Biochemical Genetics, Vol. 30, Nos. 9/10, 1992
Isolation of a Drosophila Gene Encoding Glutathione S-Transferase 1 Clifford Beali, 2,3 Christine Fyrberg, 2 Sun Song, 2 and Eric Fyrberg 2,4 Received 13 Mar. 1992--Final 16June 1992
We have isolated a Drosophila gene, DmGST-2, that encodes glutathione S-transferase, a homo- or heterodimeric enzyme thought to be involved in detoxification of xenobiotics, including known carcinogens. The encoded protein has a primary sequence that is more similar to mammalian placental and nematode GSTs than that of a previously described Drosophila GST gene, herein referred to as DmGST- 1. We provide a physical map of the gene and show that it specifies at least two mRNAs, measuring 1.9 and 1.6 kb, which differ only in the lengths of their 3' untranslated regions. Both of the mRNAs are present during all developmental stages. In situ hybridization of the DmGST-2 gene to larval polytene chromosomes places it within the 53F subdivision of chromosome 2, and Southern blotting to chromosomal DNA indicates that the gene has no close relatives within the Drosophila genome. Our results make possible molecular genetic approaches for further elaborating the function of glutathione S-transferases in insect development and physiology, in the metabolism of plant toxins, and in conferring insecticide resistance. KEY WORDS: glutathione S-transferase; Drosophila; cellular detoxification; pesticide resistance; insect metabolism.
This work was supported by a grant from the National Institutes of Health to E.A.F. 1 Sequences described herein have been filed in the GenBank Database under Accession Number M95198. 2 Department of Biology, The Johns Hopkins University, 3400 North Charles Street, Baltimore, Maryland 21218. 3 Present address: Biotechnology Center, 1060 Carmack Road, The Ohio State University, Columbus, Ohio 43210. 4 To whom correspondence should be addressed.
515 0006-2928/92/0200-0515506.50/0 ©1992PlenumPublishingCorporation
516
Beail, Fyrberg, Song, and Fyrberg
INTRODUCTION Glutathione S-transferases are a family of enzymes that couple glutathione to electrophiles and also bind with a high affinity to a variety of hydrophobic compounds (reviewed by Pickett and Lu, 1989). The best-characterized GSTs are those found within rat liver, where they are known to be induced during early stages of chemical hepatocarcinogenesis (Satoh et al., 1985). GST has also been invoked to play a role in the drug resistance of various mammalian cell lines and in the development within insect populations of resistance to natural and synthetic toxins, most notably organophosphate insecticides (Cowan et al., 1986; Terriere, 1984). For many toxic xenobiotics, including known carcinogens, glutathione S-transferase conjugate formation is believed to constitute a principal detoxification pathway. Because the enzyme likely plays a pivotal role in detoxification and, in a more general sense, cellular and organismal physiology, it is important to develop approaches for studying its in vivo functions in detail. One means by which to elaborate further the biological function of GSTs is to use molecular genetic methods to ascertain within which tissues they accumulate and, also, to investigate the consequences of perturbing individual isozymes. Such an approach can be difficult to deploy in mammalian organisms or cell lines, and it is therefore useful to develop invertebrate systems that lend themselves well to genetic techniques. As yet there are only two reports documenting the isolation of GST subunit-encoding genes in invertebrate systems. The first is that of Weston et al. (1989), who discovered that a GST gene of Caenorhabditis elegans was located adjacent to the lin-14 gene. However, as yet no attempt has been made to utilize C. eIegans to investigate further GST function. The second is that of Toung et al. (1990), who purified GST from Kco cells and Drosophila embryos, then used antisera to isolate a cDNA that specifies a