ARTICLE
Journal of Cellular Biochemistry 117:1522–1528 (2016)
Kallikrein Promotes Inflammation in Human Dental Pulp Cells Via Protease-Activated Receptor-1 Tomomi Hayama,1* Naoto Kamio,1 Tatsu Okabe,1 Koichiro Muromachi,2 and Kiyoshi Matsushima1,3 1
Department of Endodontics, Nihon University School of Dentistry at Matsudo, Matsudo, Chiba 271-8587, Japan Department of Pulp Biology and Endodontics, Graduate School of Dentistry, Kanagawa Dental University, Yokosuka, Kanagawa 238-8580, Japan 3 Research Institute of Oral Science, Nihon University School of Dentistry at Matsudo, Matsudo, Chiba 271-8587, Japan 2
ABSTRACT Plasma kallikrein (KLKB1), a serine protease, cleaves high-molecular weight kininogen to produce bradykinin, a potent vasodilator and pro-inflammatory peptide. In addition, KLKB1 activates plasminogen and other leukocyte and blood coagulation factors and processes proenkephalin, prorenin, and C3. KLKB1 has also been shown to cleave protease-activated receptors in vascular smooth muscle cells to regulate the expression of epidermal growth factor receptor. In this study, we investigated KLKB1-dependent inflammation and activation of proteaseactivated receptor-1 in human dental pulp cells. These cells responded to KLKB1 stimulation by increasing intracellular Ca2þ, upregulating cyclooxygenase-2, and secreting prostaglandin E2. Remarkably, SCH79797, an antagonist of protease-activated receptor-1, blocked these effects. Thus, these data indicate that KLKB1 induces inflammatory reactions in human dental tissues via protease-activated receptor 1. J. Cell. Biochem. 117: 1522–1528, 2016. © 2015 Wiley Periodicals, Inc.
KEY WORDS:
T
KALLIKREIN; PROTEASE-ACTIVATED RECEPTOR; INFLAMMATION; DENTAL PULP; PULPITIS
he life of a tooth is determined primarily by the health of the dental pulp, a tissue of mesenchymal origin that consists of an odontoblast layer and an immunocompetent connective tissue with nerves and vascular elements. Irritation of the dental pulp by mechanical, thermal, chemical, or bacterial stimuli triggers inflammation [Selzer and Bender, 1984] and production of proinflammatory cytokines, such as interleukin-1b (IL-1b), prostaglandin, cyclooxygenase (COX), and tumor necrosis factor [Sundqvist and Lerner, 1996; Chang et al., 2006]. After such irritation, the tissue becomes necrotic because it does not possess the capacity to heal. Notably, pulpitis is associated with tissue degradation. Indeed, elastinolytic and collagenolytic activities are enhanced in patients with suppurative pulpitis and necrosis [Morand et al., 1981]. In addition, pro-inflammatory cytokines have been shown to induce the expression of matrix metalloproteinases [O0 Boskey and Panagakos, 1998]. These observations indicate that inflammatory reactions in dental pulp resemble those in other tissues. Thus, a better understanding of such reactions will accelerate the development of preventive or therapeutic treatments.
Plasma kallikrein (KLKB1), a serine protease, regulates the maturation of various precursor proteins [Metters et al., 1988]. For example, KLKB1 activates plasminogen [Oikonomopoulou et al., 2006] and prorenin [Sainz et al., 2007; Schmaier, 2008]. In addition, this protease generates bradykinin during coagulation by cleaving high-molecularweight kininogen [Kitamura et al., 1985]. Kinin induces blood vessel hyperpermeability, leukocyte migration, smooth muscle contraction, vasodilatation, edema, and sodium excretion from the renal tubule. Furthermore, kinin mediates pain, acute inflammation, and hypertension [Francel, 1992]. Therefore, understanding the kallikrein-kinin system may provide a basis for controlling inflammation. Protease-activated receptor (PAR)-1 to PAR-4 are G proteincoupled receptors with seven transmembrane domains [Coughlin, 2000; Trejo, 2003]. PARs are widely distributed, especially throughout the alimentary system, and regulate various physiological processes, including exocrine secretion from the salivary, gastric, or pancreatic gland, motility of gastrointestinal smooth muscles, cytoprotection of gastric mucosa, and suppression of visceral pain [Kawabata et al., 2008]. PARs are activated by cleavage of the extracellular N-terminal
Grant sponsor: Japan Society for the Promotion of Science; Grant numbers: 24392079, 24592885. *Correspondence to: Tomomi Hayama, Department of Endodontics, Nihon University School of Dentistry at Matsudo, Matsudo, Chiba 271-8587, Japan. E-mail: [email protected] Manuscript Received: 2 October 2015; Manuscript Accepted: 10 November 2015 Accepted manuscript online in Wiley Online Library (wileyonlinelibrary.com): 13 November 2015 DOI 10.1002/jcb.25437 © 2015 Wiley Periodicals, Inc.
1522
domain, an event that enables the new N-terminus to allosterically activate signal transduction pathways [Coughlin, 2000; Trejo, 2003]. Remarkably, cleavage at specific activation sites determines the functional properties of the resulting activated receptor. Indeed, proteases that activate PARs have been identified through the pathways affected by different cleavage sites [Trivedi et al., 2009; Jaffre et al., 2012]. In addition, PAR activation triggers inflammatory responses. For example, PAR-1 also stimulates the expression of COX-2 and prostaglandin E2 (PGE2) in myofibroblasts and cardiomyocytes [Seymour et al., 2003; Chien et al., 2014]. Dental pulp fibroblasts express PAR-1, PAR-3, and PAR-4 [Gruber et al., 2004]. Moreover, PAR-2 has been shown to regulate dental pulp inflammation due to caries [Lundy et al., 2010] and to mediate neuropeptide release resulting from cleavage by argininespecific cysteine protease [Tancharoen et al., 2005]. Gingival fibroblasts also express PAR-1 and PAR-3 [Chan et al., 2008], and secrete IL-6 in response to PAR-1 [Tanaka et al., 2004]. In addition, we demonstrated that plasmin activates PAR-1 to stimulate the expression of IL-8 and release of PGE2 [Kamio et al., 2008]. These observations imply that PARs may be involved in pulpitis through mechanisms that have yet to be completely elucidated. In the present study, we demonstrate that KLKB1 activates PAR-1 to trigger inflammatory reactions in human dental pulp cells.
MATERIALS AND METHODS MATERIALS Fungizone, trypsin, and a-essential medium (a-MEM) supplemented with fetal calf serum (FCS) were purchased from GIBCO BRL Life Technologies (Tokyo, Japan). Penicillin G and kanamycin were purchased from Meiji Seika (Tokyo, Japan), and Fura-2/AM was obtained from Dojindo Labs (Tokyo, Japan). Recombinant human plasma KLKB1 was purchased from R&D Systems (MN). N3Cyclopropyl-7-{[4-(1-methylethyl) phenyl] methyl}-7H-pyrrolo [3,2-f]qinazoline-1,3-diamine (SCH79797) was purchased from Tocris Bioscience (Ellisville, MI). The PGE2 enzyme immunoassay kit was obtained from Oxford Biomedical Research (MI). Mouse antibodies against human COX-2 were purchased from Santa Cruz Biotechnology (CA). Rabbit antibodies against human b-actin and horseradish peroxidase (HRP)-conjugated anti-rabbit IgG were purchased from Cell Signaling Technology (Danvers, MA). HRPconjugated anti-mouse IgG was obtained from HIS Globalspec (NY). CELL CULTURE Human dental pulp (fibroblast-like) cells were harvested from third molars extracted under aseptic conditions from 20-year-old patients undergoing orthodontic treatments. Tissues were then minced on sterilized glass coverslips and cultured to confluence in a-MEM supplemented with 10% FCS, 20 U/mL penicillin G, 100 mg/mL kanamycin, and 250 ng/mL fungizone. Subsequently, cells were detached with 0.05% trypsin in phosphate-buffered saline, subcultured in culture flasks, and plated at 2 105 cells/mL after 6–9 passages. Informed consent was obtained from all patients, and this study was approved by the ethics committee of Nihon University School of Dentistry at Matsudo (No. EC12-010).
