Kit (Keygen) following the manufacturer’s protocol, and then analyzed using a FACScalibur flow cytometer. Caspase activity The cell apoptosis assay was also performed using the Apo-ONE® Homogeneous Caspase-3/7 Kit (Promega, Madison, WI, USA) according to the manufacturer’s instruction. After transfecting for 24 h, 786-O and Caki-2 cells (5,000/well) were seeded into a 96-well plate and cultured for 48 h. One hundred microliters of ApoONE® Caspase-3/7 Reagent was mixed to each well containing 100 ul medium, the plate was incubated in the dark place at room temperature for 6 h, and then the fluorescence was measured at an excitation wavelength of 480 nm and an emission wavelength range of 530 nm.
Cell cycle analysis Western blot analysis 786-O and Caki-2 cells were plated in six-well plates at a density of 1–2×105 cells/well and cultured for 12 h, and then transfected and cultured for 24 h. The medium was changed to
Protein of cell line and ccRCC samples was prepared using RIPA lysis buffer. Protein concentration was measured using
Tumor Biol.
BCA Protein Assay Kit (CWBIO, China), and equal amounts of protein (20 μg) were separated in 12 % sodium dodecylsulfate (SDS)–polyacrylamide gels. Western blot analysis was performed according to a standard protocol as described previously [20]. The primary antibodies used in this study contained: anti-Flag, caspase9, caspase8, P53, Bcl-2, Bcl-xl, Bax, cleaved caspase 3, PARP, tubulin (Cell Signal Tech, USA), GAPDH, caspase3 (Protein Tech, USA), and KCNJ1 (Sigma, USA). Statistical analysis The overall survival was analyzed using the Kaplan–Meier estimator. Statistical analysis was performed using SPSS 16.0 (SPSS Inc, Chicago, IL, USA). All data groups were analyzed by chi-square test or one-way ANOVA which is indicated in the figure legends. Data was presented as mean±SD for at least triplicate trial. The star marker “*” indicates the significant statistical difference compared with control at P
RESEARCH ARTICLE
KCNJ1 inhibits tumor proliferation and metastasis and is a prognostic factor in clear cell renal cell carcinoma Zhongqiang Guo & Jin Liu & Lian Zhang & Boxing Su & Yunchao Xing & Qun He & Weimin Ci & Xuesong Li & Liqun Zhou
Received: 28 July 2014 / Accepted: 15 October 2014 # International Society of Oncology and BioMarkers (ISOBM) 2014
Abstract Potassium inwardly rectifying channel, subfamily J, member 1 (KCNJ1), as an ATP-dependent potassium channel, plays an essential role in potassium balance. KCNJ1 variation is associated with multiple diseases, such as antenatal Bartter syndrome and diabetes. However, the role of KCNJ1 in clear cell renal cell carcinoma (ccRCC) is still unknown. Here, we studied the expression and function of KCNJ1 in ccRCC. The expression of KCNJ1 was evaluated in ccRCC tissues and cell lines by quantitative real-time PCR (qRT-PCR), Western blot, and immunohistochemistry analysis. The relationship between KCNJ1 expression and clinicopathological characteristics was analyzed. p3xFLAG-CMV14 vector containing KCNJ1 was constructed and used for transfecting ccRCC cell lines 786-O and Caki-2. The effects of KCNJ1 on cell proliferation, invasion, and apoptosis were detected in ccRCC cell lines using cell proliferation assay, transwell assay, and flow cytometry, respectively. We found that KCNJ1 was low-expressed in ccRCC tissues samples and cell lines, and its expression level was significantly associated with tumor pathology grade (P=0.002) and clinical stage (P= 0.023). Furthermore, the KCNJ1 expression was a prognostic Z. Guo : J. Liu : L. Zhang : B. Su : Y. Xing : Q. He : X. Li : L. Zhou Department of Urology, Peking University First Hospital, No. 8, Xishiku Street, Xicheng District, Beijing 100034, China Z. Guo : J. Liu : L. Zhang : B. Su : Y. Xing : Q. He : X. Li (*) : L. Zhou (*) The Institute of Urology, Peking University, No. 8, Xishiku Street, Xicheng District, Beijing 100034, China e-mail: [email protected] e-mail: [email protected] Z. Guo : J. Liu : L. Zhang : B. Su : Y. Xing : Q. He : X. Li : L. Zhou National Urological Cancer Center, Beijing 100034, China W. Ci Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing 100101, China