GST isozyme (referred to herein as DmGST-I). The encoded primary sequence proved most similar to maize GST-III. However, neither the physical map nor the chromosomal location of the corresponding structural gene was reported, making further genetic studies impossible. The fruit fly, Drosophila melanogster, has well-documented advantages for studies of in vivo protein function. Drosophila offers the potential to characterize phenotypic abnormalities associated with mutants that either fail to synthesize a protein or synthesize mutant variants thereof. Drosophila is also a convenient system for deducing protein functions by determining their cellular or subcellular locations, using immunolocalization protocols or by monitoring the accumulation of "reporter" products specified by the corresponding gene promoter. In recent years these advantages have im-
DrosophilaGlutathione S-Transferase
517
proved our understanding of how the body plan of the Drosophila embryo is established (reviewed by St. Johnston and Nusslein-Volhard, 1992) and have similarly enhanced our understanding of the biological roles of particular enzymes and structural proteins (e.g., see Simon et al., 1991; Mahoney et al., 1991). It is an opportune time to employ Drosophila similarly in order to understand cellular detoxification mechanisms better. Here we report the isolation of a gene, DrnGST-2, encoding Drosophila glutathione S-transferase. We provide a physical map of the gene and demonstrate that the sequence of the encoded protein is related to mammalian and nematode GSTs. We show that the gene encodes at least two distinct mRNAs that differ only in the length of their 3' untranslated regions and that both mRNAs are present throughout Drosophila development. Finally, we show that the gene is located within the 53F subdivision of larval polytene chromosomes. Using the information reported here it should be possible to investigate further GST function using classical genetics and, also, to delineate inductive mechanisms by fusing the GST promoter to various reporter genes and introducing such constructs into Drosophila germ line chromosomes.
MATERIALS AND METHODS Isolation of Drosophila DmGST-2 Glutathione S-Transferase cDNA Clones
A fragment containing codons 85-250 of the Drosophila glutathione S-transferase gene DmGST-2 was isolated fortuitously during polymerase chain reaction amplification of fragments of the Drosophila troponin-I gene (refer to Beall and Fyrberg, 1991). We reverse transcribed poly(A)-containing pupal RNA after annealing it to oligo(dT), then amplified DNA using a forward primer having the sequence 5'GGAATTCAAGCCAGCCCTGAAG3' and containing an EcoRI site and a reverse primer, 5'GGGATCCTTTTTTTTTTTTTTTT3', that included a BarnHI site. Both troponin-I and GST genes were amplified because, coincidentally, the 3' 13 nucleotides of the troponin-I forward primer perfectly match a sequence contained within codons 85-90 of the herein described DmGST-2 gene. We used the amplified GST gene fragment as a probe to screen libraries of Poole et al. (1985), in order to isolate a fulMength cDNA. From extensive screens of the early embryo cDNA library we isolated several strongly hybridizing phages. cDNA inserts from each were subcloned into the pUC19 vector and characterized by restriction mapping and sequencing.
518
Beall, Fyrberg, Song, and Fyrberg
Isolation and Characterization of the Drosophila DmGST.2 Glutathione S-Transferase Structural Gene
Fullqength cDNA clones isolated as described above were used to screen the library of Maniatis et aL (1978) according to the method of Benton and Davis (1977). From a screen of 1 x 105 recombinants, we recovered three positives. Restriction mapping of the three lambda clone inserts demonstrated that they could be ordered into an overlapping series and, hence, defined a single chromosomal locus. To localize structural gene exons we hybridized cDNA probes to restriction digests of the recombinant lambda phages. Hybridizing fragments were subcloned in plasmid vectors and sequenced using the method of Sanger et aL (1977). The first intron was not sequenced. Rather, primer sequences derived from the first and second exons were used to amplify the intervening DNA, thus establishing the distance between them. The composite sequence was filed in the GenBank Database under Accession Number M95198. Southern Blotting