JOURNAL OF CELLULAR BIOCHEMISTRY
MEASUREMENT OF INTRACELLULAR CA2þ Human dental pulp cells (1 105) were cultured in thin, circular, 13.5-mm glass plates containing a-MEM with 10% FCS. Confluent cells were labeled for 30 min at 37°C with 2 mM Fura-2/AM in a-MEM, washed twice, and harvested into quartz cuvettes containing Krebs-Ringer-HEPES solution (120 mM NaCl, 5 mM KCl, 1 mM MgSO4, 0.96 mM NaH2PO4, 0.2% glucose, 0.1% bovine serum albumin, 1 mM CaCl2, and 20 mM HEPES, pH 7.4). Fluorescence at 500 nm was measured with a CAF-110 spectrofluorometer (Nion Bunkou, Japan), with excitation at 340 and 380 nm. Intracellular Ca2þ was calculated from the ratio of fluorescence intensities [Grynkiewicz et al., 1985]. REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION (RT-PCR) Human dental pulp cells (1 106) were cultured to confluence in 10-cm tissue culture dishes containing a-MEM with 10% FCS. Cultures were then incubated for 24 h in a-MEM containing 1% FCS. To measure the effects of KLKB1 on COX-2 expression, cells were incubated for another 1 h with or without KLKB1 in a-MEM supplemented with 1% FCS. Total RNA was then extracted using an RNeasy Mini Kit (Qiagen, Hilden, Germany), following the manufacturer0 s protocol. Subsequently, cDNA was synthesized and amplified by RT-PCR using a One Step RT-PCR Kit (Qiagen) and a PCR Thermal Cycler Dice instrument (TaKaRa, Shiga, Japan). Briefly, RNA (100 ng) was amplified with 500 nM oligonucleotide primers for COX-2 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Reactions were carried out with predenaturation for 30 min at 95°C and amplification with 22 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s, elongation at 72°C for 30 s, and final extension for 10 min at 72°C. Finally, amplification products were electrophoresed on 2.0% agarose gels and visualized with ethidium bromide. Primer sequences are listed in Table I. REAL-TIME RT-PCR Human dental pulp cells were cultured to confluence in 10-cm tissue culture dishes containing a-MEM supplemented with 10% FCS. Cells were then incubated for 24 h in a-MEM containing 1% FCS, stimulated with KLKB1, and washed twice with PBS. Total RNA was extracted using an RNeasy Mini Kit (Qiagen), following the manufacturer0 s protocol. RNA concentrations were measured by absorbance at 260 and 280 nm. Real-time PCR was performed in 25-mL reactions using a One-Step SYBRR PrimeScript RT-PCR Kit 2 (TaKaRa) and a Thermal Cycler Dice Real-Time System (TaKaRa). Reactions contained 1 mL RNA (100 ng total), 12.5 mL 2 One-Step SYBRR RT-PCR buffer 4, 1 mL PrimeScript One-step Enzyme Mix 2, 400 nM each of forward and reverse primers, and 8.5 mL RNase-free dH2O. RNA was reverse transcribed for 5 min at 42°C, denatured at 95°C for 10 s, and amplified over 50 cycles of denaturation at 95°C for 5 s, and annealing/extension at 60°C for 30 s. Primers for COX-2 and GAPDH are listed in Table II. WESTERN BLOTTING Human dental pulp cells (1 106) were cultured to confluence in 10-cm tissue culture dishes with a-MEM and 10% FCS and then
KALLIKREIN ACTIVATES PAR-1 IN DENTAL PULP
1523
TABLE I. Primers for RT-PCR
Gene
Gene bank Acc
COX-2
NM_000963.3
GAPDH
NM_002046.5
incubated for 24 h in a-MEM and 1% FCS. Cells were lysed with CelLytic M (Sigma–Aldrich, Dorset, UK) supplemented with Complete Mini EDTA-free Protease Inhibitor Cocktail (Roche, Mannheim, Germany), 100 mM PMSF, 0.2 mM EGTA, and 2 mM EDTA. Protein concentrations were measured using the Bradford method [1976]. Samples were boiled for 5 min at 95°C in buffer containing sodium dodecyl sulfate, separated on 7.5% polyacrylamide gels, and transferred to nitrocellulose membranes at 12.5 V overnight. Membranes were blocked at room temperature for 50 min with skim milk (Wako Pure Chemical Industries, Osaka, Japan), probed for 120 min with mouse antibodies against COX-2 (1:1,000) and rabbit antibodies against b-actin (1:1000), washed three times with 4% skim milk containing 0.05% Tween 20, and labeled for 90 min with HRP-conjugated anti-mouse IgG (1:3,000) and HRPconjugated anti-rabbit IgG (1:2,000). Immunoreactivity was detected using an ECL Prime Western Blotting Detection System (GE, NJ) and quantified in Adobe Photoshop. PGE2 SECRETION Cells were plated at 5 104 cells/well in 24-well plates containing a-MEM and 10% FCS. When confluent, cells were incubated for 24 h in a-MEM containing 1% FCS and stimulated with KLKB1 for 30 min. Finally, PGE2 secreted into the culture medium was measured using an enzyme immunoassay kit according to the manufacturer0 s instructions. STATISTICAL ANALYSIS Results are reported as the means SEMs of the indicated number of experiments. Data were analyzed using Tukey tests. Differences with P values of less than 0.05 were considered significant.
RESULTS KLKB1-INDUCED MOBILIZATION OF CA2þ KLKB1 has been reported to mobilize Ca2þ in platelets and brain capillary endothelial cells. We found that in dental pulp cells, 1 mg/mL KLKB1 increased intracellular Ca2þ within 30 s, with levels gradually peaking at 90 s before decreasing to a steady level (Fig. 1A). The increase in intracellular Ca2þ was concentrationdependent (Fig. 1B).
Primer
Size (bp)
Forward 50 -ATGAGATTGTGGAAAAATTGCT-30 Reverse 50 -GATCATCTCTGCCTGAGTATC-30 Forward 50 -ATCACCATCTTCCAGGAG-30 Reverse 50 -ATGGACTGTGGTCATGAG-30
310 318
KLKB1 INDUCED THE EXPRESSION OF COX-2 mRNA RT-PCR analysis using primers specific for COX-2 generated a single band with the predicted size (310 bp), indicating that the enzyme was expressed in dental pulp cells (Fig. 2). The intensity of the band increased with exposure to KLKB1 in a concentration-dependent manner (Fig. 2A). In addition, COX-2 expression peaked 1 h after treatment with KLKB1 and decreased thereafter (Fig. 2B). Similarly, real-time RT-PCR indicated that stimulation with KLKB1 for 1 h significantly enhanced COX-2 expression in concentration-dependent manner (Fig. 2C). In addition, COX-2 expression peaked within 1 h in cells treated with 0.5 mg/mL KLKB1 (Fig. 2D). THE PAR-1 ANTAGONIST SCH79797 INHIBITED KLKB1-INDUCED MOBILIZATION OF CA2þ SCH79797 potently and selectively antagonizes thrombin-activated PAR-1 [Ahn et al., 2000]. In dental pulp cells treated with 2 or 20 mM SCH79797 for 10 min, 1 mM KLKB1 failed to induce an increase in intracellular Ca2þ (Fig. 3). However, the antagonist did not affect basal Ca2þ levels (data not shown). These observations strongly suggested that KLKB1-dependent release of Ca2þ was coupled to PAR-1 activation. KLKB1-DEPENDENT COX-2 mRNA EXPRESSION REQUIRED PAR-1 ACTIVATION Using RT-PCR and real-time RT-PCR, we measured KLKB1dependent COX-2 expression in cells treated with or without SCH79797 (Fig. 4). The PAR-1 antagonist (0.2 and 2 mM) reduced the ability of 0.5 mg/mL KLKB1 to stimulate COX-2 expression, indicating that activated PAR-1 was essential for this effect. The drug did not induce COX-2 expression on its own (data not shown). KLKB1 INDUCES COX-2 PROTEIN EXPRESSION VIA PAR-1 The abundance of COX-2 protein was markedly enhanced in cells treated with 1 mg/mL KLKB1 for 1 h (Fig. 5). However, the PAR-1 antagonist SCH79797 (2 mM) reversed this effect. These observations suggested that KLKB1-induced COX-2 protein expression in dental pulp cells was coupled to PAR-1 activation. KLKB1-INDUCED PGE2 RELEASE WAS COUPLED TO PAR-1 ACTIVATION Exposure of dental pulp cells to 1 mg/mL KLKB1 for 1 h clearly stimulated the release of PGE2, an eicosanoid involved in
TABLE II. Primers for Real-Time RT-PCR
Gene
Gene bank Acc
COX-2
NM_000963.3
GAPDH
NM_002046.5
1524
KALLIKREIN ACTIVATES PAR-1 IN DENTAL PULP
Primer 0
Size (bp) 0
Forward 5 CTGTAACCAAGATGGATGCAAAGA 3 Reverse 50 GTCAGTGACAATGAGATGTGGAA 30 Forward 50 GCACCGTCAAGGCTGAGAAC 30 Reverse 50 TGGTGAAGACGCCAGTGGA 30
195 138
JOURNAL OF CELLULAR BIOCHEMISTRY
Fig. 1. Kallikrein (KLKB1) increases intracellular Ca2þ in human dental pulp cells. (A) Ca2þ mobilization in human dental pulp cells loaded with Fura-2 and stimulated with 1 mg/mL KLKB1 at the time point marked with an arrow. This result is representative of three independent experiments. (B) Dose-dependent increase in intracellular Ca2þ. The baseline level in control cells (before stimulation) was subtracted from the KLKB1-induced peak Ca2þ value. Values are means SEMs from three independent experiments. P < 0.05; P < 0.01 versus control.
inflammation (Fig. 6). However, PGE2 release was markedly reduced in the presence of 2 mM of SCH79797, strongly suggesting that KLKB1 promoted inflammation via PAR-1 activation.
DISCUSSION Pulpitis causes intense pain, and root canal treatments may become necessary when the pulp tissue has necrotized. However, such treatments may nevertheless degrade the structure of teeth over the long term [Trabert et al., 1978]. Thus, keeping dental pulp healthy is the
most effective strategy to preventing tooth pain and loss of teeth. In turn, elucidating the mechanisms that drive pulpitis may help prevent the degradation of the tissue, although the role of inflammation continues to be debated. Indeed, while inflammation is believed by some to be detrimental to pulp tissue [Elsalhy et al., 2013], some degree of inflammation may also be required to form tertiary dentin [Okabe and Matsushima, 2006]. In this study, we investigated the relationships between pulpitis and the serine protease KLKB1 based on reports showing that proteases are involved in pathological and physiological processes in dental pulp. For example, the proteases collagenase and elastase degrade pulp
Fig. 2. KLKB1-dependent expression of COX-2 mRNA. (A) Cells were stimulated for 60 min with the indicated doses of KLKB1, and the expression of COX-2 and GAPDH was assessed by RT-PCR and agarose gel electrophoresis. (B) The expression of COX-2 and GAPDH was assessed by RT-PCR and agarose gel electrophoresis in dental pulp cells treated with 0.5 mg/mL KLKB1 for the indicated times. (C) Human dental pulp cells were stimulated for 60 min with increasing concentrations of KLKB1, and the expression of COX-2 was quantified by real-time RT-PCR, normalized to GAPDH, and reported relative to the expression level in untreated cells. Values are the means SEMs of three independent experiments. P < 0.01 versus untreated cells. (D) COX-2 expression, as measured by real-time RT-PCR, in cells treated with KLKB1 for various times. Expression was normalized to GAPDH and reported relative to the expression in unstimulated cells. Values are means SEMs of three independent experiments. P < 0.05; P < 0.01 versus the expression in unstimulated cells (0 min).
