Mol Gen Genet (1990) 221:210-2~8 © Springer-Verlag 1990

Isolation and nucleotide sequence* of an autonomously replicating sequence (ARS) element functional in Candida Mbicnns and Sncchnromyces ccrevisiae Richard D. Cannon, Howard F. Jenkinson, and Maxwell G. Shepherd Experimental Oral Biology Unit, Department of Oral Biology and Oral Pathology, Faculty of Dentistry, University of Otago, P.O. Box 647, Dunedin, New Zealand Summary. An 8.6-kb fragment was isolated from an E c o R I digest of Candida albicans ATCC 10261 genomic D N A which conferred the property of autonomous replication in Saccharomyces cervisiae on the otherwise non-replicative plasmid pMK155 (5.6 kb). The D N A responsible for the replicative function was subcloned as a 1.2-kb fragment onto a non-replicative plasmid (pRC3915) containing the C. albicans URA3 and L E U 2 genes to form plasmid pRC3920. This plasmid was capable of autonomous replication in both S. cerevisiae and C. albicans and transformed S. cerevisiae AH22 ( l e u 2 ) to Leu + at a frequency of 2.15 x 103 transformants per gg DNA, and transformed C. albicans SGY-243 (Aura3) to Ura + at a frequency of 1.91 x 103 transformants per gg DNA. Sequence analysis of the cloned D N A revealed the presence of two identical regions of eleven base pairs ( 5 ' T T T T A T G T T T T 3 ' ) which agreed with the consensus of autonomously replicating sequence ( A R S ) cores functional in S. cerevisiae. In addition there were two 10/11 and numerous 9/11 matches to the core consensus. The two 11/11 matches to the consensus, CaARS1 and CaARS2, were located on opposite strands in a non-coding AT-rich region and were separated by 107 bp. Also present on the C. albicans DNA, 538 bp from the A R S cores, was a gene for 5S r R N A which showed sequence homology with several other yeast 5S r R N A genes. A sub-fragment (494 bp) containing the 5S r R N A gene (but not the region containing the A R S cores) hybridized to genomic DNAs from a number of yeast species, including S. cerevisiae, C. tropicalis, C. pseudotropicalis, C. parapsiIosis, C. kruseii, C. (Torulopsis) glabrata and Neurospora crassa. The 709-bp A R S element (but not the 5S r R N A gene) was necessary for high-frequency transformation and autonomous plasmid replication in both S. cerevisiae and C. albicans. Key words: Candida albicans - Autonomously replicating sequence ( A R S ) - 5S r R N A

Introduction Candida albicans is a dimorphic fungus of clinical importance as the causative agent in oral and vaginal candidosis

*EMBL/GenBank database accession number: X16634 (5S rRNA) Offprint requests to." R.D. Cannon

(Odds 1988). Systemic candidosis poses a greater threat to the patient than superficial infection, and the incidence of the systemic disease is increasing. This is due to an increase in the number of immunosuppressed individuals such as transplant patients and people with immunodeficiency diseases. A greater knowledge of the biochemistry and pathogenicity of C. atbicans is necessary for the development of more effective antifungal agents; this knowledge can be gained by studying the molecular genetics of the organism. C. albicans is not amenable to standard genetic manipulation, as it is diploid or aneuploid (Whelan and Magee 1981) and lacks a sexual cycle. However, C. albicans can be transformed with vector DNA, and both integrative and replicarive transformation systems have been described. A discussion of current approaches to the molecular biology of C. albicans is given in the reviews of Kurtz et al. (1988) and Magee et al. (1988). Initially an integrative system was constructed, based on the A D E 2 gene and an A d e - host (Kurtz et al. 1986). More recently, a replicative system has been described based on a U r a - strain of C. atbicans and the URA3 gene contained on plasmid pCARS1 (Kelly et al. 1987; Kelly et al. 1988; Kurtz et al. 1987). The plasmid pCARS1 has autonomous replicative function in C. albicans, but not in Saccharomyces cerevisiae. The nature of the A R S element in pCARS1 is unknown, and the D N A sequence associated with its replicative function has not been determined. Autonomously replicating sequence ( A R S ) elements from the yeast S. eerevisiae confer on plasmids the ability to be maintained autonomously in S. eerevisiae ceils as extrachromosomal elements (Stinchcomb et al. 1979), and their role in yeast chromosomal replication and segregation has recently been reviewed (Newlon 1988). Experiments using replicon mapping techniques have demonstrated that the functional origin of replication of ribosomal D N A in S. cerevisiae colocalizes with an A R S element (Linskens and Ituberman 1988). In addition, A R S elements are important in the development of transformation systems; A R S elements which confer the property of high-frequency transformation of S. cerevisiae on non-replicative plasmids have been isolated from a variety of eukaryotic chromosomes (Marunouchi et al. 1987; Stinchcomb et al. 1980), and the structural requirements of several A R S elements have been investigated for S. cerevisiae (Kearsey 1984; Srienc et al. 1985; Palzkill and Newlon 1988). A R S elements which function in S. cerevisiae have been isolated from C. utilis (Hsu et al. 1983) and from C. maltosa (Kawamura et al. 1983),

211 but these were not shown to function as replication origins in the species from which they were obtained. However, Takagi et al. (1986) have successfully constructed a vector containing an A R S element from C. maltosa which can replicate in both C. maltosa and S. cerevisiae, and Das et al. (1984) have constructed a similar vector for replication in Kluyveromyces fragilis. This paper describes the isolation and nucleotide sequence analysis of a C. albicans A R S element of known genomic origin, and the construction of a plasmid that replicates autonomously in both S. cerevisiae and C, albieans. This DNA will be of use in constructing shuttle vectors for the analysis of C. albicans gene function and expression. Materials and methods