EcoRI-digested genomic or phage DNA was electrophoresed through 0.7 or 1.0% agarose gels and transferred to nitrocellulose using standard protocols (Southern, 1975). The blot was hybridized to a 3gP-labeled 1770-nucleotide full-length GST cDNA using moderately stringent conditions. Hybridization was performed at 42°C in 30% (w/v) formamide, 5x SSC (SSC is 0.15 M NaC1, 0.015 M Na citrate, pH 7.0), 5 × Denhardt's solution, 50 mM NaPO4 (pH 6.8) containing 40 ~g of denatured calf thymus DNA/ml. Filters were washed twice at room temperature and three times at 50°C in 2x SSC, 0.1% (w/v) NaPO4, 0.1% (w/v) sodium pyrophosphate, 0.1% (w/v) sodium dodecyl sulfate (SDS). Hybridizing fragments were visualized by exposure to X-ray film. Under these conditions nucleotide sequences with 10-20% mismatch are detectable. DNA Sequencing
Fragments were subcloned in the pUC19 vector and sequenced by the dideoxy-terminator method (Sanger et al., 1977), using a set of oligonucleotide primer sequences that allowed sequencing of all exons, as well as the three small introns. RNA Preparation, Electrophoresis, and Blotting
RNA was extracted from synchronously developing Drosophila cultures by the SDS-phenol technique (Spradling and Mahowald, 1979). Poly(A)-
Drosophila Glutathione S-Transferase
519
containing RNA was prepared from early (0- to 4-hr) and late (20- to 24-hr) embryo stages, early (145-hr), mid (169-hr), and late (186-hr) pupal stages, second-instar larvae, and newly eclosed adults. All times are postfertilization at 25°C. RNAs to be separated were denatured by heating for 15 min at 65°C in a buffer containing 50% formamide and 17% formaldehyde. Electrophoresis buffer contained 20 mM sodium acetate, 1 mM EDTA. For details of RNA transfer and hybridization see Fyrberg et al. (1983). Polymerase Chain Reaction (PCR) Amplifications ofDmGST-2 DNA
Two micrograms of poly(A) + RNA was denatured by heating to 70°C, annealed to 10 ~g of oligo(dT, and transcribed using highly purified reverse transcriptase (Boehringer Mannheim Biochemicals, Indianapolis, Indiana) for 90 rain at 37°C. The cDNA product was heated to 95°C for 5 rain and 25% was amplified as follows. PCR amplifications were carried out in 10 mM Tris-HC1, pH 8.3, 50 mM KCI, 1.5 mM MgCI2, 0.2 mM nucleotide triphosphates, and 0.01% gelatin. Sense and antisense primers were added to a final concentration of 100 pM (approximately 1 ~zg of each in a final volume of 100 ~1), 1 ng of DNA was added, and the mixture was incubated for 30 cycles of denaturation, renaturation, and extension. (94°C/1 rain, 55°C/1 rain, and 72°C/3 rain, respectively) in the presence of highly purified Taq polymerase. Recovered cDNA products were analyzed by electrophoresis in 1.5% agarose. In Situ Hybridization of the DmGST-2 Gene to Polytene Chromosomes
Polytene chromosomes from larval salivary glands of wild-type (Canton-S) larvae were isolated and spread using the technique of Gall and Pardue (1971). Tritium-labeled cRNA was prepared from recombinant lambda phages containing the D m G S T - 2 gene as described by Wensink et al. (1974). Denaturation of chromosomes and hybridization of the probe were as described by Karlik et al. (1984). Our conclusion that the D m G S T - 2 gene is located within the 53F subdivision is based upon examination of approximately 100 chromosomes, each of which displayed only one hybridizing region. RESULTS Isolation of cDNAs Encoding Drosophila DmGST-2 Glutathione S-Transferase
Our study began with the recovery of a secondary band during polymerase chain reaction amplification of troponin-I sequences (see Beall and Fyrberg,