JOURNAL OF CELLULAR BIOCHEMISTRY
KALLIKREIN ACTIVATES PAR-1 IN DENTAL PULP
1525
Fig. 3. SCH79797 inhibits KLKB1-induced increases in intracellular Ca2þ. (A) Representative time course and (B) quantification of Ca2þ mobilization in dental pulp cells loaded with Fura-2, treated for 30 min with or without SCH79797 (2 and 20 mM), and stimulated with KLKB1. SCH79797 is an antagonist of protease-activated receptor-1 (PAR-1). Values in (B) are means SEMs from three independent experiments. P < 0.01 versus control.
tissue [Morand et al., 1998], while matrix metalloprotease-3 induces cell migration during wound healing [Muromachi et al., 2012]. KLKB1 is a multifunctional serine protease that, together with F12, F11, and high-molecular-weight kininogen, comprises the plasma contact-
Fig. 4. SCH79797 inhibits KLKB1-dependent COX-2 mRNA expression. Human dental pulp cells were pre-incubated for 30 min with or without SCH79797 (0.2 and 2 mM) and stimulated with KLKB1. COX-2 and GAPDH expression levels were assessed by (A) RT-PCR and agarose gel electrophoresis and (B) by real-time RT-PCR. In (B), COX-2 expression was normalized to GAPDH and reported relative to the expression in unstimulated cells. Values are means SEMs of three independent experiments. P < 0.01 versus unstimulated cells; †P < 0.05; ††P < 0.01 versus cells stimulated with KLKB1 in the absence of SCH79797.
1526
KALLIKREIN ACTIVATES PAR-1 IN DENTAL PULP
kinin system [Thomas, 2015]. This protease was identified as a urinary enzyme that reduces blood pressure in nondialytic patients with renal disorders [Frey, 1926]. The active form of the protein is called KLKB1, whereas the inactive precursor is called prekallikrein. Prekallikrein is expressed mainly in the liver and is secreted into the blood circulation in vivo [Mandle et al., 1976]. Prekallikrein is cleaved to produce KLKB1 by activated Factor XII (Hageman factor). Factor XII itself is activated to factor XIIa by negatively charged surfaces and is upregulated after injury to vascular endothelial cells [Cerf et al., 1999; Schmaier, 2008]. In dental pulp, there are many capillaries connected with nerves, which may convey signals to the brain. Therefore, these reactions may occur within the pulp, and activated KLKB1 may reach the pulp to activate Ca2þ and COX-2 signaling. In addition, KLKB1-related serine proteases [Linardoutsos et al., 2014] regulate such physiological processes as leukocyte and platelet activity [Cassaro et al., 1987], activation of plasminogen [Miles et al., 1983], and processing of proenkephalin, prorenin, and C3 [Hayashi et al., 2002]. In particular, KLKB1 cleaves high-molecular-weight kininogen to produce bradykinin, a potent vasodilator and pro-inflammatory peptide [Sainz et al., 2007]. In addition, KLKB1 is abundantly expressed in smooth muscle cells of the tunica media and in endothelial cells, foamy macrophages, inflammatory cells, and fibroblasts within the thickened intima in blood vessel plaques [Cerf et al., 1999]. In recent years, kallikrein proteases have been reported to trigger signaling cascades via PARs [Houle et al., 2005; Mize et al., 2008; Ramsay et al., 2008; Abdallah et al., 2010; Burda et al., 2013], a mechanism distinct from kinin-dependent pathways. To date, four PARs (PAR-1 to PAR-4) have been discovered and cloned [Coughlin, 2000]. PARs regulate cell proliferation, epidermal growth factor receptor (EGFR) signaling, and the expression of COX-2 and vascular endothelial growth factor (VEGF) [Hirota et al., 2012; Zhang et al., 2012]. In the dental pulp, fibroblast-like cells have been reported to express PAR-1, PAR-3 [Gruber et al., 2004], and PAR-2 [Tancharoen et al., 2005]. These PARs may trigger various signaling cascades to stimulate the expression of COX-2 and exacerbate pulpitis. In particular, we previously demonstrated that a PAR-1-activating peptide mobilized Ca2þ. However, activating peptides for PAR-2, PAR-3, and PAR-4 mobilized Ca2þ weakly, if at all [Kamio et al., 2008]. Notably, KLKB1 induces gene expression in primary aortic
JOURNAL OF CELLULAR BIOCHEMISTRY
Fig. 5. Inhibition of KLKB1-dependent COX-2 protein expression by SCH79797. Human dental pulp cells were exposed for 30 min to SCH79797 and then treated for 1 h with KLKB1. Cytoplasmic extracts were assayed for COX-2 and b-actin by western blotting.
vascular smooth muscle via PAR-1 [Abdallah et al., 2010], and kallikreins have been shown to directly activate PAR-1 in a similar manner as thrombin [Yoon et al., 2013], which cleaves PAR-1 between Arg-41 and Ser-42 in the exodomain [Vu et al., 1991]. Therefore, we also investigated whether PAR-1 is involved in KLKB1-dependent processes in pulp tissue. We previously, reported that pulp tissues predominantly express PAR1 [Kamio et al., 2008]. In the current study, we demonstrated that the PAR-1 antagonist SCH79797 blocked the ability of KLKB1 to strongly increase intracellular Ca2þ. Similarly, SCH79797 has been shown to block the concentration-dependent increase in intracellular Ca2þ due to the PAR-activating peptide SFLLRN [Kamio et al., 2008]. However, intracellular Ca2þ peaks at a different level when cells are exposed to KLKB1 or SFLLRN, presumably because PAR-1 is cleaved at different sites [Kamio et al., 2008]. Like SFLLRN [Kamio et al., 2014], KLKB1 also clearly induced the expression of COX-2 in a concentration-dependent manner and stimulated the release of PGE2. We found that SCH79797 also blocked these effects. Notably, SCH79797 alone did not increase the level of COX-2 mRNA and was therefore believed to be nontoxic.
These observations strongly suggest that PAR-1 is functionally active in human dental pulp fibroblast-like cells. However, it is unclear why PARs are differentially expressed in these tissues. This differential expression may be caused by the heterogeneity of dental pulp cultures, which, while fibroblast-rich, also probably contain other cell types, including odontoblast progenitors. However, it is difficult to predict whether these reactions are characteristic of human dental pulp cells because we have only examined human dental pulp cells in this study. It is possible that KLKB1 may induce inflammatory reactions in other cell types. Therefore, further studies are needed to determine whether this reaction is specific to pulpitis. Taken together, these data and the literature suggest that KLKB1 is involved in pulpitis via PAR-1 activation. The current results are reminiscent of studies of plasmin [Kamio et al., 2008], which induces COX-2 expression and PGE2 secretion via calcineurin. In addition, KLKB1 has been reported to activate PARs via plasmin [Oikonomopoulou et al., 2006]. Therefore, we cannot completely exclude the possible contribution of a KLKB1-plasmin-PAR1 axis. Nevertheless, our data suggested that PAR-1 activation was essential in both cases. The mechanisms mediating these effects are still unclear. Moreover, the pathway through which KLKB1 exerts its dual roles in kinin and COX-2 production are not known. Further studies are required to elucidate the mechanisms through which KLKB1 promotes pulpitis.
ACKNOWLEDGMENTS We would like to thank Editage (www.editage.jp) for English language editing. This study was supported by Grants-in Aid for Scientific Research (No. 24392079, 24592885) from the Japan Society for the Promotion of Science (JSPS).
REFERENCES Abdallah RT, Keum JS, El-Shewy HM, Lee MH, Wang B, Gooz M, Luttrell DK, Luttrell LM, Jaffa AA. 2010. Plasma kallikrein promotes epidermal growth factor receptor transactivation and signaling in vascular smooth muscle through direct activation of protease-activated receptors. J Biol Chem 285:35206–35215. Ahn HS, Foster C, Boykow G, Stamford A, Manna M, Graziano M. 2000. Inhibition of cellular action of thrombin by N3-cyclopropyl-7-[[4-(1-methylethyl) phenyl] methyl]-7H-pyrrolo[3, 2-f]quinazoline-1,3-diamine (SCH 79797), a nonpeptide thrombin receptor antagonist. Biochem Pharmacol 60:1425–1434. Bradford MM. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254. Burda JE, Radulovic M, Yoon H, Scarisbrick IA. 2013. Critical role for PAR1 in kallikrein 6-mediated oligodendrogliopathy. Glia 61:1456–1470. Cassaro CM, Sampaio MU, Maeda NY, Chamone DF, Sampaio CA. 1987. Human plasma kallikrein: Effect on the induced platelet aggregation. Thromb Res 48:81–87. Cerf M, Raidoo D, Fink E, Fritz H, Bhoola K. 1999. Plasma kallikrein localisation in human blood vessels. Immunopharmacology 44:75–80.
Fig. 6. KLKB1-induced prostaglandin E2 release in the absence or presence of SCH79797. Human dental pulp cells were treated with or without 2 mM SCH79797 for 30 min and stimulated with 1 mg/mL KLKB1 for 1 h. Prostaglandin E2 release into the medium was determined by enzyme-linked immunoassay. Results are representative of three independent experiments. P < 0.05 versus unstimulated cells; †P < 0.05 versus cells stimulated with KLKB1 in the absence of SCH79797.