Materials. Zymolyase 100T was obtained from Seikagaku Kogyo Co. Ltd. (Tokyo 103, Japan). fl-Glucuronidase (type H-2), erythromycin and sorbitol were obtained from Sigma Chemical Co. (St. Louis, Mo.). Radioactive deoxynucleotide triphosphates were obtained from Amersham Australia Pty Ltd. (Sydney, NSW). Restriction and DNAmodifying enzymes were obtained from Amersham Australia, Bethesda Research Laboratories (Gaithersburg, Md.) or Boehringer Mannheim Ltd. (Auckland, NZ). Bacteria and yeast strains. Escherichia coli strain C600 (supE44, tonA21, thr-1, leuB6, thi-1, pro, lacY1, str R) (Bachmann 1972) and E. coli JM83 (Alacpro, ara, thi, strA, o80dlacZ AM15) (Vieira and Messing 1982) were used as bacterial hosts for propagating plasmids. E. coli JMI05 (A lacpro, thi, strA, endA, sbcB15, hsdR4, F'traD36, proAB, lacIqZ AM15) was used as host for M13 sequencing vectors. Saccharomyees cerevisiae AH22 (Mat ~, leu2-3, leu2-112, his4-519, canl) (Hinnen et al. 1978) was kindly provided by G.R. Fink (Massachusetts Institute of Technology, Gambridge, Mass.). Candida albicans 10261 (serotype A, American Type Culture Collection), the Ura C. albicans SGY-243 (ade2/ade2 Aura3: :ADE2/Aura3: :ADE2) and plasmid pCARS1 were kindly provided by R. Kelly (Squibb Institute for Medical Research, Princeton, NJ). Media. E. coli was grown at 37 ° C in either Luria-Bertani (LB) medium which contained Bacto-Tryptone (10 g/l), yeast extract (5 g/l), NaC1 (10 g/l; pH 7.5) or in M9 minimal medium (Maniatis et al. 1982) which contained L-threonine and L-proline (each 0.1 g/l) and thiamine hydrochloride (1 rag/l) as supplements. L-Leucine, uridine (0.1 g/l) and Davis agar (15 g/l) were added when required. Antibiotics were included in LB or M9 minimal media at the following concentrations: ampicillin (Ap), 50 gg/ml; tetracycline (Tc), 15 gg/ml. S. cerevisiae, C. albicans and other fungi were grown at 28 ° C in either rich yeast extract peptone (YEP) medium (grams per litre: yeast extract, 10; Bacto-Peptone, 20; glucose, 20) or in minimal medium (grams per litre: yeast nitrogen base, 6.7; ammonium sulphate, 1; glucose, 10) supplemented with amino acids as required. DNA isolation and manipulation. Large-scale preparation of plasmid DNA from E. eoli was performed by the alkaline lysis method of Birnboim and Doly (1979). Bacterial colonies were screened for plasmid DNA by a rapid boil method (Maniatis et al. t982) based on that described by Holmes and Quigley (1981). Chromosomal DNA was prepared

from C. albicans and other yeasts as described by Cryer et al. (1975), but was not purified by centrifugation through CsC1. Plasmid DNA was labelled with [~-35S]dATPeS by nick translation (Rigby et al. 1977) to a specific activity of l08 dpm/gg. Restriction fragments were separated by electrophoresis through 0.8% (w/v) agarose in Tris/acetate buffer (Maniatis et al. 1982). After electrophoresis, DNA was transferred to nitrocellulose and hybridized with labelled plasmid as described by Southern (1979). Hybridization was carried out at 65°C for 16 h in the presense of 0.9 M NaC1. Nitrocellulose filters were washed for 2 h at either 65 ° C in 0.1 x SSC (1 x SSC: 0.15 M NaC1, 15 mM Na3 citrate, pH 7.0), 0.5% (w/v) sodium dodecyl sulphate (SDS), 15 mM NaC1 (high stringency; allowing only sequences with less than 10% mismatch to remain annealed), or 62° C in 6 x SSC, 0.5% SDS, 0.9 M NaC1 (lower stringency; allowing 30% mismatch). Plasmid vectors. All plasmids were constructed by standard recombinant DNA techniques. Plasmid pMKI52 contains the S. cerevisiae 2-gm origin derived from YEpl3 and the C. albicans 3-isopropylmalate dehydrogenase (3-IMDH, LEU2) gene (Jenkinson et al. 1988). Plasmid pMKt52 was digested with EcoRI and then re-ligated to remove the 2-gm origin of replication; the resultant plasmid pMK155 did not transform S. cerevisiae AH22 to Leu +. Plasmid pRC9155 was constructed by inserting the blunt-ended EcoRI-BamHI fragment of pMK155 containing the C. albicans 3-IMDH gene into the filled-in Ndel site of pUC9 (Vieira and Messing 1982). Plasmid pRC3915 was constructed by inserting the ClaI fragment of pCARS1 (Kelly et al. 1988) containing the C. albicans URA3 gene into the unique NarI site of pRC9155. Transformations. E. coli was transformed with plasmid DNA by the CaC12 method of Dagert and Ehrlich (1979). S. cerevisiae was transformed by the method of Hinnen et al. (1978) with the following modifications: (a) spheroplasts were prepared by incubation with Zymolyase 100T (50 gg Zymolyase per 10 9 cells) for 20 min at room temperature; (b) the spheroplasts were incubated in YEP containing 1 M sorbitol for 20 min to allow physiological recovery before plasmid DNA was added; (c) molten protoplast regeneration agar [PRA: 1 M sorbitol, 2% (w/v) glucose, 0.6% (w/v) yeast nitrogen base and 3% (w/v) agar (Van Solingen and Van der Plaat 1977)] was added directly to the transformation mix and then poured onto PRA plates. The frequency of transformation of S. cerevisiae AH22 to Leu + by this method was approximately 104 transformants per gg YEpl3 DNA. Transformation of C. albicans was carried out by a modification of the method described by Kurtz et al. (1986). A 50-ml culture of C. albieans was grown in YEP medium to an ODs,o of 0.8, and the cells were harvested by centrifugation (5 rain at 3000 g). The cells were incubated for 10 min at 30 ° C in 5 ml of I M sorbitol, 50 mM dithiothreitol, 25 mM ethylenediaminetetra-acetic acid (EDTA; pH 8.0) and then washed by centrifugation. The cells were suspended in 5 ml of 1 M sorbitol, 0.1 M sodium citrate (pH 5.8), 10 mM EDTA to which sterile filtered fl-glucuronidase (0.1 ml) was added. Spheroplasts formed after 30 rain incubation at 30°C were washed by gentle centrifugation (5 rain at 600 g) and resuspended in 0.5 ml of 1 M sorbitol, 10 mM CaClz, 10 mM Tris-HC1 (pH7.5). Transforming DNA was added to portions

212 (0.1 ml) of the spheroplast suspension; these were incubated at room temperature for 15 rain, and then 0.9 ml polyethylene glycol 4000 (20% w/v) was added, After a further 15 rain incubation at room temperature the cells were harvested by centrifugation (5 rain at 600 g) and suspended in 1 M sorbitol, 6.5 m M CaC12, YEP (33% v/v) for physiological recovery. The cell suspensions were incubated at 30°C for 30 rain, suitably diluted, and then portions (0.2 ml) plated directly on the surface of selective medium containing 1 M sorbitol (Kurtz et al. 1986). Colonies from transformed cells were counted after 4 days' incubation at 30 ° C.

DNA sequencing. D N A was sequenced in the M l 3 m p l 0 and M l 3 m p l l phage (Messing and Vieira 1982) using the dideoxy chain termination method of Sanger et al. (1977). The D N A was sequenced entirely using both strands as template and the data analysed using software by Staden (1982) and Stockwell (1985).