520
Beall, Fyrberg, Song, and Fyrberg
1991). By comparing the sequence of the unexpected fragment to those within nucleic acid data bases, we discovered that it was likely to encode a glutathione S-transferase. In order to investigate the sequence further, it was necessary to recover full-length cDNAs. To this end we screened Drosophila early embryo cDNA libraries with the gene fragment recovered in the initial PCR amplification. We isolated two distinct classes of cDNA, one having a length of 1415 nucleotides and one of 1770 nucleotides, in good agreement with the 1.6- and 1.9-kb mRNAs observed during this stage by RNA blot-hybridization (refer to Fig. 5). The complete sequences of both cDNAs were determined. The translated regions of both clones were identical; they encode a protein having 249 amino acids (molecular weight = 27,709) that is 28% identical to nematode GST and 24% identical to rat placental-type GST [GST-P (Okuda et al., 1987)] but considerably less similar (8-15%, depending on the alignment protocol) to the Drosophila DmGST-1 gene previously isolated by Toung et al. (1990)• A comparison of the Drosophila, nematode, and rat glutathione S-transferase sequences is shown in Fig. 1. Note that the DmGST-2 sequence has an extended N terminus, relative to nematode and rat sequences, as well as to the DrosoDmgst2 NADEAQAPPA EGAPPAEGEA PPPAEGAEGA VEGGEAAPPA EPAEPIKHS~ 50 3 Celgst ...............................................NTL 4 Ratgst ..............................................M P ~ Dmgstl Dmgst2 Celgst Ratgst Dmgstl Dmgst2 Celgst Ratgst Dmgstl
~g~[~
~
ADz ~
CI~T~ Q~GQSW/~E~'i ~ I D ~ L Q G ~ ~ " C ~ 5 ~ . . SPCRSVIMTA ~ / { ~ L N K K LLNLQAGE~ ~ M E ~ K I N P Q . M i I ~ V D ~ KRVHIISMA ~ • .V~C~S~ EEIV~G~I ~
•
.... m .... E
N L
D
T.~~ . ~ I ~ LV.
94 49
52 5O 92
95
I[H IHHU ~
F~ ~QH~DG 18 6 Dmgst2 TINI~'LIH!WS~P .i~_ IKEXKLVr~ Celgst • A 142 Ratgst Dmgstl DMGT~YQSF~ NYY~PQVFAK APADPE~FKK I~A~FEF~N~ F I . . . . E~QD 1 4 6 HL~L~ Celgst ~ V I Ratgst Dmgstl ~ I m s ~
Dmgst2
~VYFAGIT~Y NINYMVKRDL~ EPY~VRGV~ DAVNALEP~ 236 EE . I I T EGV~KI
Isolation of a Drosophila Gene Encoding Glutathione S-Transferase 1 Clifford Beali, 2,3 Christine Fyrberg, 2 Sun Song, 2 and Eric Fyrberg 2,4 Received 13 Mar. 1992--Final 16June 1992
We have isolated a Drosophila gene, DmGST-2, that encodes glutathione S-transferase, a homo- or heterodimeric enzyme thought to be involved in detoxification of xenobiotics, including known carcinogens. The encoded protein has a primary sequence that is more similar to mammalian placental and nematode GSTs than that of a previously described Drosophila GST gene, herein referred to as DmGST- 1. We provide a physical map of the gene and show that it specifies at least two mRNAs, measuring 1.9 and 1.6 kb, which differ only in the lengths of their 3' untranslated regions. Both of the mRNAs are present during all developmental stages. In situ hybridization of the DmGST-2 gene to larval polytene chromosomes places it within the 53F subdivision of chromosome 2, and Southern blotting to chromosomal DNA indicates that the gene has no close relatives within the Drosophila genome. Our results make possible molecular genetic approaches for further elaborating the function of glutathione S-transferases in insect development and physiology, in the metabolism of plant toxins, and in conferring insecticide resistance. KEY WORDS: glutathione S-transferase; Drosophila; cellular detoxification; pesticide resistance; insect metabolism.
This work was supported by a grant from the National Institutes of Health to E.A.F. 1 Sequences described herein have been filed in the GenBank Database under Accession Number M95198. 2 Department of Biology, The Johns Hopkins University, 3400 North Charles Street, Baltimore, Maryland 21218. 3 Present address: Biotechnology Center, 1060 Carmack Road, The Ohio State University, Columbus, Ohio 43210. 4 To whom correspondence should be addressed.
