MOLECULAR REPRODUCTION AND DEVELOPMENT 32:339-348 (1992)
Isolation of Epiblast-Specific cDNA Clones by Differential Hybridization With Polymerase Chain Reaction-Amplified Probes Derived From Single Embryos SUSANNAH VARMUZA AND PER1 TATE Department of Zoology, University of Toronto, Toronto, Ontario, Canada
ABSTRACT A mouse day 7.5 embryonic ectoderm cDNA library containing 2 x lo6 clones was screened by differential hybridization with polymerase chain reaction (PCR)-amplified probes derived from a single embryo. Day 7.5 ectoplacental cone and embryonic ectoderm served as the source of mRNA t o make minus and plus probes, respectively. In a limited screen of fewer than 2,000 clones, 23 up-regulated clones were identified by the difference in hybridization signal with the two probes. DNA sequence analysis revealed the nature of some, but not all, of the clones. Northern blot and in situ hybridization with a subset of the clones confirmed the utility of the approach, since the differential signal was also observed in these experiments. This approach may prove useful for identifying genes that play a role during development. 0 1992 Wiley-Liss, Inc.
structures such as the notocord and the somites. Genetic control of these events is likely to be complex. The obvious place to look for genes involved in pattern formation in mammalian (mouse) embryos would be gastrulating embryos. Attempts to do so have been inhibited by the small size of the embryos and by their inaccessibility inside the uterus. We report here some initial success in isolating genes from gastrulating epiblast using differential hybridization with polymerase chain reaction (PCRf-amplified cDNA probes. We believe that this approach may simplify what has previously been a somewhat daunting task.
MATERIALS AND METHODS Construction of cDNA Libraries
The cDNA libraries were made in the conventional way. Several thousand mouse embryos a t 7.5 days of gestation were dissected as accurately as possible into Key Words: Gastrulation, Mouse embryos, Ectoderm, three tissues-ectoplacental cone, extraembryonic eccDNA toderm, and embryonic ectoderm (epiblast). Poly-A+ RNA was extracted from pooled tissue samples and cDNA was made using an oligo dT-XbaI adapterprimer (Promega) to prime first strand synthesis. Second strand synthesis was performed with Escherichia INTRODUCTION coli polymerase following treatment with RNase H. The stunning success of Drosophila developmental The cDNA was treated with EcoRI methylase, and genetics has inspired a whole generation of biologists to EcoRI linkers were ligated to both ends. The resulting search for genes in other organisms, particularly verte- double-strand cDNA was digested with EcoRI and brates, playing analogous roles. A number of promising XbaI. This allowed directional cloning into lambdastrategies have been devised, including homology GEM2 (Promega). Because developmental time and searches (Kessel and Gruss, 19901, enhancer trap ex- chronological time do not always correspond, the develperiments (Gossler et al., 1989), and more recently the opmental stages represented in the pooled samples very effective gene trap approach (Skarnes, 1990). ranged from 6 to 8 days, spanning the developmental These experiments are yielding rich rewards but may stage of interest. The libraries all contained -1-2 x lo6 tell only part of the story. independent clones, with an average size of 500 bp. Pattern formation events occur during two major Because the tissues are relatively noncomplex a t this stages of vertebrate development, gastrulation and neural crest migration. In mammals and birds, gastrulation is morphologically distinctive as compared with the same event in amphibians and fish, and particu- Received December 11,1991; accepted February 10,1992. larly as compared with that in Drosophila. A popula- Peri Tate’s present address is Institute of Cell and Molecular Biology, Building, King’s Buildings, Mayfield Road, Edinburgh EH9 tion of mesenchymal mesodermal cells delaminates Darwin 3JR, Scotland. from the epithelial epiblast and streams together in a Address reprint requests to Susannah Varmuza, Department of Zoolstructure called the primitive streak. The mesodermal ogy, University of Toronto, 25 Harbord Street, Toronto, Ontario M5S cells in the primitive steak eventually coalesce to form 1A1, Canada.
0 1992 WILEY-LISS, INC.
340
S. VARMUZA AND P. TATE
stage, the libraries likely are quite representative of the mRNA populations.
Screening by Differential Hybridization The ectoplacental cone (epc; source of minus probe) and embryonic ectoderm (ee; source of plus probe) were dissected from a day 7.5 mouse embryo and placed immediately into reverse transcriptase lysis buffer as described by Brady et al. (1990), except that a larger volume of lysis buffer was used to lyse the tissue. An 8 p1 aliquot of the lysed tissue was then removed for cDNA synthesis and amplification as described (Brady et al., 1990). Briefly, the lysis buffer contained 50 mM Tris HC1, pH 8.3, 75 mM KC1, 3 mM MgCI,, 2 pM each dNTP, 100 ngiml oligo-dT24, 0.5% NP40, 100 Uiml Inhibit Ace (5'-3' Inc.), and 2,000 Uiml RNAguard (Pharmacia, Uppsala, Sweden). Samples were denatured a t 65°C for 1 min, cooled a t room temperature for 3 min, and placed on ice. A mixture of reverse transcriptase [lo0 U cloned Moloney R.T. (Gibco-BRL, Grand Island, NY) and 2 units avian R.T. (Boeringer Mannheim, Mannheim, Federal Republic of Germany)] was added, and samples were incubated at 37°C for 15 min and heat inactivated at 65°C for 10 min. An equal volume of 2 x terminal transferase buffer (Gibco-BRL) containing 1mM dATP was added to the samples, and tailing was initiated by addition of 10 U terminal transferase and incubation at 37°C for 15 min. The reaction was terminated by heat inactivation a t 65°C for 10 min. Samples could be stored at this stage for several months at -70°C. The amplification reaction contained 4 pl cDNA, 10 mM Tris HC1, pH 8.3, 50 mM KC1, 2.5 mM MgC12, 100 kgirnl bovine serum albumin (BSA), 1mM each dNTP, 0.05% Triton X-100, 0.2 OD 260 primer [CATGTCGTCCAGGCCGCTCTGGGACAAAATATGAATTC(T),,] and 5 U Amplitaq (Perkin-Elmer Cetus) in a volume of 50 pl. Amplification was accomplished by 25 cycles in a Perkin-Elmer Cetus thermal cycler with the following parameters: 1rnin at 94"C, 2 rnin a t 4YC, 6 rnin plus 10 sec extensionicycle a t 72°C. After adding another 5 U Amplitaq, a further 25 cycles were performed with the following parameters: 1min at 94"C, 1min a t 42"C, and 2 rnin a t 72°C. The resulting cDNA was passed through a sephadex G-50 spin column to remove excess dNTPs before labelling by random priming. Enough cDNA was generated by this procedure to make several (10-20) probes. A detailed description of this protocol can be found in Brady et al. (1990). Differential screening was performed on duplicate plaque lifts of fewer than 2,000 clones from the embryonic ectoderm library. Plaques that hybridized more strongly with the plus probe than with the minus probe were subjected to two additional rounds of hybridization. In all cases but two, the differential signal was confirmed with a second set of probes (epc and ee) generated from different embryos. Plaque-pure phage DNA was prepared from those plaques that survived the tertiary screen. The cDNA inserts from these clones were subcloned as EcoRUXbaI fragments into pGEM7Z
or as SpeI fragments into pUC19. Plasmid subclones were used for both sequence analysis and generation of riboprobes for in situ hybridization.