Results Isolation of ARS elements from C. albicans

Plasmid pMK1551, containing 8.6 kb C. albicans chromosomal D N A was isolated as described in the Materials and methods section. The plasmid transformed S. cerevisiae AH22 to Leu + at a frequency of approximately 103 transformants per gg DNA; Leu + transformants carrying pMK1551 were mitotically unstable, and the Leu + phenotype was lost at high frequency when Leu + selection was not maintained. D N A prepared from Leu + transformants transformed E. coli C600 to ampicillin resistance. Thus the plasmid was capable of autonomous replication in S. cerevisine and by definition (Stinchcomb et al. 1980) carried an A R S element.

Isolation of C. albicans ARS elements. C. albicans chromosomal D N A (10 gg) was digested with EcoRI, ligated with EcoRI-digested pMK155 (2 gg) and the mixture transformed into E. coli C600 with selection for ampicillin resis-

tance (ApR). The transformants were pooled, total plasmid D N A was prepared by a scaled-up rapid-boil technique (see above), and cells of S. cerevisiae AH22 were transformed to Leu +. Thirty-nine yeast transformants were obtained; these were purified and pooled into 12 groups. Plasmid D N A was prepared from each group and used to transform E. eoli C600 to Ap R. Some pools gave more than 100 Ap R transformants per plate, others less than 10; 12 colonies were purified (1 from each transformation), plasmid D N A was prepared from each of them and analysed by agarose gel electrophoresis. Seven of the transformants contained plasmids that were larger than pMK155; one containing an 8.6-kb EcoRI insert was selected and denoted as pMK1551.

Subcloning of the ARS element from pMK1551

Plasmid pMK1551 (approximately 2 gg) was partially digested with Sau3AI to give fragments of average size 0.5 kb, and the 5' termini were dephosphorylated. The fragments were ligated with BamHI-digested pMK155 (1 gg), and the

qeq~

~J

t

H C

~

J

d

"

~

Fig. l a d .

G ~ ~

.~

'~

~ ~

I

"(

}" ~

< ~.

,(

~

~)fragmentnomenclature

•

t sequencing t strategy /

~- '( ~

•

I

I

I

I

I

I

I

I

I

I

0

0.2

0.4

0.6

0.8

1.0

1.2

1.4

1.6

1.8

I

2,0 kb

Restriction m a p of p M K t 2 2 . Plasmid pMK122 was constructed by subcloning a 1.2-kb Sau3AI fragment of C. albicans

10261 DNA from pMKI551 into the BarnHI site of plasmid pMK155, a Linear map of plasmid pMK122: thick line indicates pBR328 sequence, solid box indicates C. albicans 10261 genomic DNA conferring ARS element function, and hatched box indicates C. albicans 10261 DNA containing LEU2 gene. b Restriction map of 1.9-kb fragment (containing ARS element function) isolated from pMK122 by digestion with SalI. e Nomenclature of fragments obtained by cutting 1.9-kb insert with the PstI (G, H) or AccI (L J). d Summary of sequencing strategy

213 mixture was used to transform E. coli C600 to ampicillin resistance. Transformants (approximately 5000) were pooled, total plasmid prepared and used to transform S. cerevisiae AH22 to Leu +, thus selecting for plasmids capable of high-frequency transformation. Seven yeast Leu + transformants were obtained; plasmid was prepared from each and used to transform E. coli to ampicillin resistance. Transformants were screened for the presence of plasmid D N A using agarose gel electrophoresis, and those carrying plasmid larger than pMK155, but smaller than pMK1551, were retained. The smallest plasmid derivative obtained was estimated to be 6.8 kb, denoted pMK122, and consisted of a 1.2-kb Sau3AI fragment inserted into the B a m H I site of pMK155 (Fig. 1). Plasmid pMK122 behaved identically to pMK1551 in its ability to transform S. eerevisiae AH22 to Leu +. Yeast transformants carrying pMK122 were unstable under non-selective conditions and, provided that selection was maintained, pMK122 could be recovered from transformants by transforming E. coli to ampicillin resistance with a preparation of yeast D N A . Sequence analysis o f the 1.2 kb C. albicans D N A responsible f o r A R S element function

The 1.2-kb portion of C. albicans D N A responsible for A R S element function was removed from plasmid pMK122 in a 1.9-kb fragment after digestion with SalI (Fig. 1). This portion of D N A was ligated into the multiple cloning site of the M ] 3 sequencing vector m p l 0 and subjected to sequence analysis using the dideoxy chain termination method (Sanger et al. 1977). Directed sequencing from the internal restriction sites AccI, PstI and BarnHI was undertaken and combined with " s h o t g u n " cloning and sequencing of HpaII, AluI, RsaI and Sau3AI fragments (Fig. 1). The sequence of the 1.2-kb portion of C. albicans D N A between the B a m H I / S a u 3 A I sites is given in Fig. 2. Sequence analysis revealed the presence of two regions of 11 base pairs, both of which agreed with the consensus derived from A R S cores (5'~TTTAT~TTTA3 ') that function in S. cerevisiae (Broach et al. 1983). These two sequences (CaARS1 and CaARS2, boxed in Fig. 2) were identical, located on opposite strands, and were separated by 107 base pairs. Two regions of 11 base pairs were also identified where in each case 10 of the 11 base pairs matched the consensus (underlined in Fig. 2); in addition, seventeen 9/11 matches with the consensus were found (at each occurrence of a 9/11 match on Fig. 2, the middle base of the consensus core is marked on the 'T-rich' strand with an asterisk). It has been reported that in addition to the A R S core, an A R S box (5'TNT~AA3') located upstream of the core is also necessary for autonomous replication in S. cerevisiae (Marunouchi et al. 1987). One sequence upstream o f CaARS1 and two upstream of CaARS2 were located where in each case five out of six base pairs agreed with the consensus for the A R S box. In addition there is one sequence twelve base pairs downstream of C a A R S 2 which agrees exactly