515 0006-2928/92/0200-0515506.50/0 ©1992PlenumPublishingCorporation
516
Beail, Fyrberg, Song, and Fyrberg
INTRODUCTION Glutathione S-transferases are a family of enzymes that couple glutathione to electrophiles and also bind with a high affinity to a variety of hydrophobic compounds (reviewed by Pickett and Lu, 1989). The best-characterized GSTs are those found within rat liver, where they are known to be induced during early stages of chemical hepatocarcinogenesis (Satoh et al., 1985). GST has also been invoked to play a role in the drug resistance of various mammalian cell lines and in the development within insect populations of resistance to natural and synthetic toxins, most notably organophosphate insecticides (Cowan et al., 1986; Terriere, 1984). For many toxic xenobiotics, including known carcinogens, glutathione S-transferase conjugate formation is believed to constitute a principal detoxification pathway. Because the enzyme likely plays a pivotal role in detoxification and, in a more general sense, cellular and organismal physiology, it is important to develop approaches for studying its in vivo functions in detail. One means by which to elaborate further the biological function of GSTs is to use molecular genetic methods to ascertain within which tissues they accumulate and, also, to investigate the consequences of perturbing individual isozymes. Such an approach can be difficult to deploy in mammalian organisms or cell lines, and it is therefore useful to develop invertebrate systems that lend themselves well to genetic techniques. As yet there are only two reports documenting the isolation of GST subunit-encoding genes in invertebrate systems. The first is that of Weston et al. (1989), who discovered that a GST gene of Caenorhabditis elegans was located adjacent to the lin-14 gene. However, as yet no attempt has been made to utilize C. eIegans to investigate further GST function. The second is that of Toung et al. (1990), who purified GST from Kco cells and Drosophila embryos, then used antisera to isolate a cDNA that specifies a GST isozyme (referred to herein as DmGST-I). The encoded primary sequence proved most similar to maize GST-III. However, neither the physical map nor the chromosomal location of the corresponding structural gene was reported, making further genetic studies impossible. The fruit fly, Drosophila melanogster, has well-documented advantages for studies of in vivo protein function. Drosophila offers the potential to characterize phenotypic abnormalities associated with mutants that either fail to synthesize a protein or synthesize mutant variants thereof. Drosophila is also a convenient system for deducing protein functions by determining their cellular or subcellular locations, using immunolocalization protocols or by monitoring the accumulation of "reporter" products specified by the corresponding gene promoter. In recent years these advantages have im-
DrosophilaGlutathione S-Transferase
517
proved our understanding of how the body plan of the Drosophila embryo is established (reviewed by St. Johnston and Nusslein-Volhard, 1992) and have similarly enhanced our understanding of the biological roles of particular enzymes and structural proteins (e.g., see Simon et al., 1991; Mahoney et al., 1991). It is an opportune time to employ Drosophila similarly in order to understand cellular detoxification mechanisms better. Here we report the isolation of a gene, DrnGST-2, encoding Drosophila glutathione S-transferase. We provide a physical map of the gene and demonstrate that the sequence of the encoded protein is related to mammalian and nematode GSTs. We show that the gene encodes at least two distinct mRNAs that differ only in the length of their 3' untranslated regions and that both mRNAs are present throughout Drosophila development. Finally, we show that the gene is located within the 53F subdivision of larval polytene chromosomes. Using the information reported here it should be possible to investigate further GST function using classical genetics and, also, to delineate inductive mechanisms by fusing the GST promoter to various reporter genes and introducing such constructs into Drosophila germ line chromosomes.
MATERIALS AND METHODS Isolation of Drosophila DmGST-2 Glutathione S-Transferase cDNA Clones
A fragment containing codons 85-250 of the Drosophila glutathione S-transferase gene DmGST-2 was isolated fortuitously during polymerase chain reaction amplification of fragments of the Drosophila troponin-I gene (refer to Beall and Fyrberg, 1991). We reverse transcribed poly(A)-containing pupal RNA after annealing it to oligo(dT), then amplified DNA using a forward primer having the sequence 5'GGAATTCAAGCCAGCCCTGAAG3' and containing an EcoRI site and a reverse primer, 5'GGGATCCTTTTTTTTTTTTTTTT3', that included a BarnHI site. Both troponin-I and GST genes were amplified because, coincidentally, the 3' 13 nucleotides of the troponin-I forward primer perfectly match a sequence contained within codons 85-90 of the herein described DmGST-2 gene. We used the amplified GST gene fragment as a probe to screen libraries of Poole et al. (1985), in order to isolate a fulMength cDNA. From extensive screens of the early embryo cDNA library we isolated several strongly hybridizing phages. cDNA inserts from each were subcloned into the pUC19 vector and characterized by restriction mapping and sequencing.