factor of ccRCC patient’s survival (P = 0.033). The reexpression of KCNJ1 in 786-O and Caki-2 significantly inhibited cancer cell growth and invasion and promoted cancer cell apoptosis. Moreover, knockdown of KCNJ1 in HK-2 cells promoted cell proliferation. Collectively, these data highlight that KCNJ1, low-expressed in ccRCC and associated with poor prognosis, plays an important role in ccRCC cell growth and metastasis. Keywords KCNJ1 . Clear cell renal cell carcinoma . Prognostic factor . Proliferation . Invasion . Apoptosis
Introduction Renal cell carcinoma (RCC) is the most common adult renal cancer, accounting for approximately 90 % of renal malignant tumor [1]. RCC is the eighth most common malignancy, accounting for about 4 % of all cancers in the USA [2]. RCC can be classified into several pathological subtypes: clear cell, papillary, chromophobe, collecting duct, and unclassified subtype. Among these subtypes, clear cell renal cell carcinoma (ccRCC) is the most common subtype of RCC, accounting for approximately 60–80 % of all cases [3]. Unfortunately, most of the ccRCCs are not sensitive to radiotherapy or chemotherapy. Radical nephrectomy is effective on early and local ccRCCs, but metastatic ccRCCs have poor prognosis. Although therapeutic approaches, such as the tumor targeting therapy, have improved over time, the 5-year survival rate for metastatic ccRCC remains under 10 % [4]. Therefore, effective novel treatments for advanced ccRCC are urgently needed. Potassium inwardly rectifying channel, subfamily J, member 1 (KCNJ1), also named as renal outer medullary K+ channel (ROMK), is an ATP-dependent potassium channel in apical membranes of kidney tubules [5]. KCNJ1 plays an
Tumor Biol.
essential role in potassium balance [6]. Moreover, mitochondrial KCNJ1 has an important role in the protection against hypoxia-induced brain injury during stroke or other ischemic attacks [7]. Surface expression state is important for KCNJ1 to exert its transporting function [8]. The phosphorylation of KCNJ1 can affect its surface expression and gating [8]. KCNJ1 activity is regulated by variety of kinases and phosphatases. The tyrosine kinase Src [9] and threonine kinases PKC [10], PKA [11], and WNK [5, 9] change KCNJ1 surface expression by affecting its phosphorylation state. KCNJ1 variation is associated with multiple diseases. KCNJ1 mutation could lead to antenatal Bartter syndrome, which is characterized by hypokalemic alkalosis, hypercalciuria, salt wasting, and low blood pressure [12–15]. In Karnes’s study on African-American showed that KCNJ1 single nucleotide polymorphisms (SNPs) and haplotypes are associated with thiazide-induced dysglycemia and new onset diabetes (strongest association: OR=2.14) [16]. According to the Framingham Heart Study, humans heterozygous for KCNJ1 mutation have reduced blood pressure [17]. Two-phase study of KCNJ1 based on 1,818 colorectal adenoma cases and 3,992 controls tagged 13 SNPs in the KCNJ1 and concluded that KCNJ1 variants significantly interacted with calcium and magnesium intakes, which will increase the risk of colorectal adenoma, particularly for multiple adenoma [18]. This study implied that KCNJ1 may play a crucial role in tumorigenesis. However, the precise mechanism of KCNJ1 in adenomas is unknown, and there is no further study of KCNJ1 in other carcinomas. A study about genome-wide analysis of differential expressed genes in ccRCC hints that KCNJ1 is downregulated in ccRCC tissues compared with adjacent normal kidney tissues [19]. However, the role of KCNJ1 in ccRCC tumorigenesis and development remains elusive. Therefore, in this study, we determined the low expression of KCNJ1 in ccRCC tissue samples and cell lines using quantitative real-time PCR (qRT-PCR), Western blot, and immunohistochemistry analysis and found that KCNJ1 expression level is correlated with clinical stage, pathological grade, and overall survival of ccRCC patients. We also studied the potential function of KCNJ1 in ccRCC cell growth, invasion, and apoptosis by plasmid transfection. Upregulation of KCNJ1 in ccRCC cells 786-O and Caki-2 may reduce cell proliferation, inhibit cell invasion, and promote cell apoptosis.