JOURNAL OF CELLULAR BIOCHEMISTRY
Chang MC, Chen YJ, Tai TF, Tai MR, Li MY, Tsai YL, Lan WH, Wang YL, Jeng JH. 2006. Cytokine-induced prostaglandin E2 production and cyclooxygenase-2 expression in dental pulp cells: Downstream calcium signalling via activation of prostaglandin EP receptor. Int Endod J 39:819–826. Chan CP, Chang MC, Wang YJ, Chen LI, Tsai YL, Lee JJ, Jia HW, Jeng JH. 2008. Thrombin activates Ras-CREB/ATF-1 signaling and stimulates c-fos, c-jun, and c-myc expression in human gingival fibroblasts. J Periodontol 79:1248–1254.
KALLIKREIN ACTIVATES PAR-1 IN DENTAL PULP
1527
Chien PT, Hsieh HL, Chi PL, Yang CM. 2014. PAR1-dependent COX-2/PGE2 production contributes to cell proliferation via EP2 receptors in primary human cardiomyocytes. Br J Pharmacol 171:4504–4519.
Morand MA, Schilder H, Blondin J, Stone PJ, Franzblau C. 1981. Collagenolytic and elastinolytic activities from diseased human dental pulps. J Endod 24:156–160.
Coughlin SR. 2000. Thrombin signalling and protease-activated receptors. Nature 407:258–264.
Muromachi K, Kamio N, Narita T, Annen-Kamio M, Sugiya H, Matsushima K. 2012. MMP-3 provokes CTGF/CCN2 production independently of protease activity and dependently on dynamin-related endocytosis, which contributes to human dental pulp cell migration. J Cell Biochem 113:1348–1358.
Elsalhy M, Azizieh F, Raghupathy R. 2013. Cytokines as diagnostic markers of pulpal inflammation. Int Endod J 46:573–580. Francel PC. 1992. Bradykinin and neuronal injury. J Neurotrauma 9(Suppl1): S27–S45. Frey EK. 1926. Zusammenh€ange zwischen Herzarbeit und Nierent€atigkeit. Arch Klin Chir 142:663–669. Gruber R, Jindra C, Kandler B, Watzak G, Fischer MB, Watzek G. 2004. Proliferation of dental pulp fibroblasts in response to thrombin involves mitogen-activated protein kinase signalling. Int Endod J 37:145–150. Grynkiewicz G, Poenie M, Tsien RY. 1985. A new generation of Ca2þ indicators with greatly improved fluorescence properties. J Biol Chem 260:3440–3450. Kamio N, Hashizume H, Nakao S, Matsushima K, Sugiya H. 2008. Plasmin is involved in inflammation via protease-activated receptor-1 activation in human dental pulp. Biochem Pharmacol 75:1974–1980.
O0 Boskey FJ, Jr., Panagakos FS. 1998. Cytokines stimulate matrix metalloproteinase production by human pulp cells during long-term culture. J Endod 24:7–10. Oikonomopoulou K, Hansen KK, Saifeddine M, Tea I, Blaber M, Blaber SI, Scarisbrick I, Andrade-Gordon P, Cottrell GS, Bunnett NW, Diamandis EP, Hollenberg MD. 2006. Proteinase-activated receptors, targets for kallikrein signaling. J Biol Chem 281:32095–32112. Okabe T, Matsushima K. 2006. Regulation of ALP activity by TNF-alpha on human dental pulp. J Endod 32:516–520. Ramsay AJ, Dong Y, Hunt ML, Linn M, Samaratunga H, Clements JA, Hooper JD. 2008. Kallikrein-related peptidase 4 (KLK4) initiates intracellular signaling via protease-activated receptors (PARs). KLK4 and PAR-2 are co-expressed during prostate cancer progression. J Biol Chem 283:12293–12304.
Kamio N, Muromachi K, Hayama T, Okabe T, Kamio M, Morohashi T, Matsushima K. 2014. Plasmin-induced cyclooxygenase-2 expression via calcineurin activation in human dental pulp cells. Jpn J Conserv Dent 57:442–451.
Sundqvist G, Lerner UH. 1996. Bradykinin and thrombin synergistically potentiate interleukin 1 and tumour necrosis factor induced prostanoid biosynthesis in human dental pulp fibroblasts. Cytokine 8:168–177.
Kawabata A, Matsunami M, Sekiguchi F. 2008. Gastrointestinal roles for proteinase-activated receptors in health and disease. Br J Pharmacol 153: S230–S240.
Sainz IM, Pixley RA, Colman RW. 2007. Fifty years of research on the plasma kallikrein-kinin system: From protein structure and function to cell biology and in-vivo pathophysiology. Thromb Haemost 98:77–83.
Kitamura N, Kitagawa H, Fukushima D, Takagaki Y, Miyata T, Nakanishi S. 1985. Structural organization of the human kininogen gene and a model for its evolution. J Biol Chem 260:8610–8617.
Schmaier AH. 2008. Assembly, activation, and physiologic influence of the plasma kallikrein/kinin system. Int Immunopharmacol 8:161–165.
Hayashi J, Salomon DR, Hugli TE. 2002. Elevated kallikrein activity in plasma from stable liver transplant recipients. Int Immunopharmacol 2:1667–1680. Hirota CL, Moreau F, Iablokov V, Dicay M, Renaux B, Hollenberg MD, MacNaughton WK. 2012. Epidermal growth factor receptor transactivation is required for proteinase-activated receptor-2-induced COX-2 expression in intestinal epithelial cells. Am J Physiol Gastrointest Liver Physiol 303: G111–G119. Houle S, Papez MD, Ferazzini M, Hollenberg MD, Vergnolle N. 2005. Neutrophils and the kallikrein-kinin system in proteinase-activated receptor 4-mediated inflammation in rodents. Br J Pharmacol 146:670–678. Jaffre F, Friedman AE, Hu Z, Mackman N, Blaxall BC. 2012. B-adrenergic receptor stimulation transactivates protease-activated receptor 1 via matrix metalloproteinase 13 in cardiac cells. Circulation 125:2993–3003. Linardoutsos D, Gazouli M, Machairas A, Bramis I, Zografos GC. 2014. Kallikrein-related peptidases in cancers of gastrointestinal tract: An inside view of their role and clinical significance. J BUON 19:53–59. Lundy FT, About I, Curtis TM, McGahon MK, Linden GJ, Irwin CR, El Karim IA. 2010. PAR-2 regulates dental pulp inflammation associated with caries. J Dent Res 89:684–688. Mandle RJ, Colman RW, Kaplan AP. 1976. Identification of prekallikrein and high-molecular-weight kininogen as a complex in human plasma. Proc Natl Acad Sci USA 73:4179–4183. Metters KM, Rossier J, Paquin J, Chretien M, Seidah NG. 1988. Selective cleavage of proenkephalin-derived peptides (less than 23,300 daltons) by plasma kallikrein. J Biol Chem 263:12543–12553. Miles LA, Greengard JS, Griffin JH. 1983. A comparison of the abilities of plasma kallikrein, beta-Factor XIIa, Factor XIa, and urokinase to activate plasminogen. Thromb Res 29:407–417. Mize GJ, Wang W, Takayama TK. 2008. Prostate-specific kallikreins-2 and -4 enhance the proliferation of DU-145 prostate cancer cells through proteaseactivated receptors-1 and -2. Mol Cancer Res 6:1043–1051.
1528
KALLIKREIN ACTIVATES PAR-1 IN DENTAL PULP
Selzer S, Bender IB. 1984. The dental pulp: Biologic considerations in dental procedures. Philadelphia: JB Lippincott Company. Seymour ML, Zaidi NF, Hollenberg MD, MacNaughton WK. 2003. PAR1dependent and independent increases in COX-2 and PGE2 in human colonic myofibroblasts stimulated by thrombin. Am J Physiol Cell Physiol 284: C1185–C1192. Tanaka N, Morita T, Nezu A, Tanimura A, Mizoguchi I, Tojyo Y. 2004. Signaling mechanisms involved in protease activated receptor-1-mediated interleukin-6 production by human gingival fibroblasts. J Pharmacol Exp Ther 311:778–786. Tancharoen S, Sarker KP, Imamura T, Biswas KK, Matsushita K, Tatsuyama S, Travis J, Potempa J, Torii M, Maruyama I. 2005. Neuropeptide release from dental pulp cells by RgpB via proteinase-activated receptor-2 signaling. J Immunol 174:5796–5804. Thomas R. 2015. The vascular side of plasma kallikrein. Blood 125:589–590. Trabert KC, Caput AA, Abou-Rass M. 1978. Tooth fracture—A comparison of endodontic and restorative treatments. J Endod 4:341–345. Trejo J. 2003. Protease-activated receptors: New concepts in regulation of G proteincoupled receptor signaling and trafficking. J Pharmacol Exp Ther 307:437–442. Trivedi V, Boire A, Tchernychev B, Kaneider NC, Leger AJ, O0 Callaghan K, Covic L, Kuliopulos A. 2009. Platelet matrix metalloprotease-1 mediates thrombogenesis by activating PAR1 at a cryptic ligand site. Cell 137:332–343. Vu TK, Hung DT, Wheaton VI, Coughlin SR. 1991. Molecular cloning of a functional thrombin receptor reveals a novel proteolytic mechanism of receptor activation. Cell 64:1057–1068. Yoon H, Radulovic M, Wu J, Blaber SI, Blaber M, Fehlings MG, Scarisbrick IA. 2013. Kallikrein 6 signals through PAR1 and PAR2 to promote neuron injury and exacerbate glutamate neurotoxicity. J Neurochem 127:283–298. Zhang C, Gao GR, Lv CG, Zhang BL, Zhang ZL, Zhang XF. 2012. Proteaseactivated receptor-2 induces expression of vascular endothelial growth factor and cyclooxygenase-2 via the mitogen-activated protein kinase pathway in gastric cancer cells. Oncol Rep 28:1917–1923.