Identification and Verification Identification of clones was pursued by DNA sequence analysis. Since the cDNAs were cloned directionally, the orientation of each was known. In all cases, the 3' end was sequenced using a T7 RNA polymerase promoter-specific primer, and in some cases the 5' end was sequenced using a n SP6 RNA polymerasespecific primer. The partial 3' and 5' sequences from each clone were analyzed using the Wisconsin Software Package or PCiGene software. Verification of the differential signal was performed by Northern blot analysis of RNA from 9.5, 11.5, and 13.5 day embryo and placenta (Sambrook et al., 1989) and by in situ hybridization to paraffin sections of 7.5 day mouse embryos and in a few cases 13.5 day embryos. Briefly, embryos were fixed in 4% paraformaldehyde in 1x PBS, dehydrated through a n ethanol series, and embedded in paraplast x-tra tissue embedding medium (Monoject). Sections (6 pm) were subjected to a prehybridization treatment that included a 20 pg/ml pronase digestion (Sigma) to increase the accessibility of the target mRNA to the probe and acetylation to reduce nonspecific background. Sense and antisense riboprobes were radiolabelled using a l ~ h a - UTP ~ ~ S(Amersham Corporation Arlington Heights, IL) and base hydrolyzed to achieve optimal probe length. These probes were hybridized to sections overnight a t 55°C in 50% formamide, 0.3 M NaC1, 20 mM Tris C1, pH 8.0, 0.5 mM EDTA, 10 mM NaPO, pH 8.0, 10% dextran sulphate, 1x Denhardt's solution, 0.5 mgiml yeast RNA, and 10 mM dithiotheitol (DTT). Slides were washed as follows: 1)5 x SSC, 10 mM DTT a t 55°C for 30 min; 2) 50% formamide, 2 x SSC, 0.1% P-mercaptoethanol a t 65°C for 30 min; 3) 0.5 M NaCl, 10 mM Tris C1, pH 7.5, 5 mM EDTA, three times, 15 min each a t 37°C; 4) 0.5 M NaCl, 10 mM Tris C1, pH 7.5, 5 mM EDTA, 20 pgiml RNase A (Boehringer Mannheim) for 30 min at 37°C to remove nonspecifically bound probe; 5) 0.5 M NaC1, 10 mM Tris C1, pH 7.5, 5 mM EDTA, a t 37°C for 15 min; 6) 50% formamide, 2~ SSC, 0.1% (3mercaptoethanol a t 65°C for 30 min; 7) 2 x SSC 15 min at 37°C; and 8 ) 0 . 1 SSC ~ 37°C for 15 min. Slides were air dried and then coated with Eastman Kodak NTB-2 nuclear emulsion. Following exposure for varying lengths of time, slides were developed and fixed in Kodak D-19 developer and Kodak fixer. Sections were stained with 0.1% toluidine blue. Southern blot analysis was performed on tail DNA from five inbred strains of mice a s described by Sambrook et al. (1989).
RESULTS Screening the cDNA Library The critical factor in screening libraries is not the library (assuming it is representative) but the probe. Ideally, the probe should target the genes of interest
PCR-AMPLIFIED cDNA PROBES FROM SINGLE EMBRYOS
341
Fig. 1. Duplicate plaque lifts hybridized with PCR-amplified cDNA probes derived from ectoplacental cone and embryonic ectoderm. Duplicate plaque lifts of the 7.5 day embryonic ectoderm library were hybridized with probes derived from a single embryo. The filter on the right (epc) was hybridized with ectoplacental cone cDNA (minus probe), while the filter on the left (ee) was hybridized with embryonic ectoderm cDNA (plus probe). A few differentially hybridizing plaques are indicated by arrowheads.
with ease. Subtractive probes derived from very similar tissues eliminate the high degree of noise caused by the similarity. On the other hand, probes derived from very different tissues may be effective in a straight differential screen. We elected to use embryonic ectoderm and ectoplacental cone from 7.5 day embryos as the source of plus/ minus probes. The two tissues represent lineages that have been separated for 4 days but that are still relatively undifferentiated. The protocol for making PCRamplified cDNA was designed to generate short 3‘ -endspecific sequences that would be quantitatively representative of the mRNA population. The small size of the cDNAs reduced the complexity of the probe and hence the exposure time needed to visualize clones. A representative pair of plaque lifts is shown in Figure 1. Note the fairly large number of differential signals. Relative signal intensity did not change substantially when a second set of probes, derived from another embryo, was used on separate sets of secondary or tertiary lifts of the clones under scrutiny. Three of the purified, subcloned cDNAs were hybridized to 50,000 clones from the 7.5 day embryonic ectoderm library to assess their relative abundance. Clone ee 1-1 is present in 0.5% of clones, clone ee 13 is present in 0.25%, and clone ee 1C is present in 0.001% of clones. Clone ee 1-1hybridizes with 0.025% of clones in a 12.5 day random primed library, consistent with the reduced hybridization signal seen on Northern blots a t later times (see following).
Identification of Clones The identities of the clones, as assessed by sequence analysis of -200 bp from the 3’ end of each clone, and in some cases also from the 5‘ end, are listed in Table 1. Full-length sequencing of each clone would be unnecessary at this point; the goal was classification of clones into “known” and “unknown” categories with respect to mouse genes. Five of the clones are mouse elongation factor l A , although one of the five, clone ee 2-3, contains different 3’ sequences, suggesting that this gene undergoes differential splicing or poly-A addition signal usage. Among the remaining 18 clones, eight fall into the “unknown” category. While it is still possible that some of these clones are too short to be identified as such with confidence, we noted with some surprise the fact that several clones matched their nonmurine counterparts in the 3’ untranslated region, indicating possible functional roles for these sequences. Analysis of Expression of Epiblast cDNAs Verification of the differential signal with the PCRamplified probes was deemed to be assessed best in 7.5 day embryos, in t h a t these were the source of RNA. Northern blots on 7.5 day RNA require extensive dissections, so we elected to perform in situ hybridization on wax sections of 7.5 day embryos. This does not allow strict quantitation of each clone but does allow visual verification of the differential signal between ectoplacental cone and embryonic ectoderm.
342
S. VARMUZA AND P. TATE TABLE 1. Identification of Clones by DNA Sequence Comparisons cDNA clone Tentative identificationa Percent homology
ee 2b hnRNP 69%, humand ee 3c Ribosomal protein S17 88%,rate -e ee 4c Unknown go%, ratd ee 1 - 1 ~ Helix-destabilizing protein 92%,humane ee 1-4 Prothymosin 1OO%, moused ee 2-3b Elongation factor l a -e ee 2-4 Unknown -e ee 3-1 Unknown ee 3-3c Translationally controlled mRNA 89%,mousee -e ee 3-6c Repetitive element loo%, mousee ee 3-7 Lactate dehydrogenase -e ee 3-8 Unknown loo%, mousee ee 3-10 Elongation factor l a -e ee 4-lC Unknown loo%, mousee ee 4-2c Elongation factor l a loo%, mousee ee 5-lC Elongation factor l a loo%, mousee Elongation factor l a ee 5-2 939’0,ratd ee 5-3b Cyclophilin -e ee C-4 Unknown loo%, mousee ee 12 Mitochondria1 genome -e ee 13b Unknown 91%, ratd e ee lAb Ribosomal protein S11 ee l C b Unknown aAnalysis was restricted to nucleotide sequences. All except ee 1A and ee 1C were analyzed by FASTA search of GENBANK databases via BIO.NET (Pearson and Lipman, 1988).Clones ee 1A and ee 1C were analyzed withPC/Gene software in a search of the EMBL 25 database. bAnalyzed by Northern blot and in situ hybridization. CAnalyzedby Northern blot only. d5r and 3’ ends of clone sequenced. e3’ end of clone sequenced.