518
Beall, Fyrberg, Song, and Fyrberg
Isolation and Characterization of the Drosophila DmGST.2 Glutathione S-Transferase Structural Gene
Fullqength cDNA clones isolated as described above were used to screen the library of Maniatis et aL (1978) according to the method of Benton and Davis (1977). From a screen of 1 x 105 recombinants, we recovered three positives. Restriction mapping of the three lambda clone inserts demonstrated that they could be ordered into an overlapping series and, hence, defined a single chromosomal locus. To localize structural gene exons we hybridized cDNA probes to restriction digests of the recombinant lambda phages. Hybridizing fragments were subcloned in plasmid vectors and sequenced using the method of Sanger et aL (1977). The first intron was not sequenced. Rather, primer sequences derived from the first and second exons were used to amplify the intervening DNA, thus establishing the distance between them. The composite sequence was filed in the GenBank Database under Accession Number M95198. Southern Blotting
EcoRI-digested genomic or phage DNA was electrophoresed through 0.7 or 1.0% agarose gels and transferred to nitrocellulose using standard protocols (Southern, 1975). The blot was hybridized to a 3gP-labeled 1770-nucleotide full-length GST cDNA using moderately stringent conditions. Hybridization was performed at 42°C in 30% (w/v) formamide, 5x SSC (SSC is 0.15 M NaC1, 0.015 M Na citrate, pH 7.0), 5 × Denhardt's solution, 50 mM NaPO4 (pH 6.8) containing 40 ~g of denatured calf thymus DNA/ml. Filters were washed twice at room temperature and three times at 50°C in 2x SSC, 0.1% (w/v) NaPO4, 0.1% (w/v) sodium pyrophosphate, 0.1% (w/v) sodium dodecyl sulfate (SDS). Hybridizing fragments were visualized by exposure to X-ray film. Under these conditions nucleotide sequences with 10-20% mismatch are detectable. DNA Sequencing
Fragments were subcloned in the pUC19 vector and sequenced by the dideoxy-terminator method (Sanger et al., 1977), using a set of oligonucleotide primer sequences that allowed sequencing of all exons, as well as the three small introns. RNA Preparation, Electrophoresis, and Blotting
RNA was extracted from synchronously developing Drosophila cultures by the SDS-phenol technique (Spradling and Mahowald, 1979). Poly(A)-
Drosophila Glutathione S-Transferase
519
containing RNA was prepared from early (0- to 4-hr) and late (20- to 24-hr) embryo stages, early (145-hr), mid (169-hr), and late (186-hr) pupal stages, second-instar larvae, and newly eclosed adults. All times are postfertilization at 25°C. RNAs to be separated were denatured by heating for 15 min at 65°C in a buffer containing 50% formamide and 17% formaldehyde. Electrophoresis buffer contained 20 mM sodium acetate, 1 mM EDTA. For details of RNA transfer and hybridization see Fyrberg et al. (1983). Polymerase Chain Reaction (PCR) Amplifications ofDmGST-2 DNA