I ii 21 31 41 51 GGATCATACCAAAAAAAAATCCGGGGTAGCGATGAGGTAGTGCAAGTTATACCAGAGAGC CCTAGTATGGTTTTTTTTTAGGCCCCATCGCTACTCCATCACGTTCAATATGGTCTCTCG 61 71 81 91 I01 Iii CTCAATTTGAACGTGGTACTGCACACAAACCGTAGCCCTAACCCTAATTAAATGCACGTG GAGTTAAACTTGCACCATGACGTGTGTTTGGCATCGGGATTGGGATTAATTTACGTGCAC 121 131 141 151 161 171 ACCCACACAATTTTCAACCACCAACAACACACCAAAAATGTATGTACACTCGGAGTGGAA TGGGTGTGTTAAAAGTTGGTGGTTGTTGTGTGGTTTTTACATACATGTGAGCCTCACCTT 181 191 201 211 221 231 AATATTTCCCCAGGCATAATTGTGGTTGCCAATTATAGTGGAGTGTTTGTTATTAGTATA TTATAAAGGGGTCCGTATTAACACCAACGGTTAATATCACCTCACAAACAATAATCATAT 241 251 :~ 261 271 281 291 GGAGTACTCCTTTTATGTGGAAAAATCGAAAAACATAAAACAGTGCAGCTATACACTAAC CCTGATGAGGAAAATACACCTTTTTAGCT~TTTGTATTTT~TCACGTCG~T~ATTG CQARS1

301 311 321 331 341 351 AAATG~-~-A--~CCATGGTCAGACAACACCAAACAACACACCCGTAATGGTTGGTTT~ TTTAC~ATAT~GGTACCAGTCTGTTGTGGTTTGTTGTGTGGGCATTACCAACCAAACCGA Accl

361 371 381 391CaARS2 4014 4411 _A~_-~TAGAGCATCTCATT~T~T~TTA~TTTATGTTTT~GATATTTTTAG~Ti~ATTT TTTATCTCGTAGAGTAAAACACATAATAAAATACAAAACCTATAAAAATCAAACTTTAAA 421-F~ 431 441 451 461 471 ATATAAAAATATTTTACTCCAATTTTCTTGCCAAATTTTGTACAAAAAGTAAAAAATAGA TATATTTTTATAAAATGAGGTTAAAAGAACGGTTTAAAACATGTTTTTCATTTTTTATCT 481 491% 501 511 521 531 ACTTCCAATTTTTGTTAAACAAACTTCAATCTAACAACCGGGATAGTGTTTGGGGGGCTG TGAAGGTTAAAAACAATTTGTTTGAAGTTAGATTGTTGGCCCTATCACAAACCCCCCGAC 541 551 561 571 581 ~ 591 TGTAACACCACTGGTGTAATAAAAGTGCCAATATTTGGAAATTAATTTTTTGGTGGTGGA ACATTGTGGTGACCACATTATTTTCACGGTTATAAACCTTTAATTAAAAAACCACCACCT 601 611 621 631 641 651 CGTTTCTTCCTAAAACACCTAGATGTGCTAGTATAATTGCACAACCAGCACGCACACTGC GCAAAGAAGGATTTTGTGGATCTACACGATCATATTAACGTGTTGGTCGTGCGTGTGACG 661

671

681

691

701

711

GTCTGGCCGGTCCTGGACTACATTTTGTCTCTAACATTCGTAG~ACTGCTAC~ CAGACCGGCCAGGACCTGATGTAAAACAGAGATTGTAAGCATC~ACGT~GTGACGATGTT Pstl 721 731 741 751 761 771 CCCATCAATGGCCACCCGGACATACATATTCCCGTTTTGTGCCACAGCCACCCAACTTTC GGGTAGTTACCGGTGGGCCTGTATGTATAAGGGCAAAACACGGTGTCGGTGGGTTGAAAG 781 791 801 811 821 831 CGGCTCAAAAAATGGCTCCACACAATTTGGGCACCCCGATTACCCCTCC~GAC GCCGAGTTTTTTACCGAGGTGTGTTAAACCCGTGGGGCTAATGGGGAGGG~ACGTC~CTG Pstl

841 851 861 871 881 891 AGCACATACACTTTGGTGGTTGTGGGGCTAGAGCCCTAAAAGTGAATTTGGTCACGTGAG TCGTGTATGTGAAACCACCAACACCCCGATCTCGGGATTTTCACTTAAACCAGTGCACTC 901

911

921

931

941

951

AGACAGCAGAT~GGTTCGCATTTTTTTATTTTTT(~GTTGCGGCCATATCTAGCAG~ TCTGTCGTCTATTCCAAGCGTAAAAAAATAAAAAA, G~CAACGCCGGTATAGATCGTCTTT 961 971 981 991 i001 i011 GCACCGTTCCCCGTTCGATCAACCGTAGTTAAGCTGCTAAGAGCAATACCGAGTAGTGTA CGTGGCAAGGGGCAAGCTAGTTGGCATCAATTCGACGATTCTCGTTATGGCTCATCACAT 1021....... 1031 1041 1051 1061 ~ 1071 GTGGGAGACCATACGCGAAACTATTGTGCTG CAAT C~ATTTTTTTTTAGTAACGTATATT CACCCT CTGGTATG CGCTTTGATAACACGACGTTAGA~AAAAAAAAATCATTGCATATAA 1081 .~ 1091 Ii01 iiii 1121 1131 TTTTTTTTGCATGAACCAAGGGTAATCGACCCTGCTCTATCCAGTGATGGTGATAAAGTT AAAAAAAACGTACTTGGTTCCCATTAGCTGGGACGAGATAGGTCACTACCACTATTTCAA 1141 1151 1161 1171 1181 1191 GGGTGGTGTCTAACAAAAAGGGGGAGAACCAGAGGGTGTATAAATAAGGAGAAG CTGGGA CCCACCACAGATTGTTTTTCCCCCTCTTGGTCTCCCACATATTTATTCCTCTTCGACCCT 1201 TCC AGG

Fig. 2. Nucleotide sequence of 1.2-kb C. albicans 10261 DNA from pMK122 responsible for ARS element function. The DNA was sequenced in Mr3 phage according to the strategy given in Fig. 1, using the dideoxy chain termination method of Sanger et al. (1977). Certain restriction sites are boxed and labelled. Identical matches with the consensus of ARS cores functional in S. cerevisiae are

boxed (CaARSt and CaARS2). 10/11 Matches with the consensus of ARS cores are underlined, and the middle base pair in 9/11 matches with the consensus of ARS cores is marked on the "Trich" strand with an asterisk. Sequences identical with, and approximating to, the consensus of ARS boxes are surrounded by a broken line. A 5S rRNA gene is enclosed in a heavy box