JOURNAL OF CELLULAR BIOCHEMISTRY
Journal of Cellular Biochemistry 117:1522–1528 (2016)
Kallikrein Promotes Inflammation in Human Dental Pulp Cells Via Protease-Activated Receptor-1 Tomomi Hayama,1* Naoto Kamio,1 Tatsu Okabe,1 Koichiro Muromachi,2 and Kiyoshi Matsushima1,3 1
Department of Endodontics, Nihon University School of Dentistry at Matsudo, Matsudo, Chiba 271-8587, Japan Department of Pulp Biology and Endodontics, Graduate School of Dentistry, Kanagawa Dental University, Yokosuka, Kanagawa 238-8580, Japan 3 Research Institute of Oral Science, Nihon University School of Dentistry at Matsudo, Matsudo, Chiba 271-8587, Japan 2
ABSTRACT Plasma kallikrein (KLKB1), a serine protease, cleaves high-molecular weight kininogen to produce bradykinin, a potent vasodilator and pro-inflammatory peptide. In addition, KLKB1 activates plasminogen and other leukocyte and blood coagulation factors and processes proenkephalin, prorenin, and C3. KLKB1 has also been shown to cleave protease-activated receptors in vascular smooth muscle cells to regulate the expression of epidermal growth factor receptor. In this study, we investigated KLKB1-dependent inflammation and activation of proteaseactivated receptor-1 in human dental pulp cells. These cells responded to KLKB1 stimulation by increasing intracellular Ca2þ, upregulating cyclooxygenase-2, and secreting prostaglandin E2. Remarkably, SCH79797, an antagonist of protease-activated receptor-1, blocked these effects. Thus, these data indicate that KLKB1 induces inflammatory reactions in human dental tissues via protease-activated receptor 1. J. Cell. Biochem. 117: 1522–1528, 2016. © 2015 Wiley Periodicals, Inc.
KEY WORDS:
T
KALLIKREIN; PROTEASE-ACTIVATED RECEPTOR; INFLAMMATION; DENTAL PULP; PULPITIS
he life of a tooth is determined primarily by the health of the dental pulp, a tissue of mesenchymal origin that consists of an odontoblast layer and an immunocompetent connective tissue with nerves and vascular elements. Irritation of the dental pulp by mechanical, thermal, chemical, or bacterial stimuli triggers inflammation [Selzer and Bender, 1984] and production of proinflammatory cytokines, such as interleukin-1b (IL-1b), prostaglandin, cyclooxygenase (COX), and tumor necrosis factor [Sundqvist and Lerner, 1996; Chang et al., 2006]. After such irritation, the tissue becomes necrotic because it does not possess the capacity to heal. Notably, pulpitis is associated with tissue degradation. Indeed, elastinolytic and collagenolytic activities are enhanced in patients with suppurative pulpitis and necrosis [Morand et al., 1981]. In addition, pro-inflammatory cytokines have been shown to induce the expression of matrix metalloproteinases [O0 Boskey and Panagakos, 1998]. These observations indicate that inflammatory reactions in dental pulp resemble those in other tissues. Thus, a better understanding of such reactions will accelerate the development of preventive or therapeutic treatments.
Plasma kallikrein (KLKB1), a serine protease, regulates the maturation of various precursor proteins [Metters et al., 1988]. For example, KLKB1 activates plasminogen [Oikonomopoulou et al., 2006] and prorenin [Sainz et al., 2007; Schmaier, 2008]. In addition, this protease generates bradykinin during coagulation by cleaving high-molecularweight kininogen [Kitamura et al., 1985]. Kinin induces blood vessel hyperpermeability, leukocyte migration, smooth muscle contraction, vasodilatation, edema, and sodium excretion from the renal tubule. Furthermore, kinin mediates pain, acute inflammation, and hypertension [Francel, 1992]. Therefore, understanding the kallikrein-kinin system may provide a basis for controlling inflammation. Protease-activated receptor (PAR)-1 to PAR-4 are G proteincoupled receptors with seven transmembrane domains [Coughlin, 2000; Trejo, 2003]. PARs are widely distributed, especially throughout the alimentary system, and regulate various physiological processes, including exocrine secretion from the salivary, gastric, or pancreatic gland, motility of gastrointestinal smooth muscles, cytoprotection of gastric mucosa, and suppression of visceral pain [Kawabata et al., 2008]. PARs are activated by cleavage of the extracellular N-terminal
Grant sponsor: Japan Society for the Promotion of Science; Grant numbers: 24392079, 24592885. *Correspondence to: Tomomi Hayama, Department of Endodontics, Nihon University School of Dentistry at Matsudo, Matsudo, Chiba 271-8587, Japan. E-mail: [email protected] Manuscript Received: 2 October 2015; Manuscript Accepted: 10 November 2015 Accepted manuscript online in Wiley Online Library (wileyonlinelibrary.com): 13 November 2015 DOI 10.1002/jcb.25437 © 2015 Wiley Periodicals, Inc.
1522
domain, an event that enables the new N-terminus to allosterically activate signal transduction pathways [Coughlin, 2000; Trejo, 2003]. Remarkably, cleavage at specific activation sites determines the functional properties of the resulting activated receptor. Indeed, proteases that activate PARs have been identified through the pathways affected by different cleavage sites [Trivedi et al., 2009; Jaffre et al., 2012]. In addition, PAR activation triggers inflammatory responses. For example, PAR-1 also stimulates the expression of COX-2 and prostaglandin E2 (PGE2) in myofibroblasts and cardiomyocytes [Seymour et al., 2003; Chien et al., 2014]. Dental pulp fibroblasts express PAR-1, PAR-3, and PAR-4 [Gruber et al., 2004]. Moreover, PAR-2 has been shown to regulate dental pulp inflammation due to caries [Lundy et al., 2010] and to mediate neuropeptide release resulting from cleavage by argininespecific cysteine protease [Tancharoen et al., 2005]. Gingival fibroblasts also express PAR-1 and PAR-3 [Chan et al., 2008], and secrete IL-6 in response to PAR-1 [Tanaka et al., 2004]. In addition, we demonstrated that plasmin activates PAR-1 to stimulate the expression of IL-8 and release of PGE2 [Kamio et al., 2008]. These observations imply that PARs may be involved in pulpitis through mechanisms that have yet to be completely elucidated. In the present study, we demonstrate that KLKB1 activates PAR-1 to trigger inflammatory reactions in human dental pulp cells.
MATERIALS AND METHODS MATERIALS Fungizone, trypsin, and a-essential medium (a-MEM) supplemented with fetal calf serum (FCS) were purchased from GIBCO BRL Life Technologies (Tokyo, Japan). Penicillin G and kanamycin were purchased from Meiji Seika (Tokyo, Japan), and Fura-2/AM was obtained from Dojindo Labs (Tokyo, Japan). Recombinant human plasma KLKB1 was purchased from R&D Systems (MN). N3Cyclopropyl-7-{[4-(1-methylethyl) phenyl] methyl}-7H-pyrrolo [3,2-f]qinazoline-1,3-diamine (SCH79797) was purchased from Tocris Bioscience (Ellisville, MI). The PGE2 enzyme immunoassay kit was obtained from Oxford Biomedical Research (MI). Mouse antibodies against human COX-2 were purchased from Santa Cruz Biotechnology (CA). Rabbit antibodies against human b-actin and horseradish peroxidase (HRP)-conjugated anti-rabbit IgG were purchased from Cell Signaling Technology (Danvers, MA). HRPconjugated anti-mouse IgG was obtained from HIS Globalspec (NY). CELL CULTURE Human dental pulp (fibroblast-like) cells were harvested from third molars extracted under aseptic conditions from 20-year-old patients undergoing orthodontic treatments. Tissues were then minced on sterilized glass coverslips and cultured to confluence in a-MEM supplemented with 10% FCS, 20 U/mL penicillin G, 100 mg/mL kanamycin, and 250 ng/mL fungizone. Subsequently, cells were detached with 0.05% trypsin in phosphate-buffered saline, subcultured in culture flasks, and plated at 2 105 cells/mL after 6–9 passages. Informed consent was obtained from all patients, and this study was approved by the ethics committee of Nihon University School of Dentistry at Matsudo (No. EC12-010).