Two micrograms of poly(A) + RNA was denatured by heating to 70°C, annealed to 10 ~g of oligo(dT, and transcribed using highly purified reverse transcriptase (Boehringer Mannheim Biochemicals, Indianapolis, Indiana) for 90 rain at 37°C. The cDNA product was heated to 95°C for 5 rain and 25% was amplified as follows. PCR amplifications were carried out in 10 mM Tris-HC1, pH 8.3, 50 mM KCI, 1.5 mM MgCI2, 0.2 mM nucleotide triphosphates, and 0.01% gelatin. Sense and antisense primers were added to a final concentration of 100 pM (approximately 1 ~zg of each in a final volume of 100 ~1), 1 ng of DNA was added, and the mixture was incubated for 30 cycles of denaturation, renaturation, and extension. (94°C/1 rain, 55°C/1 rain, and 72°C/3 rain, respectively) in the presence of highly purified Taq polymerase. Recovered cDNA products were analyzed by electrophoresis in 1.5% agarose. In Situ Hybridization of the DmGST-2 Gene to Polytene Chromosomes
Polytene chromosomes from larval salivary glands of wild-type (Canton-S) larvae were isolated and spread using the technique of Gall and Pardue (1971). Tritium-labeled cRNA was prepared from recombinant lambda phages containing the D m G S T - 2 gene as described by Wensink et al. (1974). Denaturation of chromosomes and hybridization of the probe were as described by Karlik et al. (1984). Our conclusion that the D m G S T - 2 gene is located within the 53F subdivision is based upon examination of approximately 100 chromosomes, each of which displayed only one hybridizing region. RESULTS Isolation of cDNAs Encoding Drosophila DmGST-2 Glutathione S-Transferase
Our study began with the recovery of a secondary band during polymerase chain reaction amplification of troponin-I sequences (see Beall and Fyrberg,
520
Beall, Fyrberg, Song, and Fyrberg
1991). By comparing the sequence of the unexpected fragment to those within nucleic acid data bases, we discovered that it was likely to encode a glutathione S-transferase. In order to investigate the sequence further, it was necessary to recover full-length cDNAs. To this end we screened Drosophila early embryo cDNA libraries with the gene fragment recovered in the initial PCR amplification. We isolated two distinct classes of cDNA, one having a length of 1415 nucleotides and one of 1770 nucleotides, in good agreement with the 1.6- and 1.9-kb mRNAs observed during this stage by RNA blot-hybridization (refer to Fig. 5). The complete sequences of both cDNAs were determined. The translated regions of both clones were identical; they encode a protein having 249 amino acids (molecular weight = 27,709) that is 28% identical to nematode GST and 24% identical to rat placental-type GST [GST-P (Okuda et al., 1987)] but considerably less similar (8-15%, depending on the alignment protocol) to the Drosophila DmGST-1 gene previously isolated by Toung et al. (1990)• A comparison of the Drosophila, nematode, and rat glutathione S-transferase sequences is shown in Fig. 1. Note that the DmGST-2 sequence has an extended N terminus, relative to nematode and rat sequences, as well as to the DrosoDmgst2 NADEAQAPPA EGAPPAEGEA PPPAEGAEGA VEGGEAAPPA EPAEPIKHS~ 50 3 Celgst ...............................................NTL 4 Ratgst ..............................................M P ~ Dmgstl Dmgst2 Celgst Ratgst Dmgstl Dmgst2 Celgst Ratgst Dmgstl
~g~[~
~
ADz ~
CI~T~ Q~GQSW/~E~'i ~ I D ~ L Q G ~ ~ " C ~ 5 ~ . . SPCRSVIMTA ~ / { ~ L N K K LLNLQAGE~ ~ M E ~ K I N P Q . M i I ~ V D ~ KRVHIISMA ~ • .V~C~S~ EEIV~G~I ~
•
.... m .... E
N L
D
T.~~ . ~ I ~ LV.
94 49
52 5O 92
95
I[H IHHU ~
F~ ~QH~DG 18 6 Dmgst2 TINI~'LIH!WS~P .i~_ IKEXKLVr~ Celgst • A 142 Ratgst Dmgstl DMGT~YQSF~ NYY~PQVFAK APADPE~FKK I~A~FEF~N~ F I . . . . E~QD 1 4 6 HL~L~ Celgst ~ V I Ratgst Dmgstl ~ I m s ~
Dmgst2
~VYFAGIT~Y NINYMVKRDL~ EPY~VRGV~ DAVNALEP~ 236 EE . I I T EGV~KI