Materials and methods Patient samples In total, 102 human ccRCCs and their corresponding adjacent normal kidney samples were obtained at the time of surgical
resection at Peking University First Hospital from January 2006 to January 2010. These samples were paraffin-embedded. The pathological grade and subtype of samples were assessed by the Peking University First Hospital Department of Urology Pathology. Seventeen paired ccRCC and matched adjacent normal kidney samples were randomly selected from the 102 patients for real-time RT-PCR, and three of them were analyzed by Western blot analysis. Samples were stored in liquid nitrogen until use. Informed consent forms and approval for the study were obtained from the Ethics Committee of Peking University First Hospital. Cell culture The ccRCC cell lines, A498, Caki-1, Caki-2, Ketr-3, OS-RC2, and 786-O were purchased from the National Platform of Experimental Cell Resources for Sci-Tech (Beijing, China), and the HEK293 cells were purchased from ATCC (Manassas, VA, USA). Cells were cultured in Dulbecco’s modified Eagle’s medium/high glucose (DMEM/HG) or McCoy’s medium containing 10 % Gibco fetal bovine serum (FBS; Carlsbad, CA, USA). The human kidney tubular epithelial cells (HK-2) were purchased from ATCC and cultured in KSF medium with bovine pituitary extract and epidermal growth factor (Gibco, Carlsbad, CA, USA). All cells were cultured at 37 °C in a humidified incubator with 5 % CO2. Quantitative real-time PCR assay The total RNA from frozen samples and cultured cells was isolated using TRIzol Reagent (Invitrogen), and 3 μg of total RNA was reverse-transcribed into complementary DNA (cDNA) using the Reverse Transcription System Kit (Promega, Madison, WI, USA). Equal volume of cDNA was used as template for quantitative PCR (qPCR), using SYBR Green PCR Mix (Rothe, Indianapolis, IN, USA) in the Applied Biosystems 7300 Fast Real-time PCR system. The primer sequences were as follows: KCNJ1, TTCGGAAATGGG TCGTCACTCG (forward) and CCCCAAGAAGGCTGTG ATGAAAA (reverse); GAPDH, CGACCACTTTGTCAAG CTCA (forward) and CCCTGTTGCTGTAGCCAAAT (reverse). The KCNJ1 level was calculated using the comparative ΔΔCT method with the GAPDH for normalization. Immunohistochemistry assay Paraffin-embedded samples were cut to 4-μm thickness and mounted on the polylysine-coated slides. Endogenous peroxidase was inactivated by 3 % hydrogen peroxide for 10 min. The sections were incubated with rabbit anti-KCNJ1 antibody (1:50, Sigma, USA) at 4 °C overnight, and then the sections were incubated with the secondary antibody (ZSGB-BIO, China) for 30 min. DAB Enhancer (Dako) was used for
Tumor Biol.
1 min to enrich the brown color. All sections were counterstained with hematoxylin for 1 min. The expression of KCNJ1 in all sections was assessed by two experienced pathologists. The staining intensity was scored as follows: “−” for negative staining, “+” for weak staining, “++” for moderate staining, and “+++” for strong staining. The KCNJ1 expression level was considered “low or none” when staining intensity was “−” or “+” and “high” when the staining intensity was “++” or “+++.”
DMEM/HG medium with 2 % FBS for 12 h, and then to DMEM/HG with 10 % FBS for 24 h. At the end of incubation, cells were trypsinized and washed with cold phosphatebuffered saline (PBS), and fixed with 75 % ice-cold ethanol for 24 h at −20 °C and then, cells were measured on a FACScalibur flow cytometer (Becton Dickinson, San Jose, CA, USA).
Construction of KCNJ1 expressing vector
The cell invasive and migratory potential in vitro was detected using 8-μm Cell Culture Inserts (Millipore Corporation, Billerica, MA, USA) coated with Matrigel (BD Biosciences, Bedford, MA, USA). Transfected 786-O and Caki-2 cells (2×104) in 100 μl serum-free DMEM/HG medium were added to the upper chamber of transwell, while the lower chamber was filled with 600 μl of DMEM/HG medium containing 10 % FBS. After incubating cells at 37 °C for 24 h, the transwells were fixed with methanol for 30 min, stained with 0.1 % crystal violet buffer for 15 min, and then scrape off the cells on the top of the transwells using a cotton swab. For quantification, invasive cells were counted under a microscope in five fields randomly at ×200 magnification and summarized by means±SD (standard deviation). All assays were repeated three times independently.