JOURNAL OF CELLULAR BIOCHEMISTRY
MEASUREMENT OF INTRACELLULAR CA2þ Human dental pulp cells (1 105) were cultured in thin, circular, 13.5-mm glass plates containing a-MEM with 10% FCS. Confluent cells were labeled for 30 min at 37°C with 2 mM Fura-2/AM in a-MEM, washed twice, and harvested into quartz cuvettes containing Krebs-Ringer-HEPES solution (120 mM NaCl, 5 mM KCl, 1 mM MgSO4, 0.96 mM NaH2PO4, 0.2% glucose, 0.1% bovine serum albumin, 1 mM CaCl2, and 20 mM HEPES, pH 7.4). Fluorescence at 500 nm was measured with a CAF-110 spectrofluorometer (Nion Bunkou, Japan), with excitation at 340 and 380 nm. Intracellular Ca2þ was calculated from the ratio of fluorescence intensities [Grynkiewicz et al., 1985]. REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION (RT-PCR) Human dental pulp cells (1 106) were cultured to confluence in 10-cm tissue culture dishes containing a-MEM with 10% FCS. Cultures were then incubated for 24 h in a-MEM containing 1% FCS. To measure the effects of KLKB1 on COX-2 expression, cells were incubated for another 1 h with or without KLKB1 in a-MEM supplemented with 1% FCS. Total RNA was then extracted using an RNeasy Mini Kit (Qiagen, Hilden, Germany), following the manufacturer0 s protocol. Subsequently, cDNA was synthesized and amplified by RT-PCR using a One Step RT-PCR Kit (Qiagen) and a PCR Thermal Cycler Dice instrument (TaKaRa, Shiga, Japan). Briefly, RNA (100 ng) was amplified with 500 nM oligonucleotide primers for COX-2 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Reactions were carried out with predenaturation for 30 min at 95°C and amplification with 22 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s, elongation at 72°C for 30 s, and final extension for 10 min at 72°C. Finally, amplification products were electrophoresed on 2.0% agarose gels and visualized with ethidium bromide. Primer sequences are listed in Table I. REAL-TIME RT-PCR Human dental pulp cells were cultured to confluence in 10-cm tissue culture dishes containing a-MEM supplemented with 10% FCS. Cells were then incubated for 24 h in a-MEM containing 1% FCS, stimulated with KLKB1, and washed twice with PBS. Total RNA was extracted using an RNeasy Mini Kit (Qiagen), following the manufacturer0 s protocol. RNA concentrations were measured by absorbance at 260 and 280 nm. Real-time PCR was performed in 25-mL reactions using a One-Step SYBRR PrimeScript RT-PCR Kit 2 (TaKaRa) and a Thermal Cycler Dice Real-Time System (TaKaRa). Reactions contained 1 mL RNA (100 ng total), 12.5 mL 2 One-Step SYBRR RT-PCR buffer 4, 1 mL PrimeScript One-step Enzyme Mix 2, 400 nM each of forward and reverse primers, and 8.5 mL RNase-free dH2O. RNA was reverse transcribed for 5 min at 42°C, denatured at 95°C for 10 s, and amplified over 50 cycles of denaturation at 95°C for 5 s, and annealing/extension at 60°C for 30 s. Primers for COX-2 and GAPDH are listed in Table II. WESTERN BLOTTING Human dental pulp cells (1 106) were cultured to confluence in 10-cm tissue culture dishes with a-MEM and 10% FCS and then
KALLIKREIN ACTIVATES PAR-1 IN DENTAL PULP
1523
TABLE I. Primers for RT-PCR
Gene
Gene bank Acc
COX-2
NM_000963.3
GAPDH
NM_002046.5
incubated for 24 h in a-MEM and 1% FCS. Cells were lysed with CelLytic M (Sigma–Aldrich, Dorset, UK) supplemented with Complete Mini EDTA-free Protease Inhibitor Cocktail (Roche, Mannheim, Germany), 100 mM PMSF, 0.2 mM EGTA, and 2 mM EDTA. Protein concentrations were measured using the Bradford method [1976]. Samples were boiled for 5 min at 95°C in buffer containing sodium dodecyl sulfate, separated on 7.5% polyacrylamide gels, and transferred to nitrocellulose membranes at 12.5 V overnight. Membranes were blocked at room temperature for 50 min with skim milk (Wako Pure Chemical Industries, Osaka, Japan), probed for 120 min with mouse antibodies against COX-2 (1:1,000) and rabbit antibodies against b-actin (1:1000), washed three times with 4% skim milk containing 0.05% Tween 20, and labeled for 90 min with HRP-conjugated anti-mouse IgG (1:3,000) and HRPconjugated anti-rabbit IgG (1:2,000). Immunoreactivity was detected using an ECL Prime Western Blotting Detection System (GE, NJ) and quantified in Adobe Photoshop. PGE2 SECRETION Cells were plated at 5 104 cells/well in 24-well plates containing a-MEM and 10% FCS. When confluent, cells were incubated for 24 h in a-MEM containing 1% FCS and stimulated with KLKB1 for 30 min. Finally, PGE2 secreted into the culture medium was measured using an enzyme immunoassay kit according to the manufacturer0 s instructions. STATISTICAL ANALYSIS Results are reported as the means SEMs of the indicated number of experiments. Data were analyzed using Tukey tests. Differences with P values of less than 0.05 were considered significant.
RESULTS KLKB1-INDUCED MOBILIZATION OF CA2þ KLKB1 has been reported to mobilize Ca2þ in platelets and brain capillary endothelial cells. We found that in dental pulp cells, 1 mg/mL KLKB1 increased intracellular Ca2þ within 30 s, with levels gradually peaking at 90 s before decreasing to a steady level (Fig. 1A). The increase in intracellular Ca2þ was concentrationdependent (Fig. 1B).
Primer
Size (bp)
Forward 50 -ATGAGATTGTGGAAAAATTGCT-30 Reverse 50 -GATCATCTCTGCCTGAGTATC-30 Forward 50 -ATCACCATCTTCCAGGAG-30 Reverse 50 -ATGGACTGTGGTCATGAG-30
310 318
KLKB1 INDUCED THE EXPRESSION OF COX-2 mRNA RT-PCR analysis using primers specific for COX-2 generated a single band with the predicted size (310 bp), indicating that the enzyme was expressed in dental pulp cells (Fig. 2). The intensity of the band increased with exposure to KLKB1 in a concentration-dependent manner (Fig. 2A). In addition, COX-2 expression peaked 1 h after treatment with KLKB1 and decreased thereafter (Fig. 2B). Similarly, real-time RT-PCR indicated that stimulation with KLKB1 for 1 h significantly enhanced COX-2 expression in concentration-dependent manner (Fig. 2C). In addition, COX-2 expression peaked within 1 h in cells treated with 0.5 mg/mL KLKB1 (Fig. 2D). THE PAR-1 ANTAGONIST SCH79797 INHIBITED KLKB1-INDUCED MOBILIZATION OF CA2þ SCH79797 potently and selectively antagonizes thrombin-activated PAR-1 [Ahn et al., 2000]. In dental pulp cells treated with 2 or 20 mM SCH79797 for 10 min, 1 mM KLKB1 failed to induce an increase in intracellular Ca2þ (Fig. 3). However, the antagonist did not affect basal Ca2þ levels (data not shown). These observations strongly suggested that KLKB1-dependent release of Ca2þ was coupled to PAR-1 activation. KLKB1-DEPENDENT COX-2 mRNA EXPRESSION REQUIRED PAR-1 ACTIVATION Using RT-PCR and real-time RT-PCR, we measured KLKB1dependent COX-2 expression in cells treated with or without SCH79797 (Fig. 4). The PAR-1 antagonist (0.2 and 2 mM) reduced the ability of 0.5 mg/mL KLKB1 to stimulate COX-2 expression, indicating that activated PAR-1 was essential for this effect. The drug did not induce COX-2 expression on its own (data not shown). KLKB1 INDUCES COX-2 PROTEIN EXPRESSION VIA PAR-1 The abundance of COX-2 protein was markedly enhanced in cells treated with 1 mg/mL KLKB1 for 1 h (Fig. 5). However, the PAR-1 antagonist SCH79797 (2 mM) reversed this effect. These observations suggested that KLKB1-induced COX-2 protein expression in dental pulp cells was coupled to PAR-1 activation. KLKB1-INDUCED PGE2 RELEASE WAS COUPLED TO PAR-1 ACTIVATION Exposure of dental pulp cells to 1 mg/mL KLKB1 for 1 h clearly stimulated the release of PGE2, an eicosanoid involved in
TABLE II. Primers for Real-Time RT-PCR
Gene
Gene bank Acc
COX-2
NM_000963.3
GAPDH
NM_002046.5
1524
KALLIKREIN ACTIVATES PAR-1 IN DENTAL PULP
Primer 0
Size (bp) 0
Forward 5 CTGTAACCAAGATGGATGCAAAGA 3 Reverse 50 GTCAGTGACAATGAGATGTGGAA 30 Forward 50 GCACCGTCAAGGCTGAGAAC 30 Reverse 50 TGGTGAAGACGCCAGTGGA 30
195 138
JOURNAL OF CELLULAR BIOCHEMISTRY
Fig. 1. Kallikrein (KLKB1) increases intracellular Ca2þ in human dental pulp cells. (A) Ca2þ mobilization in human dental pulp cells loaded with Fura-2 and stimulated with 1 mg/mL KLKB1 at the time point marked with an arrow. This result is representative of three independent experiments. (B) Dose-dependent increase in intracellular Ca2þ. The baseline level in control cells (before stimulation) was subtracted from the KLKB1-induced peak Ca2þ value. Values are means SEMs from three independent experiments. P < 0.05; P < 0.01 versus control.
inflammation (Fig. 6). However, PGE2 release was markedly reduced in the presence of 2 mM of SCH79797, strongly suggesting that KLKB1 promoted inflammation via PAR-1 activation.
DISCUSSION Pulpitis causes intense pain, and root canal treatments may become necessary when the pulp tissue has necrotized. However, such treatments may nevertheless degrade the structure of teeth over the long term [Trabert et al., 1978]. Thus, keeping dental pulp healthy is the
most effective strategy to preventing tooth pain and loss of teeth. In turn, elucidating the mechanisms that drive pulpitis may help prevent the degradation of the tissue, although the role of inflammation continues to be debated. Indeed, while inflammation is believed by some to be detrimental to pulp tissue [Elsalhy et al., 2013], some degree of inflammation may also be required to form tertiary dentin [Okabe and Matsushima, 2006]. In this study, we investigated the relationships between pulpitis and the serine protease KLKB1 based on reports showing that proteases are involved in pathological and physiological processes in dental pulp. For example, the proteases collagenase and elastase degrade pulp
Fig. 2. KLKB1-dependent expression of COX-2 mRNA. (A) Cells were stimulated for 60 min with the indicated doses of KLKB1, and the expression of COX-2 and GAPDH was assessed by RT-PCR and agarose gel electrophoresis. (B) The expression of COX-2 and GAPDH was assessed by RT-PCR and agarose gel electrophoresis in dental pulp cells treated with 0.5 mg/mL KLKB1 for the indicated times. (C) Human dental pulp cells were stimulated for 60 min with increasing concentrations of KLKB1, and the expression of COX-2 was quantified by real-time RT-PCR, normalized to GAPDH, and reported relative to the expression level in untreated cells. Values are the means SEMs of three independent experiments. P < 0.01 versus untreated cells. (D) COX-2 expression, as measured by real-time RT-PCR, in cells treated with KLKB1 for various times. Expression was normalized to GAPDH and reported relative to the expression in unstimulated cells. Values are means SEMs of three independent experiments. P < 0.05; P < 0.01 versus the expression in unstimulated cells (0 min).