214 with the consensus of A R S boxes (putative A R S boxes are surrounded by a dotted line on Fig. 2). The region of D N A around CaARSI and CaARS2 is AT rich (69% of the 329 base pairs containing CaARS1, CaARS2, and 100 base pairs on either side of the A R S cores) which may facilitate localized D N A melting during the initiation of D N A replication. Comparison of the nucleotide sequence with the sequences contained in the EMBL database revealed the presence of 5S rDNA downstream of the PstI sites (heavy box on Fig. 2). The nucleotide sequence was identical to that for 5S rRNA from C. albicans MCRI COO/which had been obtained by direct sequencing of purified 5S rRNA (Chen et al. 1984). The 5S rDNA sequenced from ATCC 10261 showed a 90.1% homology to the 5S rRNA gene from C. utilis (Nishikawa and Takemura 1974) and 87.6% homology to the gene in S. cerevisiae (Skryabin et al. 1984). Transcription of the 5S rRNA gene would start at position 937 on Fig. 2; there is no recognizable promotor upstream of the start site and so there could be an internal promotor, as is the case for S. cerevisiae. There are no Sau3AI restriction enzyme sites between the CaARSs and the start of the 5S r R N A gene. Sequence homology of the ARS element and the 5S rDNA across yeast species The 1.9-kb SalI fragment from pMKI22 (containing the C. albicans CaARSs and 5S rDNA) was subcloned from M13 as fragments G, H, I and J using internal AccI and PstI restriction sites (Fig. 1). Sequence analysis of the fragments revealed which PstI site had been cleaved. Fragments G (containing 5S rDNA) and H (containing CaARSs) were purified, labelled with 35S by nick translation and used to probe Southern blots of EcoRI-digested fungal genomic D N A (Fig. 3). The Southern blots were washed under lowstringency conditions allowing approximately 30% mismatch. The hybridization of probe to high molecular weight D N A in the first four tracks is probably indicative of partially cut MI3 D N A in these lanes. Both probes G and H hybridized to multiple sites in the C. albicans genome, the majority of hybridization occurring at a broad band around 8.0 kb (Fig. 3). However, although probe G hybrid-

G H I

J O'O'O'-'co y

G H T J

0-%.

ized to multiple sites in the genomic DNAs of C. tropicalis and C. glabrata and to one major site in S. cerevisiae, probe H did not. Thus there is sequence homology of the rDNA, but not the A R S element, to other fungal DNAs. In addition sequence homology was found by hybridization between the C. albicans r D N A (probe G) and genomic D N A from C. pseudotropicalis B2455, C. krusei B2399 and C. parapsilosis MCC 499, but not with Mus (mouse) genomic D N A (data not shown). The Southern blots which had been probed with fragments G and H were washed at a higher stringency allowing less than 10% mismatch. There was no alteration in the hybridization pattern or the strength of the signal for the plasmid controls or the EcoRI digest of C. albicans DNA; however, there was no longer hybridization of probe G to C. glabrata or S. cerevisiae DNA, and the amount of probe bound to C. tropicalis D N A was reduced. This may reflect differences in the amount of homology between the 5S rRNA genes from these organisms. ARS element function in S. cerevisiae and C. albicans In order to localize the portion of the 1.2-kb fragment of C. albicans D N A responsible for replication in S. cerevisiae, a plasmid was constructed in which fragments G and I~ (Fig. 1) were tested for replicative function. Plasmid pRC3915 (Fig. 4) was constructed as described in the Materials and methods section and contained the C. albicans LEU2 gene, the URA3 gene and an intact multiple cloning site (mcs). Therefore replicative transformation of S. cerevisiae AH22 to Leu + and C. albicans SGY-243 to Ura + can be achieved with pRC3915 using the selectable LEU2 and URA3 genes respectively, provided that a functional A R S element is inserted into the mcs. The C. albieans D N A containing the A R S element and 5S rDNA was isolated as a 1.5-kb fragment from an M13 clone by digestion with HindIII and BamHI, and then ligated into the mcs of pRC3915 to form pRC3920 (Fig. 4). In this way the D N A containing the A R S element and rDNA was subcloned without the 0.4-kb portion of the LEU2 gene (Fig. 1). Digestion of the C. albicans insert with PstI generated fragments containing either the CaARSs or the 5S rDNA; the CaARS portion was inserted into the mcs ofpRC3915 to form pRC3925, and the 5S r D N A por-

•

kb

9.4 6.6 4.4 2.3 2.0

0.56 Probe G

Probe H

Fig. 3. Hybridization of 5S rDNA and ARS element to EcoRI-digested fungal DNAs. The 1.2-kb C. albicans 10261 DNA responsible for ARS element function was cut into fragments G, H, I and aT, as outlined in Fig. 1. Each fragment was isolated from an individual MI3 clone and separated from M13 DNA on an agarose gel (lanes G, H, I and J). Also run on each gel were EcoRI digests of genomic DNA from C. albicans 10261, C. tropicalis NHI 2389, C. (Torulopsis) glabrata CBS 138 and S. cerevisiae AH22. The gels were blotted onto nitrocellulose and probed with either 3sS nicktranslated fragment G (5S rDNA) or 35S nicktranslated fragment H (ARS element). The Southern blots were washed at low stringency allowing approximately 30% mismatch

215

.

I

IJR~A3

l

'xl~ "~'~-~S pRC3915

mcs i

joe

..,.,', * pRC3920

rDNA

9" pRC3925 pRC3930

rDNA

I

I

I

I

I

I

I

I

0

1.0

2.0

3.0

4.0

5.0

6.0

7.0

tion was inserted in pRC3915 to form pRC3930 (Fig. 4). Plasmids pRC3915, pRC3920, pRC3925 and pRC3930 were tested for their frequencies o f transformation of S. cerevisiae and C. albicans. S. cerevisiae AH22 was transformed to Leu + by pRC3920 (CaARSs plus r D N A ) at a frequency of 2.15 x 103 transformants per lag D N A (Table 1). The portion of D N A Table 1. Frequency of transformation of S. cerevisiae and C. albicans

Plasmid

Features

Transformants per microgram of transforming DNA S. cerevisiae

C. albicans

AH22"

SGY-243 b Small c Large d

pMK122 pCARS1 pRC3915 pRC3920 pRC3925 pRC3930

(LEU2, CaARSs, 2200 rDNA) (URA3, CARS1) ND (LEU2, URA3) 0 (LEU2, URA3, 2150 CaARSs, rDNA) (LEU2, URA3, 3080 CaARSs) (LEU2, URA3, 180 rDNA)

0

0

1050 0 1910

0 10 9

2300

5

0

12

ND, not determined Transformations were carried out with between 1.5 and 5.0 gg transforming DNA, and the figures given are the mean of at least two experiments a Transformation of S. eerevisiae AH22 to Leu + b Transformation of C. albicans SGY-243 to Ura + c Transformant colony size 0.2mm diameter after 4 days at 30°C