Figure 2 illustrates the hybridization patterns of four of our clones. The first thing to note is the difference in signal between ectoplacental cone and embryonic ectoderm, which is consistent for all clones, although clone ee 2 shows significant hybridization to part of the ectoplacental cone. In particular, secondary giant cells, which form a substantial part of the tissue used to make probe, do not express these genes above background levels. Comparison with the pattern generated by IGF-I1 (DeChiara et al., 19911,which is expressed at high levels in trophoblast (Fig. 31, illustrates this difference. Second, some clones are expressed in slightly different patterns. For example, the hybridization signal with clone ee 2 (hnRNP) and clone ee 5-3 (cyclophilin) is strong over both embryonic ectoderm and extraembryonic ectoderm, while clone ee 1-1 (helixdestabilizing protein) and clone ee 13 (unknown) are expressed more strongly in embryonic ectoderm than in extraembryonic ectoderm. In other sections, we observed strong hybridization of clones ee 2 (hnRNP) and ee 5-3 (cyclophilin) to mesoderm, while clone ee 13 (unknown) displayed weak hybridization to mesoderm (not shown). The hnRNP clone (ee 2) has been shown to hybridize with many members of the gene family on a Southern blot (see Fig. 6) and with multiple transcripts on a Northern blot (Fig. 4),so the in situ pattern seen here may reflect that of more than one gene.
Northern blot analysis revealed that some clones, which appear to be expressed more abundantly in embryonic ectoderm than in ectoplacental cone at 7.5 days, become up-regulated in the placenta at later stages (Fig. 4). For example, clone ee 5-3 (cyclophilin) is expressed at low levels in ectoplacental cone but at high levels in day 9.5 placenta. The high level of expression of this gene is maintained, a t least up to 13.5 days, consistent with the high levels of expression seen in many cell types and tissues in other organisms (Haendler et al., 1987). Other clones retain the differential expression pattern up to 13.5days. Clone ee 1-1(putative helix-destabilizing protein) is expressed much more abundantly in embryo than in placenta. It is also expressed more abundantly a t early stages than a t later stages. The larger transcript on the Northern blot may be another gene that cross-hybridizes with sequences in the 3‘ untranslated region that are conserved in clone ee 1-1, hnRNP A l , and rat helix-destabilizing protein (hnRNP A l ; Yacov Ben-David, personal communication). We are currently isolating and sequencing full-length cDNA clones of clone ee 1-1to identify it further. Other cDNAs, such a s hnRNP (ee 21, appear to be down-regulated in the embryo. This apparent loss of specificity may reflect tissue restriction in the embryo a s i t becomes more complex, a s evidenced by the hy-
PCR-AMPLIFIED cDNA PROBES FROM SINGLE EMBRYOS
Fig. 2. In situ hybridization of sectioned 7.5 day embryos with differentially expressing cDNA clones. Seven micrometer sections of 7.5 day mouse embryos were hybridized with antisense riboprobes labeled with 35S.Following treatment to remove unbound probe, slides were dipped in photographic emulsion and exposed for varying lengths of
343
time (7-21 days), depending on the quality (age) of the probe and the abundance of the mRNA. Clones used in this experiment were A: ee 1-1(helix-destabilizing protein); B: ee 2 (hnRNP); C: ee 13 (unknown); D: ee 5-3 (cyclophilin). In all cases, sense probe controls were performed. Bar = 200 pm.
344
S. VARMUZA AND P. TATE
Fig. 3. In situ hybridization of 7.5 day embryos with IGF-11. Seven micrometer sections of 7.5 day mouse embryos were hybridized with a subclone of the mouse IGF-I1 gene. The panel a t left is a dark-field image, while that at right is a bright-field image. Arrows at left in the bright-field image indicate the places where embryos were dissected into the three tissues used to make libraries and probes. The upper
one-third is ectoplacental cone (epc), the middle one-third is extraembryonic ectoderm (eee),and the lower one-third is embryonic ectoderm (ee). Other tissues indicated are visceral endoderm (v end), which covers both the eee and the ee, and amnion (am). In all cases, sense probes were hybridized to similar sections and displayed background levels of signal only. Bar = 200 Fm.
bridization signal of hnRNP (ee 2) in day 13.5embryos (Fig. 5A), where some tissues express the gene strongly, while others do not. Clone ee 1-1(helix-destabilizing protein) is expressed, a t 13.5 days, in a pattern very similar to that of hnRNP (ee 2) (Fig. 5B). These patterns suggest that we are observing differences in metabolic rates rather than tissue-specific gene expression. Clone ee 1C is expressed at extremely low levels throughout development in both embryo and placenta. The transcript is barely detectable on a Northern blot, and the in situ hybridization signal is close to background. The differential hybridization signal on plaque lifts was consistently observed through three rounds of screening. Clone ee 1C hybridizes to 0.001%of clones in the embryonic ectoderm cDNA library. The hnRNP clone (ee 2) is a member of a large gene family in the mouse (Fig. 6). A 3' untranslated sequence subclone hybridizes to most of the transcripts in the Northern blot and with the other members of the family on a Southern blot, although less intensely (not
shown). We suspect that this reflects a recent gene amplification event. Human hnRNP A1 also hybridizes with a large number of bands, although Xenopus hnRNP A1 hybridizes to only a few bands (Kay et al., 1990; Biamonti et al., 1989). Mouse hnRNP A1 also hybridizes to a large number of bands; however, sequence comparison reveals that clone ee 2 is not hnRNP A1 (Yacov Ben-David, personal communication). Our clone shares 73% homology with human hnRNP B1 at the nucleotide level, but the coding sequence is not identical. Human hnRNP B1 is not amplified in the genome (Burd et al., 1989). We do not know if the expression pattern we see for our hnRNP clone (ee 2) reflects functional activity.
DISCUSSI 0N Identification of genes involved in pattern formation in mice has proceeded along three main routes: homology with Drosophila genes, mainly homeobox genes (Kessel and Gruss, 1990); enhancer trap experiments
PCR-AMPLIFIED cDNA PROBES FROM SINGLE EMBRYOS
345
Fig. 4. Northern blot analysis. Equal amounts of total RNA from embryo or placenta at indicated developmental stages was eiectrophoresed, blotted, and hybridized with 32P-labelledprobes from plasmids containing clones ee 2, ee 1-1, and ee 5-3. Following exposure of X-ray film, the blots were stripped and rehybridized with a chicken actin probe to confirm the loading of RNA. The numbers and arrows refer to the sizes of transcripts in kb.
revealing chromosomal domains exerting pattern-speeifie expression (Gossler et al., 1989); and gene trap experiments that simultaneously capture and destroy spatially restricted gene activity (Skarnes, 1990). The
first approach has already yielded tremendous insight into the activity of a multigene family. The latter two approaches are elegant but expensive and technically demanding. We have adopted a simpler, more direct
346
S. VARMUZA AND P. TATE
Fig. 5. In situ hybridization of sectioned 13.5 day embryos with differentially expressed cDNA clones. Seven micrometer sections of 13.5day mouse embryos were hybridized with antisense probes as described in the legend to Figure 2. The probes were A: ee 2 (hnRNP); B: ee 1-1(helix destabilizing protein). Bar = 0.25 cm.