JOURNAL OF CELLULAR BIOCHEMISTRY
KALLIKREIN ACTIVATES PAR-1 IN DENTAL PULP
1525
Fig. 3. SCH79797 inhibits KLKB1-induced increases in intracellular Ca2þ. (A) Representative time course and (B) quantification of Ca2þ mobilization in dental pulp cells loaded with Fura-2, treated for 30 min with or without SCH79797 (2 and 20 mM), and stimulated with KLKB1. SCH79797 is an antagonist of protease-activated receptor-1 (PAR-1). Values in (B) are means SEMs from three independent experiments. P < 0.01 versus control.
tissue [Morand et al., 1998], while matrix metalloprotease-3 induces cell migration during wound healing [Muromachi et al., 2012]. KLKB1 is a multifunctional serine protease that, together with F12, F11, and high-molecular-weight kininogen, comprises the plasma contact-
Fig. 4. SCH79797 inhibits KLKB1-dependent COX-2 mRNA expression. Human dental pulp cells were pre-incubated for 30 min with or without SCH79797 (0.2 and 2 mM) and stimulated with KLKB1. COX-2 and GAPDH expression levels were assessed by (A) RT-PCR and agarose gel electrophoresis and (B) by real-time RT-PCR. In (B), COX-2 expression was normalized to GAPDH and reported relative to the expression in unstimulated cells. Values are means SEMs of three independent experiments. P < 0.01 versus unstimulated cells; †P < 0.05; ††P < 0.01 versus cells stimulated with KLKB1 in the absence of SCH79797.
1526
KALLIKREIN ACTIVATES PAR-1 IN DENTAL PULP
kinin system [Thomas, 2015]. This protease was identified as a urinary enzyme that reduces blood pressure in nondialytic patients with renal disorders [Frey, 1926]. The active form of the protein is called KLKB1, whereas the inactive precursor is called prekallikrein. Prekallikrein is expressed mainly in the liver and is secreted into the blood circulation in vivo [Mandle et al., 1976]. Prekallikrein is cleaved to produce KLKB1 by activated Factor XII (Hageman factor). Factor XII itself is activated to factor XIIa by negatively charged surfaces and is upregulated after injury to vascular endothelial cells [Cerf et al., 1999; Schmaier, 2008]. In dental pulp, there are many capillaries connected with nerves, which may convey signals to the brain. Therefore, these reactions may occur within the pulp, and activated KLKB1 may reach the pulp to activate Ca2þ and COX-2 signaling. In addition, KLKB1-related serine proteases [Linardoutsos et al., 2014] regulate such physiological processes as leukocyte and platelet activity [Cassaro et al., 1987], activation of plasminogen [Miles et al., 1983], and processing of proenkephalin, prorenin, and C3 [Hayashi et al., 2002]. In particular, KLKB1 cleaves high-molecular-weight kininogen to produce bradykinin, a potent vasodilator and pro-inflammatory peptide [Sainz et al., 2007]. In addition, KLKB1 is abundantly expressed in smooth muscle cells of the tunica media and in endothelial cells, foamy macrophages, inflammatory cells, and fibroblasts within the thickened intima in blood vessel plaques [Cerf et al., 1999]. In recent years, kallikrein proteases have been reported to trigger signaling cascades via PARs [Houle et al., 2005; Mize et al., 2008; Ramsay et al., 2008; Abdallah et al., 2010; Burda et al., 2013], a mechanism distinct from kinin-dependent pathways. To date, four PARs (PAR-1 to PAR-4) have been discovered and cloned [Coughlin, 2000]. PARs regulate cell proliferation, epidermal growth factor receptor (EGFR) signaling, and the expression of COX-2 and vascular endothelial growth factor (VEGF) [Hirota et al., 2012; Zhang et al., 2012]. In the dental pulp, fibroblast-like cells have been reported to express PAR-1, PAR-3 [Gruber et al., 2004], and PAR-2 [Tancharoen et al., 2005]. These PARs may trigger various signaling cascades to stimulate the expression of COX-2 and exacerbate pulpitis. In particular, we previously demonstrated that a PAR-1-activating peptide mobilized Ca2þ. However, activating peptides for PAR-2, PAR-3, and PAR-4 mobilized Ca2þ weakly, if at all [Kamio et al., 2008]. Notably, KLKB1 induces gene expression in primary aortic
JOURNAL OF CELLULAR BIOCHEMISTRY
Fig. 5. Inhibition of KLKB1-dependent COX-2 protein expression by SCH79797. Human dental pulp cells were exposed for 30 min to SCH79797 and then treated for 1 h with KLKB1. Cytoplasmic extracts were assayed for COX-2 and b-actin by western blotting.
vascular smooth muscle via PAR-1 [Abdallah et al., 2010], and kallikreins have been shown to directly activate PAR-1 in a similar manner as thrombin [Yoon et al., 2013], which cleaves PAR-1 between Arg-41 and Ser-42 in the exodomain [Vu et al., 1991]. Therefore, we also investigated whether PAR-1 is involved in KLKB1-dependent processes in pulp tissue. We previously, reported that pulp tissues predominantly express PAR1 [Kamio et al., 2008]. In the current study, we demonstrated that the PAR-1 antagonist SCH79797 blocked the ability of KLKB1 to strongly increase intracellular Ca2þ. Similarly, SCH79797 has been shown to block the concentration-dependent increase in intracellular Ca2þ due to the PAR-activating peptide SFLLRN [Kamio et al., 2008]. However, intracellular Ca2þ peaks at a different level when cells are exposed to KLKB1 or SFLLRN, presumably because PAR-1 is cleaved at different sites [Kamio et al., 2008]. Like SFLLRN [Kamio et al., 2014], KLKB1 also clearly induced the expression of COX-2 in a concentration-dependent manner and stimulated the release of PGE2. We found that SCH79797 also blocked these effects. Notably, SCH79797 alone did not increase the level of COX-2 mRNA and was therefore believed to be nontoxic.
These observations strongly suggest that PAR-1 is functionally active in human dental pulp fibroblast-like cells. However, it is unclear why PARs are differentially expressed in these tissues. This differential expression may be caused by the heterogeneity of dental pulp cultures, which, while fibroblast-rich, also probably contain other cell types, including odontoblast progenitors. However, it is difficult to predict whether these reactions are characteristic of human dental pulp cells because we have only examined human dental pulp cells in this study. It is possible that KLKB1 may induce inflammatory reactions in other cell types. Therefore, further studies are needed to determine whether this reaction is specific to pulpitis. Taken together, these data and the literature suggest that KLKB1 is involved in pulpitis via PAR-1 activation. The current results are reminiscent of studies of plasmin [Kamio et al., 2008], which induces COX-2 expression and PGE2 secretion via calcineurin. In addition, KLKB1 has been reported to activate PARs via plasmin [Oikonomopoulou et al., 2006]. Therefore, we cannot completely exclude the possible contribution of a KLKB1-plasmin-PAR1 axis. Nevertheless, our data suggested that PAR-1 activation was essential in both cases. The mechanisms mediating these effects are still unclear. Moreover, the pathway through which KLKB1 exerts its dual roles in kinin and COX-2 production are not known. Further studies are required to elucidate the mechanisms through which KLKB1 promotes pulpitis.
ACKNOWLEDGMENTS We would like to thank Editage (www.editage.jp) for English language editing. This study was supported by Grants-in Aid for Scientific Research (No. 24392079, 24592885) from the Japan Society for the Promotion of Science (JSPS).
REFERENCES Abdallah RT, Keum JS, El-Shewy HM, Lee MH, Wang B, Gooz M, Luttrell DK, Luttrell LM, Jaffa AA. 2010. Plasma kallikrein promotes epidermal growth factor receptor transactivation and signaling in vascular smooth muscle through direct activation of protease-activated receptors. J Biol Chem 285:35206–35215. Ahn HS, Foster C, Boykow G, Stamford A, Manna M, Graziano M. 2000. Inhibition of cellular action of thrombin by N3-cyclopropyl-7-[[4-(1-methylethyl) phenyl] methyl]-7H-pyrrolo[3, 2-f]quinazoline-1,3-diamine (SCH 79797), a nonpeptide thrombin receptor antagonist. Biochem Pharmacol 60:1425–1434. Bradford MM. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254. Burda JE, Radulovic M, Yoon H, Scarisbrick IA. 2013. Critical role for PAR1 in kallikrein 6-mediated oligodendrogliopathy. Glia 61:1456–1470. Cassaro CM, Sampaio MU, Maeda NY, Chamone DF, Sampaio CA. 1987. Human plasma kallikrein: Effect on the induced platelet aggregation. Thromb Res 48:81–87. Cerf M, Raidoo D, Fink E, Fritz H, Bhoola K. 1999. Plasma kallikrein localisation in human blood vessels. Immunopharmacology 44:75–80.
Fig. 6. KLKB1-induced prostaglandin E2 release in the absence or presence of SCH79797. Human dental pulp cells were treated with or without 2 mM SCH79797 for 30 min and stimulated with 1 mg/mL KLKB1 for 1 h. Prostaglandin E2 release into the medium was determined by enzyme-linked immunoassay. Results are representative of three independent experiments. P < 0.05 versus unstimulated cells; †P < 0.05 versus cells stimulated with KLKB1 in the absence of SCH79797.