I

8.0 kb

Fig. 4. Map of plasmids pRC3915, pRC3920, pRC3925 and pRC3930. Portions of C. albicans 10261 DNA (solid box) containing rDNA, ARS core elements or both were inserted into the mcs of pRC3915 to form plasmids pRC3930, pRC3925 and pRC3920 respectively. Hatched box represents C. albieans DNA containing the LEU2 gene, open box is the URA3 gene from C. albicans. Open line represents pBR322 DNA

to left of the PstI sites (Fig. 1), containing the CaARSs (in pRC3925), transformed at a slightly higher frequency of 3.08 x 103 transformants per lag D N A , whereas the portion to the right of the PstI site (in pRC3930), containing the 5S r D N A , transformed at a very low frequency (180 transformants per lag DNA). The probing of a Southern blot of total D N A from S. cerevisiae transformants for the presence of free or integrated plasmid with nicktranslated pBR322 (which contains a sequence in c o m m o n with all plasmids used) showed that there was free plasmid present in all transformants (Fig. 5). N o integration of plasmid into S. cerevisiae chromosomal D N A was detected. Free, autonomously replicating plasmid was also demonstrated in cells transformed with pRC3920, pRC3925 and pRC3930 in that D N A prepared from these transformants transformed E. coli to ampicillin resistance. All S. cerevisiae transformants containing the p R C plasmids were unstable in the absence of selection; less than 1% retained the Leu + phenotype after approximately 15 generation times in medium containing leucine. Two sizes of transformant colonies were noted with C. albicans; the majority were 0.1-0.2 m m in diameter after 4 days, incubation at 30 ° C, but larger ones (1 m m diameter) were present at a lower frequency (approximately 10 per lag transforming DNA). It has been previously reported (Kelly et al. 1988) that SGY-243 transformed to Ura + with pCARS1 gave "typically small" colonies; the same authors, however, reported large transformant colonies when SGY-243 was cotransformed with linear D N A in addition to pCARS1. In the present study, a Southern analysis of D N A prepared from the large transformants revealed that the pBR322 probe associated with high molecular weight genomic D N A (Fig. 5, lane 11), whereas for D N A prepared from small transformants the probe bound to free plasmid (Fig. 5, lanes 9 and 10). The presence of free plasmid in small transformants was also demonstrated by the ability of D N A preparations to transform E. coli to ampicillin resistance. After growth for a period of approximately 15 generations in the absence of selective pres-

216 S.cerevisiae

C. albicans

transformants

transformants

,"< cb

09

c~

_@ cb

a

z~- Z~=

cb

cb

,,.

,7

b

kb

kb

23.1 - -

--23.1

9.4~

--

9.4

6.6--

--

6.6

4.4--

--

4.4

2,3 m

---

2.3 2.0

2.0-1

2

3

4

5

6

7

8

9

10

sure, only 19.2% of progeny from small transformants retained the Ura + phenotpye, whereas all progeny from large transformants stably inherited the Ura + phenotype. These data indicate that the large colonies are due to integrative transformation and the small colonies, to replicative transformation. Plasmid pRC3915 gave a hazy background of small C. albicans transformants which failed to grow and were nonviable on subculture. The low level of background growth may be due to abortive transformation or a very weak A R S element associated with the U R A 3 gene. There was a low frequency of large colonies with pRC3915, and the probe hybridized to high molecular weight D N A in these transformants, indicating that integration into chromosomal D N A had taken place (Fig. 5, lane 11). The pBR322 probe bound to genomic D N A from all C. albieans transformants to a certain degree, and this binding was not non-specific as it did not occur with D N A from untransformed SGY-243 (Fig. 5, lane 12). This indicates a low level of integration at the L E U 2 locus. A similar amount of D N A was loaded in each lane of the gel that was blotted; the strength of the signal from the pCARSI transformant (Fig. 5, lane 8) is consistent with the hypothesis proposed by Kurtz et al. (1987) that the plasmid pCARS1 forms head-to-tail multimeric oligomers. The frequency of replicative transformation with pRC3920 (1.91 x 1 0 3 transformants per pg DNA) was approximately twice that obtained with the plasmid pCARS 1. Plasmid pRC3925 gave a frequency of replicative transformation similar to that of pRC3920 (Table 1). In contrast, pRC3930 did not promote replicative transformation, confirming that it is the D N A associated with the CaARSs rather than the 5S r D N A that is required for replication in C. albicans.

11 12

Fig. 5a and b. Autoradiograms of Southern blot hybridizations of DNA preparations from a S. cerevisiae AH22 and b C. albicans SGY-243, probed with 35S nick-translated pBR322. Lanes 6, 7 and 13 contain uncut plasmid in closed circular and supercoiled form. The size markers (lambda DNA cut with HindII) are included to indicate where chromosomal DNA would run (approximately 23 kb) and cannot be used to determine plasmid sizes. Lane 5 contains DNA from untransformed S. cerevisiae AH22, and lane 12 contains DNA from untransformed C. albicans SGY-243. Lanes 9 and 10 contain DNA prepared from "small" transformant colonies, and lane 11 contains DNA prepared from a "large" transformant colony

13

Discussion

In S. cerevisiae there are 100-120 copies of the rRNA genes, and they form a single tandem array on chromosome XII with a repeat length of approximately 9 kb (Petes 1979; Warner 1982). The 5S rRNA genes vary only slightly between several yeast species (Chen et al. 1984), and the nontranscribed spacers (NTS) between the 5S and 35S rRNA transcripts from different Saccharomyces species have been shown to be homologous (Skryabin et al. 1984). Sequence analysis of the NTS region from S. cerevisiae and S. calsbergensis showed that they contained three sequences of 11 base pairs, each resembling the consensus of A R S cores (two 10/11 matches and one 8/11 match), located about 600 bp upstream of the start of the 5S rRNA gene (Skryabin et al. 1984). Other workers have shown that the rDNA region in S. eerevisiae contains a sequence capable of autonomous replication (Szostak and Wu 1979; Saffer and Miller 1986), and Linskens and Huberman (1988) have presented evidence showing that functional origins of replication colocalize with A R S elements. The organization of the CaARSs with respect to the 5S rRNA gene in C. albicans described in this study shows a marked similarity to the organization of the same region in S. cerevisiae with A R S core sequences in opposite orientations 538 bp from the start of a 5S rRNA gene (Fig. 2). We will consider in more detail, first, this similarity in organization of rDNA, and then, the sequences associated with replicative function in the two organisms. Probe G, which contained the C. albicans 5S rRNA gene, hybridized with a single E e o R I digest fragment (2.4 kb) of S. cerevisiae genomic D N A (Fig. 3). A similarly sized E e o R I fragment from S. cerevisiae contains the 5S