Fig. 6. Southern blot of mouse DNA hybridized with clone ee 2. DNA from five inbred mouse strains was digested with HindIII, electrophoresed through a 0.8% agarose gel, and blotted onto Genescreen. The blot was hybridized at high stringency with radiolabelled clone ee 2 (hnRNP).
approach and are encouraged by our initial results. In a short period of time, it is possible to screen fairly large numbers of clones and to discard those deemed not to provide any new information. We used 7.5 day ectoplacental cone and embryonic ectoderm a s the source of probes and were able to iden-
tify 23 up-regulated cDNAs in a very limited screen of a 7.5 day embryonic ectoderm cDNA library. Subsequent analysis of the clones revealed some aspects of their nature. Five of the 23 clones were elongation factor 1A. This clone is obviously quite abundant in the library, as
PCR-AMPLIFIED cDNA PROBES FROM SINGLE EMBRYOS evidenced by the strong hybridization signals 1) with the cDNA probe and 2) on Northern blots. Most of these clones were full length or close to full length, as judged by their size. One contained a different 3' end, suggesting alternative splicing or poly-A addition usage. We did not sequence the whole clone, so we cannot distinguish between these possibilities. Three other clones displayed homology to mouse genes, including lactate dehydrogenase and mitochondrial DNA. One clone, ee 3-3, is not 100% homologous with its putative cognate, translationally controlled mRNA, indicating either conservation of function or membership in a gene family. Six clones share homology with genes from other species, specifically human and rat. Interestingly, the homology resides in the 3' untranslated region, suggesting functional conservation of these sequences. The remaining eight clones are as yet unidentified. Since we have not sequenced each in its entirety, we cannot exclude the possibility that informative sequences are present. Perhaps most intriguing was the putative hnRNP, clone ee 2. This clone hybridizes with several transcripts on a Northern blot, ranging from 1.6 kb to 5.1 kb. It also hybridizes with a minimum of 30 bands on a Southern blot at very high stringency. A subclone containing only 3' untranslated sequences does not reduce the complexity of the signal appreciably, although the intensity is reduced. This profile is very similar to that of the human hnRNP A1 (Biamonti et al., 1989). In the latter case, some of the genes were shown to be processed pseudogenes. Hybridization of human DNA with our clone revealed only two bands a t moderate stringency. Xenopus hnRNP A1 is not amplified in the genome (Kay et al., 1990), and neither are human hnRNP B1, C1, and C2 (Burd e t al., 1989). Our clone shares the greatest degree of homology with human hnRNP B1. Although the true identity of our clone awaits further analysis, it appears that these genes may undergo frequent amplification events, possibly by retrotransposition. The kinds of genes identified by the differential screen described here will depend largely on the choice of probe. We chose to compare ectoplacental cone and embryonic ectoderm. The clones we identified in this way were indeed expressed at lower levels in the ectoplacental cone. It is possible that we are detecting, more frequently, differences in metabolic activity rather than tissue-specific gene expression. Ectoplacental cone is more terminally differentiated than embryonic ectoderm. We consistently observed clones that hybridized exclusively with the minus probe, but did not pursue these. It may be preferable to use probes from more terminally differentiated tissues or from different stages. A differential screen performed with day 9 and day 10 embryos yielded only globin sequences (Wilkinson et al., 1987). These embryos may have been too complex, since organogenesis is well under way by 9 days.
347
Other methods of identifying developmentally regulated genes, specifically enhancer trap (Gossler et al., 1989) and gene trap (Skarnes, 1990) experiments, rely on tagging genomic sequences with a reporter gene in ES cells. I t is not clear whether any tissue culture artifacts accrue from these approaches. One major advantage of gene trap experiments is the simultaneous creation of mutations, in most cases, t h a t greatly aid the genetic analysis. These experiments are very labor intensive and expensive, however, and the genes identified with this methodology are not qualitatively different from those identified by differential hybridization. The same selective criteria are used to focus attention on potentially interesting genes. The limits of detectability in differential hybridization range between 0.05% and 0.1% using heterologous cDNA probes (Sargent, 1987). We were able to detect a sequence at the level of 0.001% (assuming that the library is representative). Our cDNAs typically range between 200 and 500 bp in length. Their small size may reduce the complexity of the probe without affecting its representativeness, increasing the sensitivity. Other investigators employing a similar approach have also reported a n increased detectability (Brunet et al., 1991). Thus careful choice of probe source may be the key to successful screens. Abundance of tissue is no longer a roadblock; purity may be the technical barrier to overcome next. The target library provides the other limitation in this kind of screen. It might be profitable to screen several cDNA libraries to ensure blanket coverage of expressed sequences. Long-term goals include chromosome mapping. The primary objective is the identification of possible mutant alleles. A secondary objective is enrichment of the mouse genome map and, through synthenic relationships, the human genome map. Because the clones are cDNAs, the map location will pinpoint genes. Interestingly, many of the mouse genes share significant homology with nonmurine counterparts, even in the 3' untranslated region. The facility with which cDNA probes can be prepared from very small amounts of starting material will simplify many aspects of molecular biology. This is particularly important for developmental biologists in that the experimental organisms are very small. The experiments described herein demonstrate the ease with which a simple, direct approach can yield rich results.
ACKNOWLEDGMENTS We thank Ged Brady for many helpful discussions and for practical advice. Thanks are also due Bill Skarnes for advice and encouragement, Liz Robertson for providing the IGF-I1 probe, and Mellissa Wigle for critical reading of the manuscript. This work was funded by grants to S.V. from the Natural Sciences and Engineering Research Council of Canada (NSERC) and the Medical Research Council of Canada. S.V. is the recipient of a n NSERC University Research Fellowship.
348
S. VARMUZA AND P. TATE REFERENCES
Biamonti G, Buvoli M, Bassi M, Morandi C, Cobianchi F, Riva S (1989): Isolation of an active gene encoding human hnRNP protein Al. J Mol Biol 207:491-503. Brady G, Barbara M, Iscove N (1990):Representative in vitro cDNA amplification from individual hemopoietic cells and colonies. Methods Mol Cell Biol 2:17-25. Brunet J-F, Shapiro E, Foster S, Kandel E, Iino Y (1991): Identification of a peptide specific for aplysla sensory neurons by PCR-based differential screening. Science 252856459, Burd C, Swanson M, Gorlach M, Dreyfuss G (1989):Primary structure of the heterogeneous nuclear ribonucleoprotein A2, B1, and C2 proteins: A diversity of RNA binding proteins is generated by small peptide inserts. Proc Natl Acad Sci USA 86:9788-9792. DeChiara T, Robertson E, Efstratiadis A (1991): Parental imprinting of the mouse insulin-like growth factor I1 gene. Cell 642349-859. Gossler A, Joyner A, Rossant J, Skarnes W (1989): Mouse embryonic stem cells and reporter constructs to detect developmentally regulated genes. Science 244:463465.
Haendler B, Hofer-Warbinek R, Hofer R (1987):Complementary DNA from human T-cell cyclophilin. EMBO J 6:947-950. Kay B, Sawhney R, Wilson S (1990):Potential for two isoforms of the A1 ribonucleoprotein inXenopus Zaeuzs. Proc Natl Acad Sci 87:1367-1371. Kessel M, Gruss P (1990): Murine developmental control genes. Science 249:37&379. Pearson W, Lipman D (1988): Improved tools for biological sequence comparison. Proc Natl Acad Sci USA 85:244&2448. Sambrook J, Fritsch E, Maniatis T (1989): ‘‘Molecular Cloning, A Laboratory Manual.” Cold Spring Harbor, NY: Cold Sprong Harbor Laboratory Press. Sargent T (1987): Isolation of differentially expressed genes. Methods Enzymol152:423432. Skarnes W (1990): Entrapment vectors: A new tool for mammalian genetics. Biotechnology 8:827-831. Wilkinson D, Bailes J, Champion J, McMahon A (1987): A molecular analysis of mouse development from 8 to 10 days post coitum detects changes only in embryonic globin expression. Development 99:493500.