JOURNAL OF CELLULAR BIOCHEMISTRY
Chang MC, Chen YJ, Tai TF, Tai MR, Li MY, Tsai YL, Lan WH, Wang YL, Jeng JH. 2006. Cytokine-induced prostaglandin E2 production and cyclooxygenase-2 expression in dental pulp cells: Downstream calcium signalling via activation of prostaglandin EP receptor. Int Endod J 39:819–826. Chan CP, Chang MC, Wang YJ, Chen LI, Tsai YL, Lee JJ, Jia HW, Jeng JH. 2008. Thrombin activates Ras-CREB/ATF-1 signaling and stimulates c-fos, c-jun, and c-myc expression in human gingival fibroblasts. J Periodontol 79:1248–1254.
KALLIKREIN ACTIVATES PAR-1 IN DENTAL PULP
1527
Chien PT, Hsieh HL, Chi PL, Yang CM. 2014. PAR1-dependent COX-2/PGE2 production contributes to cell proliferation via EP2 receptors in primary human cardiomyocytes. Br J Pharmacol 171:4504–4519.
Morand MA, Schilder H, Blondin J, Stone PJ, Franzblau C. 1981. Collagenolytic and elastinolytic activities from diseased human dental pulps. J Endod 24:156–160.
Coughlin SR. 2000. Thrombin signalling and protease-activated receptors. Nature 407:258–264.
Muromachi K, Kamio N, Narita T, Annen-Kamio M, Sugiya H, Matsushima K. 2012. MMP-3 provokes CTGF/CCN2 production independently of protease activity and dependently on dynamin-related endocytosis, which contributes to human dental pulp cell migration. J Cell Biochem 113:1348–1358.
Elsalhy M, Azizieh F, Raghupathy R. 2013. Cytokines as diagnostic markers of pulpal inflammation. Int Endod J 46:573–580. Francel PC. 1992. Bradykinin and neuronal injury. J Neurotrauma 9(Suppl1): S27–S45. Frey EK. 1926. Zusammenh€ange zwischen Herzarbeit und Nierent€atigkeit. Arch Klin Chir 142:663–669. Gruber R, Jindra C, Kandler B, Watzak G, Fischer MB, Watzek G. 2004. Proliferation of dental pulp fibroblasts in response to thrombin involves mitogen-activated protein kinase signalling. Int Endod J 37:145–150. Grynkiewicz G, Poenie M, Tsien RY. 1985. A new generation of Ca2þ indicators with greatly improved fluorescence properties. J Biol Chem 260:3440–3450. Kamio N, Hashizume H, Nakao S, Matsushima K, Sugiya H. 2008. Plasmin is involved in inflammation via protease-activated receptor-1 activation in human dental pulp. Biochem Pharmacol 75:1974–1980.
O0 Boskey FJ, Jr., Panagakos FS. 1998. Cytokines stimulate matrix metalloproteinase production by human pulp cells during long-term culture. J Endod 24:7–10. Oikonomopoulou K, Hansen KK, Saifeddine M, Tea I, Blaber M, Blaber SI, Scarisbrick I, Andrade-Gordon P, Cottrell GS, Bunnett NW, Diamandis EP, Hollenberg MD. 2006. Proteinase-activated receptors, targets for kallikrein signaling. J Biol Chem 281:32095–32112. Okabe T, Matsushima K. 2006. Regulation of ALP activity by TNF-alpha on human dental pulp. J Endod 32:516–520. Ramsay AJ, Dong Y, Hunt ML, Linn M, Samaratunga H, Clements JA, Hooper JD. 2008. Kallikrein-related peptidase 4 (KLK4) initiates intracellular signaling via protease-activated receptors (PARs). KLK4 and PAR-2 are co-expressed during prostate cancer progression. J Biol Chem 283:12293–12304.
Kamio N, Muromachi K, Hayama T, Okabe T, Kamio M, Morohashi T, Matsushima K. 2014. Plasmin-induced cyclooxygenase-2 expression via calcineurin activation in human dental pulp cells. Jpn J Conserv Dent 57:442–451.
Sundqvist G, Lerner UH. 1996. Bradykinin and thrombin synergistically potentiate interleukin 1 and tumour necrosis factor induced prostanoid biosynthesis in human dental pulp fibroblasts. Cytokine 8:168–177.
Kawabata A, Matsunami M, Sekiguchi F. 2008. Gastrointestinal roles for proteinase-activated receptors in health and disease. Br J Pharmacol 153: S230–S240.
Sainz IM, Pixley RA, Colman RW. 2007. Fifty years of research on the plasma kallikrein-kinin system: From protein structure and function to cell biology and in-vivo pathophysiology. Thromb Haemost 98:77–83.
Kitamura N, Kitagawa H, Fukushima D, Takagaki Y, Miyata T, Nakanishi S. 1985. Structural organization of the human kininogen gene and a model for its evolution. J Biol Chem 260:8610–8617.
Schmaier AH. 2008. Assembly, activation, and physiologic influence of the plasma kallikrein/kinin system. Int Immunopharmacol 8:161–165.
Hayashi J, Salomon DR, Hugli TE. 2002. Elevated kallikrein activity in plasma from stable liver transplant recipients. Int Immunopharmacol 2:1667–1680. Hirota CL, Moreau F, Iablokov V, Dicay M, Renaux B, Hollenberg MD, MacNaughton WK. 2012. Epidermal growth factor receptor transactivation is required for proteinase-activated receptor-2-induced COX-2 expression in intestinal epithelial cells. Am J Physiol Gastrointest Liver Physiol 303: G111–G119. Houle S, Papez MD, Ferazzini M, Hollenberg MD, Vergnolle N. 2005. Neutrophils and the kallikrein-kinin system in proteinase-activated receptor 4-mediated inflammation in rodents. Br J Pharmacol 146:670–678. Jaffre F, Friedman AE, Hu Z, Mackman N, Blaxall BC. 2012. B-adrenergic receptor stimulation transactivates protease-activated receptor 1 via matrix metalloproteinase 13 in cardiac cells. Circulation 125:2993–3003. Linardoutsos D, Gazouli M, Machairas A, Bramis I, Zografos GC. 2014. Kallikrein-related peptidases in cancers of gastrointestinal tract: An inside view of their role and clinical significance. J BUON 19:53–59. Lundy FT, About I, Curtis TM, McGahon MK, Linden GJ, Irwin CR, El Karim IA. 2010. PAR-2 regulates dental pulp inflammation associated with caries. J Dent Res 89:684–688. Mandle RJ, Colman RW, Kaplan AP. 1976. Identification of prekallikrein and high-molecular-weight kininogen as a complex in human plasma. Proc Natl Acad Sci USA 73:4179–4183. Metters KM, Rossier J, Paquin J, Chretien M, Seidah NG. 1988. Selective cleavage of proenkephalin-derived peptides (less than 23,300 daltons) by plasma kallikrein. J Biol Chem 263:12543–12553. Miles LA, Greengard JS, Griffin JH. 1983. A comparison of the abilities of plasma kallikrein, beta-Factor XIIa, Factor XIa, and urokinase to activate plasminogen. Thromb Res 29:407–417. Mize GJ, Wang W, Takayama TK. 2008. Prostate-specific kallikreins-2 and -4 enhance the proliferation of DU-145 prostate cancer cells through proteaseactivated receptors-1 and -2. Mol Cancer Res 6:1043–1051.
1528
KALLIKREIN ACTIVATES PAR-1 IN DENTAL PULP
Selzer S, Bender IB. 1984. The dental pulp: Biologic considerations in dental procedures. Philadelphia: JB Lippincott Company. Seymour ML, Zaidi NF, Hollenberg MD, MacNaughton WK. 2003. PAR1dependent and independent increases in COX-2 and PGE2 in human colonic myofibroblasts stimulated by thrombin. Am J Physiol Cell Physiol 284: C1185–C1192. Tanaka N, Morita T, Nezu A, Tanimura A, Mizoguchi I, Tojyo Y. 2004. Signaling mechanisms involved in protease activated receptor-1-mediated interleukin-6 production by human gingival fibroblasts. J Pharmacol Exp Ther 311:778–786. Tancharoen S, Sarker KP, Imamura T, Biswas KK, Matsushita K, Tatsuyama S, Travis J, Potempa J, Torii M, Maruyama I. 2005. Neuropeptide release from dental pulp cells by RgpB via proteinase-activated receptor-2 signaling. J Immunol 174:5796–5804. Thomas R. 2015. The vascular side of plasma kallikrein. Blood 125:589–590. Trabert KC, Caput AA, Abou-Rass M. 1978. Tooth fracture—A comparison of endodontic and restorative treatments. J Endod 4:341–345. Trejo J. 2003. Protease-activated receptors: New concepts in regulation of G proteincoupled receptor signaling and trafficking. J Pharmacol Exp Ther 307:437–442. Trivedi V, Boire A, Tchernychev B, Kaneider NC, Leger AJ, O0 Callaghan K, Covic L, Kuliopulos A. 2009. Platelet matrix metalloprotease-1 mediates thrombogenesis by activating PAR1 at a cryptic ligand site. Cell 137:332–343. Vu TK, Hung DT, Wheaton VI, Coughlin SR. 1991. Molecular cloning of a functional thrombin receptor reveals a novel proteolytic mechanism of receptor activation. Cell 64:1057–1068. Yoon H, Radulovic M, Wu J, Blaber SI, Blaber M, Fehlings MG, Scarisbrick IA. 2013. Kallikrein 6 signals through PAR1 and PAR2 to promote neuron injury and exacerbate glutamate neurotoxicity. J Neurochem 127:283–298. Zhang C, Gao GR, Lv CG, Zhang BL, Zhang ZL, Zhang XF. 2012. Proteaseactivated receptor-2 induces expression of vascular endothelial growth factor and cyclooxygenase-2 via the mitogen-activated protein kinase pathway in gastric cancer cells. Oncol Rep 28:1917–1923.
JOURNAL OF CELLULAR BIOCHEMISTRY