217 rRNA gene together with the NTS region and A R S core sequences (Philippsen et al. 1978; Skryabin et al. 1984). Probe H, however, which contained the C. albicans CaARSs, did not hybridize to the 2.4-kb fragment in S. cerevisiae (Fig. 3). This indicated that there was no substantial sequence homology between the NTS regions of C. albicans and S. cerevisiae. Probe G bound to several sites in the digest of C. albicans DNA, the major band approximating to 8.6 kb and corresponding to the 8.6-kb E c o R I fragment originally cloned in pMK1551. The strong hybridization signal indicated the presence of multiple copies of this sequence in the genome. The smallest prominent band to which probe G bound was 2.9 kb, and it is equivalent to the E c o R I fragment of chromosomal D N A containing the L E U 2 gene (Jenkinson et al. 1988), since probe G contained part of the L E U 2 gene from pMK122 (Fig 1). The L E U 2 gene of C. albicans does not show extensive sequence homology to genomic DNAs from any other yeast species tested (except C. maltosa; unpublished observations); thus, hybridization of probe G to other yeast DNAs in Fig. 3 was due only to homology of the 5S rDNA. The portion of C. albicans D N A responsible for conferring on pMK122 the property of autonomous replication in S. cerevisiae was localized to a region of 709 bp. Plasmid pRC3925, containing this fragment, transformed S. eerevisiae at a frequency of about 3 x 1 0 3 transformants per gg DNA. The fragment of D N A contained two sequences, denoted CaARSI and CaARS2, which agreed exactly with the A R S core consensus sequence that has been shown to be necessary, but alone not sufficient, for A R S activity in S. cerevisiae. Regions flanking A R S core sequences in S. cerevisiae have an effect on A R S function and plasmid stability (Srienc etal. 1985; Williamson 1985; Strich etal. 1986). Palzkill and Newlon (1988) suggest that near matches to the core consensus in the D N A 3' to the S. cerevisiae C2G3 A R S core (chromosome III) are required for A R S function; removal of all 9/11 matches in the 3' region resulted in complete loss of A R S function. Araki and Oshima (1989) showed that deletion of one t0/11 and three 9/11 matches in D N A 3' to the consensus A R S core in plasmid pSR1 of Zygosaccharomyces rouxii reduced plasmid stability. Nucleotide sequencing of the 1.2 kb C. albieans D N A in this paper reveals two exact matches to the A R S core consensus, two 10/11 matches (adjacent to the 5S rDNA) and seventeen 9/11 matches. Twelve of the 9/11 matches were clustered around the exact match CaARSs in a 248-bp portion from position 251 to position 498 in the base pair numbering on Fig. 2. Four of the 9/11 matches were close to the end of the 5S rRNA gene (positions 1054-1088, Fig. 2). In addition to the various A R S cores in the C. albicans D N A sequence, there are A R S "boxes", which Marunouchi et al. (1987) suggest are common to many A R S elements. There are several sequences that approximate to the consensus of A R S "boxes" adjacent to CaARS1 and CaARS2 (Fig. 2). This nucleotide sequence analysis provides information on an A R S element from a yeast other than S. cerevisiae. Although the same 709-bp sequence functioned as an A R S element in both organisms, it is likely that the exact requirements for A R S function in each organism differ. For example, Araki and Oshima (1989) identified a 30-bp sequence in pSR1 from Z. rouxii that functions as an A R S in both the native host and S. cerevisiae, but nucleotide substitution experiments showed that sequences required for A R S func-

tion in the two organisms were different. Despite the presence of two A R S core sequences and numerous nearmatches in the 709-bp fragment of C. albicans DNA, we have no evidence that these sequences are essential for A R S function in C. albicans. Indeed, the A R S core sequence alone is not sufficient for autonomous replication in C. albicans, since plasmid YEpl3 containing the 2-gin origin (including A R S core) does not replicate autonomously in C. albieans (Kurtz et al. 1986). Furthermore, the sequence responsible for the autonomous replication of pCARSI in C. albicans does not function in S. cerevisiae (Kurtz et al. 1987). Clearly, extensive analysis of the 709-bp fragment would be necessary to determine the various contributions that the many near-matches to the A R S core consensus made towards A R S element activity in S. cerevisiae and C. albicans. The fragment of C. albieans D N A (positions 710-1203, Fig. 2) containing the 5S rRNA gene, in pRC3930, also transformed S. cerevisiae, but at a lower frequency than the CaARSs-containing plasmids (Table 1). Transformation did not appear to be due to integration of the plasmid into the chromosome (Fig. 5), and free plasmid was detectable in transformants. This suggests that the near-matches to the A R S core adjacent to the 5S rRNA gene (Fig. 2) might act as weak origins in S. cerevisiae. C. albicans was transformed at a frequency of only 12 per gg of pRC3930, and all transformants were of "large colony type" due to integration of plasmid into the chromosome. Thus if the near matches to the A R S core consensus associated with the 5S rDNA act as weak A R S elements in S. cerevisiae, they are evidently not sufficient to promote autonomous replication in C. albicans. Integrative transformation of C. albicans, resulting in large transformant colonies, occurred with all pRC plasraids at approximately the same frequency. Integration probably took place at the L E U 2 locus since the URA3 gene is deleted in the host strain SGY-243. This integration could be circumvented by using a LEU2-deleted host constructed by gene disruption (Kelly et al. 1988). The isolation of a portion of genomic D N A from C. albicans that acts as an origin of replication in both S. cerevisiae and C. albicans will be useful in the development of transformation systems for C. albicans. More versatile shuttle vectors based on pRC3925 are being constructed to permit the study of expression of cloned genes in both C. albicans and S. cerevisiae. Acknowledgements. We thank Gillian Schep for undertaking some of the initial work on the isolation of ARS elements. This work was supported by the Medical Research Council of New Zealand. References

Araki H, Oshima Y (1989) An autonomously replicating sequence ofpSRI plasmid is effective in two yeast species, Zygosaceharomyces rouxii and Saccharomyces cerevisiae. J Mol Biol 207:757-769 Bachmann BJ (1972) Pedigrees of some mutant strains of Escherichia coli K-t2. Bacteriol Rev 36:525 557 Birnboim HC, Doly J (1979) A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acid Res 7:1513-1523 Broach JR, Li Y-Y, Feldman J, Jayaram M, Abraham J, Nasmyth KA, Hicks JB (1983) Localization and sequence analysis of yeast origins of DNA replication. Cold Spring Harbor Syrup Quant Biol 46:1165-1173