Isolation of Epiblast-Specific cDNA Clones by Differential Hybridization With Polymerase Chain Reaction-Amplified Probes Derived From Single Embryos SUSANNAH VARMUZA AND PER1 TATE Department of Zoology, University of Toronto, Toronto, Ontario, Canada
ABSTRACT A mouse day 7.5 embryonic ectoderm cDNA library containing 2 x lo6 clones was screened by differential hybridization with polymerase chain reaction (PCR)-amplified probes derived from a single embryo. Day 7.5 ectoplacental cone and embryonic ectoderm served as the source of mRNA t o make minus and plus probes, respectively. In a limited screen of fewer than 2,000 clones, 23 up-regulated clones were identified by the difference in hybridization signal with the two probes. DNA sequence analysis revealed the nature of some, but not all, of the clones. Northern blot and in situ hybridization with a subset of the clones confirmed the utility of the approach, since the differential signal was also observed in these experiments. This approach may prove useful for identifying genes that play a role during development. 0 1992 Wiley-Liss, Inc.
structures such as the notocord and the somites. Genetic control of these events is likely to be complex. The obvious place to look for genes involved in pattern formation in mammalian (mouse) embryos would be gastrulating embryos. Attempts to do so have been inhibited by the small size of the embryos and by their inaccessibility inside the uterus. We report here some initial success in isolating genes from gastrulating epiblast using differential hybridization with polymerase chain reaction (PCRf-amplified cDNA probes. We believe that this approach may simplify what has previously been a somewhat daunting task.
MATERIALS AND METHODS Construction of cDNA Libraries
The cDNA libraries were made in the conventional way. Several thousand mouse embryos a t 7.5 days of gestation were dissected as accurately as possible into Key Words: Gastrulation, Mouse embryos, Ectoderm, three tissues-ectoplacental cone, extraembryonic eccDNA toderm, and embryonic ectoderm (epiblast). Poly-A+ RNA was extracted from pooled tissue samples and cDNA was made using an oligo dT-XbaI adapterprimer (Promega) to prime first strand synthesis. Second strand synthesis was performed with Escherichia INTRODUCTION coli polymerase following treatment with RNase H. The stunning success of Drosophila developmental The cDNA was treated with EcoRI methylase, and genetics has inspired a whole generation of biologists to EcoRI linkers were ligated to both ends. The resulting search for genes in other organisms, particularly verte- double-strand cDNA was digested with EcoRI and brates, playing analogous roles. A number of promising XbaI. This allowed directional cloning into lambdastrategies have been devised, including homology GEM2 (Promega). Because developmental time and searches (Kessel and Gruss, 19901, enhancer trap ex- chronological time do not always correspond, the develperiments (Gossler et al., 1989), and more recently the opmental stages represented in the pooled samples very effective gene trap approach (Skarnes, 1990). ranged from 6 to 8 days, spanning the developmental These experiments are yielding rich rewards but may stage of interest. The libraries all contained -1-2 x lo6 tell only part of the story. independent clones, with an average size of 500 bp. Pattern formation events occur during two major Because the tissues are relatively noncomplex a t this stages of vertebrate development, gastrulation and neural crest migration. In mammals and birds, gastrulation is morphologically distinctive as compared with the same event in amphibians and fish, and particu- Received December 11,1991; accepted February 10,1992. larly as compared with that in Drosophila. A popula- Peri Tate’s present address is Institute of Cell and Molecular Biology, Building, King’s Buildings, Mayfield Road, Edinburgh EH9 tion of mesenchymal mesodermal cells delaminates Darwin 3JR, Scotland. from the epithelial epiblast and streams together in a Address reprint requests to Susannah Varmuza, Department of Zoolstructure called the primitive streak. The mesodermal ogy, University of Toronto, 25 Harbord Street, Toronto, Ontario M5S cells in the primitive steak eventually coalesce to form 1A1, Canada.
0 1992 WILEY-LISS, INC.
340
S. VARMUZA AND P. TATE
stage, the libraries likely are quite representative of the mRNA populations.
Screening by Differential Hybridization The ectoplacental cone (epc; source of minus probe) and embryonic ectoderm (ee; source of plus probe) were dissected from a day 7.5 mouse embryo and placed immediately into reverse transcriptase lysis buffer as described by Brady et al. (1990), except that a larger volume of lysis buffer was used to lyse the tissue. An 8 p1 aliquot of the lysed tissue was then removed for cDNA synthesis and amplification as described (Brady et al., 1990). Briefly, the lysis buffer contained 50 mM Tris HC1, pH 8.3, 75 mM KC1, 3 mM MgCI,, 2 pM each dNTP, 100 ngiml oligo-dT24, 0.5% NP40, 100 Uiml Inhibit Ace (5'-3' Inc.), and 2,000 Uiml RNAguard (Pharmacia, Uppsala, Sweden). Samples were denatured a t 65°C for 1 min, cooled a t room temperature for 3 min, and placed on ice. A mixture of reverse transcriptase [lo0 U cloned Moloney R.T. (Gibco-BRL, Grand Island, NY) and 2 units avian R.T. (Boeringer Mannheim, Mannheim, Federal Republic of Germany)] was added, and samples were incubated at 37°C for 15 min and heat inactivated at 65°C for 10 min. An equal volume of 2 x terminal transferase buffer (Gibco-BRL) containing 1mM dATP was added to the samples, and tailing was initiated by addition of 10 U terminal transferase and incubation at 37°C for 15 min. The reaction was terminated by heat inactivation a t 65°C for 10 min. Samples could be stored at this stage for several months at -70°C. The amplification reaction contained 4 pl cDNA, 10 mM Tris HC1, pH 8.3, 50 mM KC1, 2.5 mM MgC12, 100 kgirnl bovine serum albumin (BSA), 1mM each dNTP, 0.05% Triton X-100, 0.2 OD 260 primer [CATGTCGTCCAGGCCGCTCTGGGACAAAATATGAATTC(T),,] and 5 U Amplitaq (Perkin-Elmer Cetus) in a volume of 50 pl. Amplification was accomplished by 25 cycles in a Perkin-Elmer Cetus thermal cycler with the following parameters: 1rnin at 94"C, 2 rnin a t 4YC, 6 rnin plus 10 sec extensionicycle a t 72°C. After adding another 5 U Amplitaq, a further 25 cycles were performed with the following parameters: 1min at 94"C, 1min a t 42"C, and 2 rnin a t 72°C. The resulting cDNA was passed through a sephadex G-50 spin column to remove excess dNTPs before labelling by random priming. Enough cDNA was generated by this procedure to make several (10-20) probes. A detailed description of this protocol can be found in Brady et al. (1990). Differential screening was performed on duplicate plaque lifts of fewer than 2,000 clones from the embryonic ectoderm library. Plaques that hybridized more strongly with the plus probe than with the minus probe were subjected to two additional rounds of hybridization. In all cases but two, the differential signal was confirmed with a second set of probes (epc and ee) generated from different embryos. Plaque-pure phage DNA was prepared from those plaques that survived the tertiary screen. The cDNA inserts from these clones were subcloned as EcoRUXbaI fragments into pGEM7Z
or as SpeI fragments into pUC19. Plasmid subclones were used for both sequence analysis and generation of riboprobes for in situ hybridization.