Human KCNJ1 fragment was acquired from HEK293 cell cDNA. To amplify the KCNJ1 fragment, we used the following primers: TGCGGCCGCGATGAATGCTTCCAGTCGG AAT (forward) and CCGGATCCCATTTTGGTGTCATCT GTTTCA (reverse). The amplified fragments were purified and digested using NotI and BamHI and then cloned into p3xFLAG-CMV-14 vector with a 3xFlag tag. The constructed vector was verified by standard DNA sequencing. RNA interference The small interfering RNA (siRNA) targeting the human KCNJ1 transcript was designed using the software developed by Ambion (Foster, CA, USA); target sequences are as follows: siKCNJ1-1: UGUGGAGGCACAGTCAAGGTT, siKCNJ1-2: ACGUGCCAAGACCAUUACGTT, and siControl: UUCUCCGAACGUGUCACGUTT. Transient siRNA transfection was performed using Lipofectamine RNAiMAX transfection reagent (Invitrogen, USA) according to the manufacturer’s instruction. The interference efficiency of each individual siRNA was checked using Western blot analysis. Cell proliferation assay The CellTiter-Blue Reagent (Promega, Madison, WI, USA) was performed to test cell viability and proliferation. After transfection, 786-O and Caki-2 cells (1,000–2,000/well) were seeded into 96-well plates and cultured, and the cell viability was detected using CellTiter-Blue Reagent every 24 h. To detect cell viability, 20 μl CellTiter-Blue Reagent was added into each well, incubating the plate for 3 h at 37 °C, and then fluorescence was recorded at an excitation wavelength of 560 nm and an emission wavelength of 590 nm with a Labsystems Fluoroskan Ascent plate reader.
Cell invasion assay
Cell apoptosis assay Flow cytometry 786-O and Caki-2 cells were plated into sixwell plates at a density of 2×105 cells/well and cultured overnight, then transfected using KCNJ1 vector or control vector, and cultured for 3 days. The cells were trypsinized and washed with cold PBS for twice, stained using the Annexin V-PE/7-AAD Kit (Keygen) following the manufacturer’s protocol, and then analyzed using a FACScalibur flow cytometer. Caspase activity The cell apoptosis assay was also performed using the Apo-ONE® Homogeneous Caspase-3/7 Kit (Promega, Madison, WI, USA) according to the manufacturer’s instruction. After transfecting for 24 h, 786-O and Caki-2 cells (5,000/well) were seeded into a 96-well plate and cultured for 48 h. One hundred microliters of ApoONE® Caspase-3/7 Reagent was mixed to each well containing 100 ul medium, the plate was incubated in the dark place at room temperature for 6 h, and then the fluorescence was measured at an excitation wavelength of 480 nm and an emission wavelength range of 530 nm.
Cell cycle analysis Western blot analysis 786-O and Caki-2 cells were plated in six-well plates at a density of 1–2×105 cells/well and cultured for 12 h, and then transfected and cultured for 24 h. The medium was changed to
Protein of cell line and ccRCC samples was prepared using RIPA lysis buffer. Protein concentration was measured using
Tumor Biol.
BCA Protein Assay Kit (CWBIO, China), and equal amounts of protein (20 μg) were separated in 12 % sodium dodecylsulfate (SDS)–polyacrylamide gels. Western blot analysis was performed according to a standard protocol as described previously [20]. The primary antibodies used in this study contained: anti-Flag, caspase9, caspase8, P53, Bcl-2, Bcl-xl, Bax, cleaved caspase 3, PARP, tubulin (Cell Signal Tech, USA), GAPDH, caspase3 (Protein Tech, USA), and KCNJ1 (Sigma, USA). Statistical analysis The overall survival was analyzed using the Kaplan–Meier estimator. Statistical analysis was performed using SPSS 16.0 (SPSS Inc, Chicago, IL, USA). All data groups were analyzed by chi-square test or one-way ANOVA which is indicated in the figure legends. Data was presented as mean±SD for at least triplicate trial. The star marker “*” indicates the significant statistical difference compared with control at P