218 Chen M-W, Ann6 J, Volckaert G, Huysmans E, Vandenberghe A, De Wachter R (1984) The nucleotide sequences of the 5S rRNAs of seven molds and a yeast and their use in studying ascomycete phylogeny. Nucleic Acids Res 12: 4881-4892 Cryer DR, Eccleshall R, Marmur J (1975) Isolation of yeast DNA. Methods Cell Biol 12:39-44 Dagert M, Ehrlieh SD (1979) Prolonged incubation in calcium chloride improves the competence of Eseheriehia coli cells. Gene 6: 23-28 Das S, Kellermann E, Hollenberg CP (1984) Transformation of Kluyveromycesfragilis. J Bacteriol 158:1165-1167 Hinnen A, Hicks JB, Fink GR (1978) Transformation of yeast. Proc Natl Acad Sci USA 75:1929-1933 Holmes DS, Quigley M (1981) A rapid boiling method for the preparation of bacterial plasmids. Anal Biochem 114:193-197 Hsu WH, Magee PT, Magee BB, Reddy CA (1983) Construction of a new yeast cloning vector containing autonomous replicating sequences from Candida utilis. J Bacteriol 154:1033-1039 Jenkinson HF, Schep GP, Shepherd MG (1988) Cloning and expression of the 3-isopropyhnalate dehydrogenase gene from Candida albieans. FEMS Microbiol Lett 49:285-288 Kawamura M, Takagi M, Yano K (1983) Cloning of a LEU gene and an A R S site of Candida maltosa. Gene 24:157-162 Kearsey S (1984) Structural requirements for the function of a yeast chromosomal replicator. Cell 37:299-307 Kelly R, Miller SM, Kurtz MB, Kirsch DR (1987) Directed mutagenesis in Candida albicans: one-step gene disruption to isolate ura3 mutants. Mol Cell Biol 7:199-208 Kelly R, Miller SM, Kurtz MB (1988) One-step gene disruption by cotransformation to isolate double auxotrophs in Candida albicans. Mol Gen Genet 214: 24-31 Kurtz MB, Cortelyou MW, Kirsch DR (1986) Integrative transformation of Candida albieans, using a cloned Candida ADE2 gene. Mol Cell Biol 6:142-149 Kurtz MB, Cortelyou MW, Miller SM, Lai M, Kitsch DR (1987) Development of autonomously replicating plasmids for Candida albicans. Mol Cell Biol 7:209-217 Kurtz MB, Kirseh DR, Kelly R (1988) The molecular genetics of Candida albieans. Microbiol Sci 5 : 58-63 Linskens MH, Huberman JA (1988) Organization of replication of ribosomal DNA in Saeeharomyees eerevisiae. Mol Cell Biol 8:4927-4935 Magee PT, Rikkerink EHA, Magee BB (1988) Methods for the genetics and molecular biology of Candida albicans. Anal Biochem 175:361-372 Maniatis T, Fritsch EF, Sambrook J (1982) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Marunouchi T, Matsumoto Y, Hosoya H, Okabayashi K (1987) In addition to the ARS core, the ARS box is necessary for autonomously replicating sequences. Mol Gen Genet 206:60-65 Messing J, Vieira J (1982) A new pair of M13 vectors for selecting either DNA strand of double-digest restriction fragments. Gene 19 : 269-276 Newlon CS (1988) Yeast chromosome replication and segregation. Microbiol Rev 52:568-601 Nishikawa K, Takemura S (1974) Structure and function of 5S ribosomal ribonucleie acid from Torulopsis utilis. II. Partial digestion with ribonucleases and derivation of the complete sequence. J Biochem 76:935-947 Odds FC (1988) Candida and candidosis, 2nd ed. Bailli6re Tindall, London Palzkill TG, Newlon CS (1988) A yeast replication origin consists

of multiple copies of a small conserved sequence. Cell 53 : 441-450 Petes TD (1979) Yeast ribosomal DNA genes are located on chromosome XII. Proc Natl Acad Sci USA 76:4/0-414 Philippsen P, Thomas M, Kramer RA, Davis RW (1978) Unique arrangement of coding sequences for 5S, 5.8S, 18S and 25S ribosomal RNA in Saccharomyces cerevisiae as determined by R-loop and hybridization analysis. J Mol Biol 123:387-404 Rigby PWJ, Dieckmann M, Rhodes C, Berg P (1977) Labeling deoxyribonucleic acid to high specific activity in vitro by nick translation with DNA polymerase I. J Mol Biol 113:237-251 Saffer LD, Miller OL (1986) Electron microscopic study of Saccharomyces eerevisiae rDNA ehromatin replication. Mol Cell Biol 6 : 1148-1157 Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74:5463-5467 Skryabin KG, Eldarov MA, Larionov VL, Bayer AA, Klootwijk J, de Regt VCHF, Veldman GM, Planta R J, Georgiev OI, Hadjiolov AA (1984) Structure and function of the nontranscribed spacer regions of yeast rDNA. Nucleic Acids Res 12:2955-2968 Southern E (1979) Gel electrophoresis of restriction fragments. Methods Enzymol 68:152-176 Srienc F, Bailey JE, Campbell JL (1985) Effect of ARS1 mutations on chromosome stability in Saccharomyees cerevisiae. Mol Cell Biol 5 : 1676-1684 Staden R (1982) Automation of the computer handling of gel reading data produced by the shotgun method of DNA sequencing. Nucleic Acids Res 10:4731-4751 Stinchcomb DT, Struhl K, Davis RW (1979) Isolation and characterisation of a yeast chromosomal replicator. Nature 282 : 39-43 Stinchcomb DT, Thomas M, Kelly J, Selker E, Davis RW (1980) Eukaryotic DNA segments capable of autonomous replication in yeast. Proc Natl Acad Sci USA 77:4559-4563 Stockwell PA (1985) VTUTIN: a full screen gel management editor. Comput Appl Biosci 1 : 253-259 Strich R, Woontner M, Scott JF (1986) Mutations in ARS1 increase the rate of simple loss of plasmids in Saceharomyces cerevisiae. Yeast 2:169-178 Szostak JW, Wu R (1979) Insertion of a genetic marker into the ribosomal DNA of yeast. Plasmid 2:536-554 Takagi M, Kawai S, Chang MC, Shibuya I, Yano K (1986) Construction of a host-vector system in Candida maltosa by using an A R S site isolated from its genome. J Bacteriol 167:551-555 Van Solingen P, Van der Plaat JB (1977) Fusion of yeast spheroblasts. J Bacteriol 130:946-947 Vieira J, Messing J (1982) The pUC plasmids, an M13mp7-derived system for insertion mutagenesis and sequencing with synthetic universal primers. Gene 19: 259-268 Warner JR (1982) The yeast ribosome: structure, function, and synthesis. In: Strathern JN, Jones EW, Broach JR (eds) The molecular biology of the yeast Saecharomyces, metabolism and gene expression. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp 529-560 Whelan WL, Magee PT (1981) Natural heterozygosity in Candida albicans. J Bacteriol 145:896-903 Williamson DH (1985) The yeast ARS element, six years on: a progress report. Yeast 1 : 1-14 C o m m u n i c a t e d by W. Gajewski Received October 25, 1989