Identification and Verification Identification of clones was pursued by DNA sequence analysis. Since the cDNAs were cloned directionally, the orientation of each was known. In all cases, the 3' end was sequenced using a T7 RNA polymerase promoter-specific primer, and in some cases the 5' end was sequenced using a n SP6 RNA polymerasespecific primer. The partial 3' and 5' sequences from each clone were analyzed using the Wisconsin Software Package or PCiGene software. Verification of the differential signal was performed by Northern blot analysis of RNA from 9.5, 11.5, and 13.5 day embryo and placenta (Sambrook et al., 1989) and by in situ hybridization to paraffin sections of 7.5 day mouse embryos and in a few cases 13.5 day embryos. Briefly, embryos were fixed in 4% paraformaldehyde in 1x PBS, dehydrated through a n ethanol series, and embedded in paraplast x-tra tissue embedding medium (Monoject). Sections (6 pm) were subjected to a prehybridization treatment that included a 20 pg/ml pronase digestion (Sigma) to increase the accessibility of the target mRNA to the probe and acetylation to reduce nonspecific background. Sense and antisense riboprobes were radiolabelled using a l ~ h a - UTP ~ ~ S(Amersham Corporation Arlington Heights, IL) and base hydrolyzed to achieve optimal probe length. These probes were hybridized to sections overnight a t 55°C in 50% formamide, 0.3 M NaC1, 20 mM Tris C1, pH 8.0, 0.5 mM EDTA, 10 mM NaPO, pH 8.0, 10% dextran sulphate, 1x Denhardt's solution, 0.5 mgiml yeast RNA, and 10 mM dithiotheitol (DTT). Slides were washed as follows: 1)5 x SSC, 10 mM DTT a t 55°C for 30 min; 2) 50% formamide, 2 x SSC, 0.1% P-mercaptoethanol a t 65°C for 30 min; 3) 0.5 M NaCl, 10 mM Tris C1, pH 7.5, 5 mM EDTA, three times, 15 min each a t 37°C; 4) 0.5 M NaCl, 10 mM Tris C1, pH 7.5, 5 mM EDTA, 20 pgiml RNase A (Boehringer Mannheim) for 30 min at 37°C to remove nonspecifically bound probe; 5) 0.5 M NaC1, 10 mM Tris C1, pH 7.5, 5 mM EDTA, a t 37°C for 15 min; 6) 50% formamide, 2~ SSC, 0.1% (3mercaptoethanol a t 65°C for 30 min; 7) 2 x SSC 15 min at 37°C; and 8 ) 0 . 1 SSC ~ 37°C for 15 min. Slides were air dried and then coated with Eastman Kodak NTB-2 nuclear emulsion. Following exposure for varying lengths of time, slides were developed and fixed in Kodak D-19 developer and Kodak fixer. Sections were stained with 0.1% toluidine blue. Southern blot analysis was performed on tail DNA from five inbred strains of mice a s described by Sambrook et al. (1989).
RESULTS Screening the cDNA Library The critical factor in screening libraries is not the library (assuming it is representative) but the probe. Ideally, the probe should target the genes of interest
PCR-AMPLIFIED cDNA PROBES FROM SINGLE EMBRYOS
341
Fig. 1. Duplicate plaque lifts hybridized with PCR-amplified cDNA probes derived from ectoplacental cone and embryonic ectoderm. Duplicate plaque lifts of the 7.5 day embryonic ectoderm library were hybridized with probes derived from a single embryo. The filter on the right (epc) was hybridized with ectoplacental cone cDNA (minus probe), while the filter on the left (ee) was hybridized with embryonic ectoderm cDNA (plus probe). A few differentially hybridizing plaques are indicated by arrowheads.
with ease. Subtractive probes derived from very similar tissues eliminate the high degree of noise caused by the similarity. On the other hand, probes derived from very different tissues may be effective in a straight differential screen. We elected to use embryonic ectoderm and ectoplacental cone from 7.5 day embryos as the source of plus/ minus probes. The two tissues represent lineages that have been separated for 4 days but that are still relatively undifferentiated. The protocol for making PCRamplified cDNA was designed to generate short 3‘ -endspecific sequences that would be quantitatively representative of the mRNA population. The small size of the cDNAs reduced the complexity of the probe and hence the exposure time needed to visualize clones. A representative pair of plaque lifts is shown in Figure 1. Note the fairly large number of differential signals. Relative signal intensity did not change substantially when a second set of probes, derived from another embryo, was used on separate sets of secondary or tertiary lifts of the clones under scrutiny. Three of the purified, subcloned cDNAs were hybridized to 50,000 clones from the 7.5 day embryonic ectoderm library to assess their relative abundance. Clone ee 1-1 is present in 0.5% of clones, clone ee 13 is present in 0.25%, and clone ee 1C is present in 0.001% of clones. Clone ee 1-1hybridizes with 0.025% of clones in a 12.5 day random primed library, consistent with the reduced hybridization signal seen on Northern blots a t later times (see following).
Identification of Clones The identities of the clones, as assessed by sequence analysis of -200 bp from the 3’ end of each clone, and in some cases also from the 5‘ end, are listed in Table 1. Full-length sequencing of each clone would be unnecessary at this point; the goal was classification of clones into “known” and “unknown” categories with respect to mouse genes. Five of the clones are mouse elongation factor l A , although one of the five, clone ee 2-3, contains different 3’ sequences, suggesting that this gene undergoes differential splicing or poly-A addition signal usage. Among the remaining 18 clones, eight fall into the “unknown” category. While it is still possible that some of these clones are too short to be identified as such with confidence, we noted with some surprise the fact that several clones matched their nonmurine counterparts in the 3’ untranslated region, indicating possible functional roles for these sequences. Analysis of Expression of Epiblast cDNAs Verification of the differential signal with the PCRamplified probes was deemed to be assessed best in 7.5 day embryos, in t h a t these were the source of RNA. Northern blots on 7.5 day RNA require extensive dissections, so we elected to perform in situ hybridization on wax sections of 7.5 day embryos. This does not allow strict quantitation of each clone but does allow visual verification of the differential signal between ectoplacental cone and embryonic ectoderm.
342
S. VARMUZA AND P. TATE TABLE 1. Identification of Clones by DNA Sequence Comparisons cDNA clone Tentative identificationa Percent homology
ee 2b hnRNP 69%, humand ee 3c Ribosomal protein S17 88%,rate -e ee 4c Unknown go%, ratd ee 1 - 1 ~ Helix-destabilizing protein 92%,humane ee 1-4 Prothymosin 1OO%, moused ee 2-3b Elongation factor l a -e ee 2-4 Unknown -e ee 3-1 Unknown ee 3-3c Translationally controlled mRNA 89%,mousee -e ee 3-6c Repetitive element loo%, mousee ee 3-7 Lactate dehydrogenase -e ee 3-8 Unknown loo%, mousee ee 3-10 Elongation factor l a -e ee 4-lC Unknown loo%, mousee ee 4-2c Elongation factor l a loo%, mousee ee 5-lC Elongation factor l a loo%, mousee Elongation factor l a ee 5-2 939’0,ratd ee 5-3b Cyclophilin -e ee C-4 Unknown loo%, mousee ee 12 Mitochondria1 genome -e ee 13b Unknown 91%, ratd e ee lAb Ribosomal protein S11 ee l C b Unknown aAnalysis was restricted to nucleotide sequences. All except ee 1A and ee 1C were analyzed by FASTA search of GENBANK databases via BIO.NET (Pearson and Lipman, 1988).Clones ee 1A and ee 1C were analyzed withPC/Gene software in a search of the EMBL 25 database. bAnalyzed by Northern blot and in situ hybridization. CAnalyzedby Northern blot only. d5r and 3’ ends of clone sequenced. e3’ end of clone sequenced.
Figure 2 illustrates the hybridization patterns of four of our clones. The first thing to note is the difference in signal between ectoplacental cone and embryonic ectoderm, which is consistent for all clones, although clone ee 2 shows significant hybridization to part of the ectoplacental cone. In particular, secondary giant cells, which form a substantial part of the tissue used to make probe, do not express these genes above background levels. Comparison with the pattern generated by IGF-I1 (DeChiara et al., 19911,which is expressed at high levels in trophoblast (Fig. 31, illustrates this difference. Second, some clones are expressed in slightly different patterns. For example, the hybridization signal with clone ee 2 (hnRNP) and clone ee 5-3 (cyclophilin) is strong over both embryonic ectoderm and extraembryonic ectoderm, while clone ee 1-1 (helixdestabilizing protein) and clone ee 13 (unknown) are expressed more strongly in embryonic ectoderm than in extraembryonic ectoderm. In other sections, we observed strong hybridization of clones ee 2 (hnRNP) and ee 5-3 (cyclophilin) to mesoderm, while clone ee 13 (unknown) displayed weak hybridization to mesoderm (not shown). The hnRNP clone (ee 2) has been shown to hybridize with many members of the gene family on a Southern blot (see Fig. 6) and with multiple transcripts on a Northern blot (Fig. 4),so the in situ pattern seen here may reflect that of more than one gene.
Northern blot analysis revealed that some clones, which appear to be expressed more abundantly in embryonic ectoderm than in ectoplacental cone at 7.5 days, become up-regulated in the placenta at later stages (Fig. 4). For example, clone ee 5-3 (cyclophilin) is expressed at low levels in ectoplacental cone but at high levels in day 9.5 placenta. The high level of expression of this gene is maintained, a t least up to 13.5 days, consistent with the high levels of expression seen in many cell types and tissues in other organisms (Haendler et al., 1987). Other clones retain the differential expression pattern up to 13.5days. Clone ee 1-1(putative helix-destabilizing protein) is expressed much more abundantly in embryo than in placenta. It is also expressed more abundantly a t early stages than a t later stages. The larger transcript on the Northern blot may be another gene that cross-hybridizes with sequences in the 3‘ untranslated region that are conserved in clone ee 1-1, hnRNP A l , and rat helix-destabilizing protein (hnRNP A l ; Yacov Ben-David, personal communication). We are currently isolating and sequencing full-length cDNA clones of clone ee 1-1to identify it further. Other cDNAs, such a s hnRNP (ee 21, appear to be down-regulated in the embryo. This apparent loss of specificity may reflect tissue restriction in the embryo a s i t becomes more complex, a s evidenced by the hy-
PCR-AMPLIFIED cDNA PROBES FROM SINGLE EMBRYOS
Fig. 2. In situ hybridization of sectioned 7.5 day embryos with differentially expressing cDNA clones. Seven micrometer sections of 7.5 day mouse embryos were hybridized with antisense riboprobes labeled with 35S.Following treatment to remove unbound probe, slides were dipped in photographic emulsion and exposed for varying lengths of
343
time (7-21 days), depending on the quality (age) of the probe and the abundance of the mRNA. Clones used in this experiment were A: ee 1-1(helix-destabilizing protein); B: ee 2 (hnRNP); C: ee 13 (unknown); D: ee 5-3 (cyclophilin). In all cases, sense probe controls were performed. Bar = 200 pm.
344
S. VARMUZA AND P. TATE
Fig. 3. In situ hybridization of 7.5 day embryos with IGF-11. Seven micrometer sections of 7.5 day mouse embryos were hybridized with a subclone of the mouse IGF-I1 gene. The panel a t left is a dark-field image, while that at right is a bright-field image. Arrows at left in the bright-field image indicate the places where embryos were dissected into the three tissues used to make libraries and probes. The upper
one-third is ectoplacental cone (epc), the middle one-third is extraembryonic ectoderm (eee),and the lower one-third is embryonic ectoderm (ee). Other tissues indicated are visceral endoderm (v end), which covers both the eee and the ee, and amnion (am). In all cases, sense probes were hybridized to similar sections and displayed background levels of signal only. Bar = 200 Fm.
bridization signal of hnRNP (ee 2) in day 13.5embryos (Fig. 5A), where some tissues express the gene strongly, while others do not. Clone ee 1-1(helix-destabilizing protein) is expressed, a t 13.5 days, in a pattern very similar to that of hnRNP (ee 2) (Fig. 5B). These patterns suggest that we are observing differences in metabolic rates rather than tissue-specific gene expression. Clone ee 1C is expressed at extremely low levels throughout development in both embryo and placenta. The transcript is barely detectable on a Northern blot, and the in situ hybridization signal is close to background. The differential hybridization signal on plaque lifts was consistently observed through three rounds of screening. Clone ee 1C hybridizes to 0.001%of clones in the embryonic ectoderm cDNA library. The hnRNP clone (ee 2) is a member of a large gene family in the mouse (Fig. 6). A 3' untranslated sequence subclone hybridizes to most of the transcripts in the Northern blot and with the other members of the family on a Southern blot, although less intensely (not
shown). We suspect that this reflects a recent gene amplification event. Human hnRNP A1 also hybridizes with a large number of bands, although Xenopus hnRNP A1 hybridizes to only a few bands (Kay et al., 1990; Biamonti et al., 1989). Mouse hnRNP A1 also hybridizes to a large number of bands; however, sequence comparison reveals that clone ee 2 is not hnRNP A1 (Yacov Ben-David, personal communication). Our clone shares 73% homology with human hnRNP B1 at the nucleotide level, but the coding sequence is not identical. Human hnRNP B1 is not amplified in the genome (Burd et al., 1989). We do not know if the expression pattern we see for our hnRNP clone (ee 2) reflects functional activity.
DISCUSSI 0N Identification of genes involved in pattern formation in mice has proceeded along three main routes: homology with Drosophila genes, mainly homeobox genes (Kessel and Gruss, 1990); enhancer trap experiments
PCR-AMPLIFIED cDNA PROBES FROM SINGLE EMBRYOS
345
Fig. 4. Northern blot analysis. Equal amounts of total RNA from embryo or placenta at indicated developmental stages was eiectrophoresed, blotted, and hybridized with 32P-labelledprobes from plasmids containing clones ee 2, ee 1-1, and ee 5-3. Following exposure of X-ray film, the blots were stripped and rehybridized with a chicken actin probe to confirm the loading of RNA. The numbers and arrows refer to the sizes of transcripts in kb.
revealing chromosomal domains exerting pattern-speeifie expression (Gossler et al., 1989); and gene trap experiments that simultaneously capture and destroy spatially restricted gene activity (Skarnes, 1990). The
first approach has already yielded tremendous insight into the activity of a multigene family. The latter two approaches are elegant but expensive and technically demanding. We have adopted a simpler, more direct
346
S. VARMUZA AND P. TATE
Fig. 5. In situ hybridization of sectioned 13.5 day embryos with differentially expressed cDNA clones. Seven micrometer sections of 13.5day mouse embryos were hybridized with antisense probes as described in the legend to Figure 2. The probes were A: ee 2 (hnRNP); B: ee 1-1(helix destabilizing protein). Bar = 0.25 cm.
Fig. 6. Southern blot of mouse DNA hybridized with clone ee 2. DNA from five inbred mouse strains was digested with HindIII, electrophoresed through a 0.8% agarose gel, and blotted onto Genescreen. The blot was hybridized at high stringency with radiolabelled clone ee 2 (hnRNP).
approach and are encouraged by our initial results. In a short period of time, it is possible to screen fairly large numbers of clones and to discard those deemed not to provide any new information. We used 7.5 day ectoplacental cone and embryonic ectoderm a s the source of probes and were able to iden-
tify 23 up-regulated cDNAs in a very limited screen of a 7.5 day embryonic ectoderm cDNA library. Subsequent analysis of the clones revealed some aspects of their nature. Five of the 23 clones were elongation factor 1A. This clone is obviously quite abundant in the library, as
PCR-AMPLIFIED cDNA PROBES FROM SINGLE EMBRYOS evidenced by the strong hybridization signals 1) with the cDNA probe and 2) on Northern blots. Most of these clones were full length or close to full length, as judged by their size. One contained a different 3' end, suggesting alternative splicing or poly-A addition usage. We did not sequence the whole clone, so we cannot distinguish between these possibilities. Three other clones displayed homology to mouse genes, including lactate dehydrogenase and mitochondrial DNA. One clone, ee 3-3, is not 100% homologous with its putative cognate, translationally controlled mRNA, indicating either conservation of function or membership in a gene family. Six clones share homology with genes from other species, specifically human and rat. Interestingly, the homology resides in the 3' untranslated region, suggesting functional conservation of these sequences. The remaining eight clones are as yet unidentified. Since we have not sequenced each in its entirety, we cannot exclude the possibility that informative sequences are present. Perhaps most intriguing was the putative hnRNP, clone ee 2. This clone hybridizes with several transcripts on a Northern blot, ranging from 1.6 kb to 5.1 kb. It also hybridizes with a minimum of 30 bands on a Southern blot at very high stringency. A subclone containing only 3' untranslated sequences does not reduce the complexity of the signal appreciably, although the intensity is reduced. This profile is very similar to that of the human hnRNP A1 (Biamonti et al., 1989). In the latter case, some of the genes were shown to be processed pseudogenes. Hybridization of human DNA with our clone revealed only two bands a t moderate stringency. Xenopus hnRNP A1 is not amplified in the genome (Kay et al., 1990), and neither are human hnRNP B1, C1, and C2 (Burd e t al., 1989). Our clone shares the greatest degree of homology with human hnRNP B1. Although the true identity of our clone awaits further analysis, it appears that these genes may undergo frequent amplification events, possibly by retrotransposition. The kinds of genes identified by the differential screen described here will depend largely on the choice of probe. We chose to compare ectoplacental cone and embryonic ectoderm. The clones we identified in this way were indeed expressed at lower levels in the ectoplacental cone. It is possible that we are detecting, more frequently, differences in metabolic activity rather than tissue-specific gene expression. Ectoplacental cone is more terminally differentiated than embryonic ectoderm. We consistently observed clones that hybridized exclusively with the minus probe, but did not pursue these. It may be preferable to use probes from more terminally differentiated tissues or from different stages. A differential screen performed with day 9 and day 10 embryos yielded only globin sequences (Wilkinson et al., 1987). These embryos may have been too complex, since organogenesis is well under way by 9 days.
347
Other methods of identifying developmentally regulated genes, specifically enhancer trap (Gossler et al., 1989) and gene trap (Skarnes, 1990) experiments, rely on tagging genomic sequences with a reporter gene in ES cells. I t is not clear whether any tissue culture artifacts accrue from these approaches. One major advantage of gene trap experiments is the simultaneous creation of mutations, in most cases, t h a t greatly aid the genetic analysis. These experiments are very labor intensive and expensive, however, and the genes identified with this methodology are not qualitatively different from those identified by differential hybridization. The same selective criteria are used to focus attention on potentially interesting genes. The limits of detectability in differential hybridization range between 0.05% and 0.1% using heterologous cDNA probes (Sargent, 1987). We were able to detect a sequence at the level of 0.001% (assuming that the library is representative). Our cDNAs typically range between 200 and 500 bp in length. Their small size may reduce the complexity of the probe without affecting its representativeness, increasing the sensitivity. Other investigators employing a similar approach have also reported a n increased detectability (Brunet et al., 1991). Thus careful choice of probe source may be the key to successful screens. Abundance of tissue is no longer a roadblock; purity may be the technical barrier to overcome next. The target library provides the other limitation in this kind of screen. It might be profitable to screen several cDNA libraries to ensure blanket coverage of expressed sequences. Long-term goals include chromosome mapping. The primary objective is the identification of possible mutant alleles. A secondary objective is enrichment of the mouse genome map and, through synthenic relationships, the human genome map. Because the clones are cDNAs, the map location will pinpoint genes. Interestingly, many of the mouse genes share significant homology with nonmurine counterparts, even in the 3' untranslated region. The facility with which cDNA probes can be prepared from very small amounts of starting material will simplify many aspects of molecular biology. This is particularly important for developmental biologists in that the experimental organisms are very small. The experiments described herein demonstrate the ease with which a simple, direct approach can yield rich results.
ACKNOWLEDGMENTS We thank Ged Brady for many helpful discussions and for practical advice. Thanks are also due Bill Skarnes for advice and encouragement, Liz Robertson for providing the IGF-I1 probe, and Mellissa Wigle for critical reading of the manuscript. This work was funded by grants to S.V. from the Natural Sciences and Engineering Research Council of Canada (NSERC) and the Medical Research Council of Canada. S.V. is the recipient of a n NSERC University Research Fellowship.
348
S. VARMUZA AND P. TATE REFERENCES
Biamonti G, Buvoli M, Bassi M, Morandi C, Cobianchi F, Riva S (1989): Isolation of an active gene encoding human hnRNP protein Al. J Mol Biol 207:491-503. Brady G, Barbara M, Iscove N (1990):Representative in vitro cDNA amplification from individual hemopoietic cells and colonies. Methods Mol Cell Biol 2:17-25. Brunet J-F, Shapiro E, Foster S, Kandel E, Iino Y (1991): Identification of a peptide specific for aplysla sensory neurons by PCR-based differential screening. Science 252856459, Burd C, Swanson M, Gorlach M, Dreyfuss G (1989):Primary structure of the heterogeneous nuclear ribonucleoprotein A2, B1, and C2 proteins: A diversity of RNA binding proteins is generated by small peptide inserts. Proc Natl Acad Sci USA 86:9788-9792. DeChiara T, Robertson E, Efstratiadis A (1991): Parental imprinting of the mouse insulin-like growth factor I1 gene. Cell 642349-859. Gossler A, Joyner A, Rossant J, Skarnes W (1989): Mouse embryonic stem cells and reporter constructs to detect developmentally regulated genes. Science 244:463465.
Haendler B, Hofer-Warbinek R, Hofer R (1987):Complementary DNA from human T-cell cyclophilin. EMBO J 6:947-950. Kay B, Sawhney R, Wilson S (1990):Potential for two isoforms of the A1 ribonucleoprotein inXenopus Zaeuzs. Proc Natl Acad Sci 87:1367-1371. Kessel M, Gruss P (1990): Murine developmental control genes. Science 249:37&379. Pearson W, Lipman D (1988): Improved tools for biological sequence comparison. Proc Natl Acad Sci USA 85:244&2448. Sambrook J, Fritsch E, Maniatis T (1989): ‘‘Molecular Cloning, A Laboratory Manual.” Cold Spring Harbor, NY: Cold Sprong Harbor Laboratory Press. Sargent T (1987): Isolation of differentially expressed genes. Methods Enzymol152:423432. Skarnes W (1990): Entrapment vectors: A new tool for mammalian genetics. Biotechnology 8:827-831. Wilkinson D, Bailes J, Champion J, McMahon A (1987): A molecular analysis of mouse development from 8 to 10 days post coitum detects changes only in embryonic globin expression. Development 99:493500.
